RH124784 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: RH124784

Symbol:

RH124784

Previously known as:

RGD ID:

5502415

Expected Size:

0 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	74,246,504 - 74,246,699 (+)	MAPPER	mRatBN7.2
mRatBN7.2	13	84,657,142 - 84,657,336 (+)	MAPPER	mRatBN7.2
Rnor_6.0	13	90,579,172 - 90,579,365	NCBI	Rnor6.0
Rnor_6.0	2	75,135,046 - 75,135,240	NCBI	Rnor6.0
Rnor_5.0	13	95,100,277 - 95,100,470	UniSTS	Rnor5.0
Rnor_5.0	2	94,862,783 - 94,862,977	UniSTS	Rnor5.0
RGSC_v3.4	2	75,231,325 - 75,231,519	UniSTS	RGSC3.4
RGSC_v3.4	13	88,187,002 - 88,187,195	UniSTS	RGSC3.4
Celera	13	84,268,567 - 84,268,760	UniSTS
Celera	2	70,008,198 - 70,008,392	UniSTS

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CTGCTGGATGGGGTCAAG
Reverse Primer	ACTGAGTATGAAAGTCCCTGTGG

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1308513	Dcaf8	DDB1 and CUL4 associated factor 8	13	84609838	84667025	Rat

Nucleotide Sequences


GenBank Nucleotide	FQ211524	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ225975	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH617894.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	1	101056920	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	1	101056920	Rat
1354666	Bp244	Blood pressure QTL 244	4.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	1	101056920	Rat
1581570	Eae17	Experimental allergic encephalomyelitis QTL 17	4.1		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	13	8897350	101631289	Rat
7207885	Glom27	Glomerulus QTL 27	3.9		kidney glomerulus integrity trait (VT:0010546)	kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)	13	20605871	101339738	Rat
1354621	Rf47	Renal function QTL 47	3.7		kidney renin amount (VT:0010559)	kidney renin level (CMO:0002166)	13	30395351	101056920	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	13	31241331	93395974	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	31241331	93395974	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	31241331	93395974	Rat
70181	BpQTLcluster11	Blood pressure QTL cluster 11	6.922		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	13	31241331	93395974	Rat
619615	Bp80	Blood pressure QTL 80		0.0354	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	39754544	84754544	Rat
12879444	Bp397	Blood pressure QTL 397			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	45049404	90049404	Rat
12879471	Bp398	Blood pressure QTL 398			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	45514719	90514719	Rat
12879441	Bp396	Blood pressure QTL 396			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	45699983	90699983	Rat
1298066	Bp159	Blood pressure QTL 159		0.004	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	46088046	91088046	Rat
71119	Thym2	Thymus enlargement QTL 2	3.8		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	13	46197976	84753113	Rat
1641901	Alcrsp6	Alcohol response QTL 6			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	13	52362171	97362171	Rat
1354655	Bp241	Blood pressure QTL 241	3.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	13	56056920	101056920	Rat
738026	Lnnr5	Liver neoplastic nodule remodeling QTL 5	3.29		liver integrity trait (VT:0010547)	liver remodeling tumorous lesion number (CMO:0001461)	13	59874408	85581182	Rat
12879475	Bp400	Blood pressure QTL 400			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	61825626	106807694	Rat
2293702	Bss34	Bone structure and strength QTL 34	4.61	0.0001	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	13	65103704	106807694	Rat
2293687	Bss26	Bone structure and strength QTL 26	4.6	0.0001	femur morphology trait (VT:0000559)	femur cross-sectional area (CMO:0001661)	13	65103704	106807694	Rat
8655945	Rf61	Renal function QTL 61	3.6		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	13	69060519	86800898	Rat
1331783	Bp221	Blood pressure QTL 221	3.72886		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	13	69060519	86800898	Rat
1300166	Kidm6	Kidney mass QTL 6	3.93		kidney mass (VT:0002707)	single kidney wet weight to body weight ratio (CMO:0000622)	13	69060519	86800898	Rat
8655959	Pur32	Proteinuria QTL 32	8.4		urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	13	74023918	97213863	Rat
738027	Lnnr6	Liver neoplastic nodule remodeling QTL 6	3.3		liver integrity trait (VT:0010547)	liver remodeling tumorous lesion number (CMO:0001461)	13	74862117	85581182	Rat
2293341	Glom15	Glomerulus QTL 15	9.1		kidney glomerulus integrity trait (VT:0010546)	kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)	13	74862117	101339893	Rat
4889606	Gluco63	Glucose level QTL 63	2.86	0.003	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	13	80753256	106807694	Rat
61355	Bp36	Blood pressure QTL 36	2.9		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	2	5873687	102844969	Rat
10402051	Gdil2	Gastrointestinal dilation QTL 2			enteric ganglion morphology trait (VT:0001045)	length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)	2	24903853	74786777	Rat
1302794	Stl27	Serum triglyceride level QTL 27	4.4	0.0001	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	2	25413423	143657569	Rat
1358894	Kidm24	Kidney mass QTL 24	4.03		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358899	Kidm23	Kidney mass QTL 23	3.88		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358901	Cm38	Cardiac mass QTL 38	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1358904	Cm39	Cardiac mass QTL 39	2.26		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1358910	Kidm27	Kidney mass QTL 27	5.77		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358911	Kidm28	Kidney mass QTL 28	5.42		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1358887	Bw50	Body weight QTL 50	2.39		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1358908	Bw49	Body weight QTL 49	3.36		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1354617	Bp240	Blood pressure QTL 240	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	26917817	81754745	Rat
1354617	Bp240	Blood pressure QTL 240	4		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	26917817	81754745	Rat
1354617	Bp240	Blood pressure QTL 240	4		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	26917817	81754745	Rat
1354603	Bp243	Blood pressure QTL 243	3.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	26917817	127469484	Rat
2290453	Scl55	Serum cholesterol level QTL 55	2.83		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	2	26917817	136917119	Rat
10755434	Coatc7	Coat color QTL 7		0.04794	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	2	30648065	75648065	Rat
10755436	Coatc8	Coat color QTL 8		0.02431	coat/hair pigmentation trait (VT:0010463)	pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)	2	35023117	80023117	Rat
61371	Edpm1	Estrogen-dependent pituitary mass QTL 1	4	0.05	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	35134841	88029593	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	2	40067944	102785628	Rat
70174	BpQTLCluster2	Blood pressure QTL cluster 2	4.24		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	2	40067944	102785628	Rat
2293835	Kiddil5	Kidney dilation QTL 5	3.8		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	157142209	Rat
2293843	Kiddil6	Kidney dilation QTL 6	3.1		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	182042367	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	43154682	202446871	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	43154682	202446871	Rat
2293676	Bmd19	Bone mineral density QTL 19	10.7	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	2	43162366	111362592	Rat
2293682	Bmd24	Bone mineral density QTL 24	8.9	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	2	43162366	111362592	Rat
2293671	Bss44	Bone structure and strength QTL 44	10.97	0.0001	lumbar vertebra morphology trait (VT:0010494)	lumbar vertebra cortical cross-sectional area (CMO:0001690)	2	43162366	148478373	Rat
631208	Bw1	Body weight QTL1	5.09		mesenteric fat pad mass (VT:0010427)	mesenteric fat pad weight to body weight ratio (CMO:0000654)	2	43171017	83575226	Rat
1354601	Slep1	Serum leptin concentration QTL 1	5.39		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	2	43171017	184114403	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	46123260	202447032	Rat
1354592	Rf50	Renal function QTL 50	3.5		urine output (VT:0003620)	timed urine volume (CMO:0000260)	2	53822747	74786777	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	56043031	202447032	Rat
6480225	Gdil1	Gastrointestinal dilation QTL 1			enteric ganglion morphology trait (VT:0001045)	length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)	2	56660879	74786777	Rat
1582246	Cm60	Cardiac mass QTL 60	5.8		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	57605612	76539510	Rat
1558648	Smcn1	Smooth muscle cell number QTL 1		0.039	blood vessel smooth muscle cell quantity (VT:0010525)	aorta smooth muscle cell count per unit vessel length (CMO:0001646)	2	59134147	127460910	Rat
5684990	Bmd82	Bone mineral density QTL 82	2.8		tibia mineral mass (VT:1000283)	bone mineral content (CMO:0001554)	2	59324377	103795077	Rat
5684996	Bmd85	Bone mineral density QTL 85	4.7	0.024	tibia mineral mass (VT:1000283)	bone mineral density (CMO:0001226)	2	59324377	103795077	Rat
61438	Cia7	Collagen induced arthritis QTL 7	4.6	0.0001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	2	59324377	141596857	Rat
631500	Bp99	Blood pressure QTL 99	2.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	59324719	102755241	Rat
1578777	Stresp15	Stress response QTL 15	2	0.05	blood aldosterone amount (VT:0005346)	plasma aldosterone level (CMO:0000551)	2	59846005	104846005	Rat
2306903	Bp336	Blood pressure QTL 336		0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	64366971	109366971	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118275	202447032	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118463	226797303	Rat
7411551	Bw131	Body weight QTL 131	29.6	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	2	67942638	112942638	Rat
1558653	Prcr1	Prostate cancer resistance QTL 1	5		prostate integrity trait (VT:0010571)	area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)	2	72532993	157142209	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
UniSTS	161606	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: RH124784