RH124242 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH124242

Symbol: RH124242
Previously known as:
RGD ID: 5502275
Expected Size: 104 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21206,629,181 - 206,629,285 (+)MAPPERmRatBN7.2
mRatBN7.2123,638,719 - 23,638,823 (+)MAPPERmRatBN7.2
mRatBN7.23136,915,508 - 136,915,612 (+)MAPPERmRatBN7.2
Rnor_6.01226,032,980 - 226,033,083NCBIRnor6.0
Rnor_6.0125,077,959 - 25,078,062NCBIRnor6.0
Rnor_5.01232,981,162 - 232,981,265UniSTSRnor5.0
Rnor_5.0126,536,032 - 26,536,135UniSTSRnor5.0
RGSC_v3.41212,432,493 - 212,432,596UniSTSRGSC3.4
RGSC_v3.4124,186,378 - 24,186,481UniSTSRGSC3.4
Celera122,350,730 - 22,350,833UniSTS
Celera1204,124,716 - 204,124,819UniSTS
Cytogenetic Map1q43UniSTS
Cytogenetic Map1p12UniSTS
Is Marker For: Genes:   Fth1   Best1   Fth1-ps4  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCACGTGACCAACTTACGC
Reverse Primer AGTCAGCTTATCTCTCATCACCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2467Cyp2b2cytochrome P450, family 2, subfamily b, polypeptide 218159453481608567Rat
2477Cyp2g1cytochrome P450, family 2, subfamily g, polypeptide 118214563582156862Rat
3078Men1menin 11203638905203644871Rat
3083Mfge8milk fat globule EGF and factor V/VIII domain containing1133064665133080069Rat
3461Pygmglycogen phosphorylase, muscle associated1203690550203705369Rat
71032Folr1folate receptor alpha1156219460156238436Rat
68415Ppp5cprotein phosphatase 5, catalytic subunit17769020377714507Rat
2082Akt2AKT serine/threonine kinase 218287722882933828Rat
69436Synj2synaptojanin 214651859446621919Rat
68948Bcat2branched chain amino acid transaminase 219604040796060008Rat
2146Aqp8aquaporin 81177993313177999158Rat
3641Scnn1gsodium channel epithelial 1 subunit gamma1176304942176338816Rat
3643Sctsecretin1196382857196383668Rat
3661Selenowselenoprotein W17659944176604514Rat
61811FcgrtFc gamma receptor and transporter19557443695584171Rat
61813Ftl1ferritin light chain 119593638795938234Rat
3934Scgb1a1secretoglobin family 1A member 11205977060205980610Rat
3627Clec11aC-type lectin domain containing 11A19480045694809002Rat
3631Scn1bsodium voltage-gated channel beta subunit 118635391786363820Rat
3859Thrspthyroid hormone responsive1151723415151727740Rat
68434Pde10aphosphodiesterase 10A15176574352218086Rat
619881Neu3neuraminidase 31154137732154148879Rat
619973Prss8serine protease 81182536229182540745Rat
2538Eef2keukaryotic elongation factor-2 kinase1175393119175456756Rat
62027Rps17ribosomal protein S171135295920135298506Rat
62035Cd37CD37 molecule19571917195724662Rat
620093Xylt1xylosyltransferase 11171643925171929774Rat
71075Itgadintegrin subunit alpha D1182759762182788422Rat
2735Grik5glutamate ionotropic receptor kainate type subunit 518060587880667896Rat
2955Kcnc1potassium voltage-gated channel subfamily C member 119690295396944744Rat
3727Sult2a6sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 617491109774962239Rat
3732Sod2superoxide dismutase 214763831847645163Rat
71092Csrp3cysteine and glycine rich protein 319852806798546647Rat
71097Timm10btranslocase of inner mitochondrial membrane 10B1159980525159983371Rat
2758Gstp1glutathione S-transferase pi 11201337762201340230Rat
2775H19H19 imprinted maternally expressed transcript1197730698197733374Rat
619771Cuzd1CUB and zona pellucida-like domains 11186089422186130536Rat
619772Epn1Epsin 116874249168760570Rat
619779AhnakAHNAK nucleoprotein1205882225205970934Rat
69053Lypd3Ly6/Plaur domain containing 318022644980230901Rat
2581Esr1estrogen receptor 114110633541499104Rat
61797Prknparkin RBR E3 ubiquitin protein ligase14868865149882520Rat
61804Map6microtubule-associated protein 61153568020153634415Rat
70074Trim3tripartite motif-containing 31159950921159973600Rat
2294Ccne1cyclin E119078194790791188Rat
2326CebpaCCAAT/enhancer binding protein alpha18775963187762303Rat
69332Ifitm2interferon induced transmembrane protein 21196051539196052719Rat
70553C5ar1complement C5a receptor 117694862276959826Rat
62088P2ry2purinergic receptor P2Y21155352050155367423Rat
67396Ceacam1CEA cell adhesion molecule 118104359581060050Rat
619960Prxperiaxin18278508282807154Rat
619965Adcy2adenylate cyclase 213437563934822252Rat
2156Arrb1arrestin, beta 11153837964153912111Rat
2169Atp1a3ATPase Na+/K+ transporting subunit alpha 318057279080601936Rat
2177Atp4aATPase H+/K+ transporting subunit alpha18596160785974972Rat
619888Rps3ribosomal protein S31153778363153783663Rat
61884Clns1achloride nucleotide-sensitive channel 1A1152019369152039670Rat
61887Pdcd2programmed cell death 215648494756490437Rat
2089Aldoaaldolase, fructose-bisphosphate A1181402275181407476Rat
2259Calm3calmodulin 317759066877597776Rat
61841Psma1proteasome 20S subunit alpha 11168442421168453440Rat
61859Gabra5gamma-aminobutyric acid type A receptor subunit alpha 51108268728108381670Rat
619895Dlg2discs large MAGUK scaffold protein 21144451653146503949Rat
2333Ceacam3CEA cell adhesion molecule 317786390777876441Rat
69247Kcnj11potassium inwardly-rectifying channel, subfamily J, member 1119659104896594574Rat
619905Slc7a9solute carrier family 7 member 918810951788132653Rat
620006Rin1Ras and Rab interactor 11202355729202362731Rat
3118Mt1-ps1metallothionein 1, pseudogene 11181132896181133270Rat
2783Hbbhemoglobin subunit beta1158250421158251832Rat
61951Lgals7galectin 718414861284152016Rat
61954Galgalanin and GMAP prepropeptide1200650439200655302Rat
70963Folh1folate hydrolase 11140428101140501563Rat
70971Hamphepcidin antimicrobial peptide18617092686172865Rat
3207Nras-ps1neuroblastoma RAS viral (v-ras) oncogene homolog , pseudogene 11157404959157406216Rat
3214Ntrk3neurotrophic receptor tyrosine kinase 31132116472132503849Rat
3250Pak1p21 (RAC1) activated kinase 11152111172152226390Rat
3262Pcpyruvate carboxylase1201799374201898412Rat
3440Pthparathyroid hormone1167508121167511530Rat
3448Ptpn5protein tyrosine phosphatase, non-receptor type 519762063897681186Rat
3909Tsg101tumor susceptibility 10119741268997442589Rat
61982Hpnhepsin18633708586352785Rat
61984Dmbt1deleted in malignant brain tumors 11185617469185696476Rat
70943Mrpl17mitochondrial ribosomal protein L171160162181160163870Rat
2869Igf1rinsulin-like growth factor 1 receptor1121549831121838548Rat
69322Gucy2dguanylate cyclase 2D1152739775152774474Rat
69414Glrx3glutaredoxin 31192241707192272012Rat
70332Hif3ahypoxia inducible factor 3 subunit alpha17771811077750448Rat
71015Ap2a2adaptor related protein complex 2 subunit alpha 21196652315196725609Rat
71021Parvaparvin, alpha1166547142166704958Rat
2639Fut2fucosyltransferase 219611954996139567Rat
2111Ampd3adenosine monophosphate deaminase 31164884823164929899Rat
2870Igf2insulin-like growth factor 21197814409197831802Rat
2899Il4rinterleukin 4 receptor1180115061180139981Rat
69330Echs1enoyl-CoA hydratase, short chain 11194895036194903863Rat
69305Nr2f2nuclear receptor subfamily 2, group F, member 21124008282124022521Rat
69306Fxyd1FXYD domain-containing ion transport regulator 118628716386291478Rat
2267Capn1calpain 11203275912203300848Rat
2134Apoc1apolipoprotein C117934705779350340Rat
2827HrasHRas proto-oncogene, GTPase1196290127196299823Rat
2829Plaat3phospholipase A and acyltransferase 31204782608204816397Rat
619729Lrp3LDL receptor related protein 318784381587859147Rat
619744Pgap2post-GPI attachment to proteins 21156591540156618116Rat
3046Mapk3mitogen activated protein kinase 31181366646181372863Rat
3087MgmtO-6-methylguanine-DNA methyltransferase1191710980191937760Rat
61868Dpf1double PHD fingers 118460221284615954Rat
61876Prap1proline-rich acidic protein 11194883078194886874Rat
3918TubTUB bipartite transcription factor1163008198163030958Rat
620028AxlAxl receptor tyrosine kinase18126508881296278Rat
620042Il18bpinterleukin 18 binding protein1156372923156374963Rat
620054Ppfia3PTPRF interacting protein alpha 319581711095845950Rat
620057PolgDNA polymerase gamma, catalytic subunit1133382764133399578Rat
620063Ilkintegrin-linked kinase1160088839160095140Rat
69285Cfl1cofilin 11202796012202801337Rat
69296Slc29a2solute carrier family 29 member 21202327641202335185Rat
69302Serpinh1serpin family H member 11153643500153650853Rat
70494Terttelomerase reverse transcriptase12963721329659561Rat
3006Lhbluteinizing hormone subunit beta19589826995901973Rat
2627Fosl1FOS like 1, AP-1 transcription factor subunit1202754549202763057Rat
2635Fth1ferritin heavy chain 11206627142206629430Rat
3750Spnsialophorin1181746937181759564Rat
3751Sptbn2spectrin, beta, non-erythrocytic 21202002970202045343Rat
3757Srd5a1steroid 5 alpha-reductase 113368606933720468Rat
3784Stx1bsyntaxin 1B1182415544182434385Rat
3786Abcc8ATP binding cassette subfamily C member 819659856896679563Rat
2013Acadsbacyl-CoA dehydrogenase, short/branched chain1186188939186227796Rat
61906Nr1h2nuclear receptor subfamily 1, group H, member 219504196795047358Rat
70895Lilrb2leukocyte immunoglobulin like receptor B216532683265334683Rat
3035Magmyelin-associated glycoprotein18614822786163726Rat
3832Tcp1t-complex 114782906147836809Rat
619938Nup62nucleoporin 6219529899595314902Rat
62003Bmal1basic helix-loop-helix ARNT like 11167331756167430235Rat
62014Nxf1nuclear RNA export factor 11205655442205668637Rat
62020Prmt1protein arginine methyltransferase 119545885395468176Rat
3123Muc2mucin 2, oligomeric mucus/gel-forming1196799494196831740Rat
3375Ppp1caprotein phosphatase 1 catalytic subunit alpha1201485117201488734Rat
3397Prkcgprotein kinase C, gamma16583285165860676Rat
69352Slc6a18solute carrier family 6 member 1812960728829621925Rat
69353Ech1enoyl-CoA hydratase 118411449484120788Rat
2926Itgamintegrin subunit alpha M1182659047182709501Rat
2254Calcacalcitonin-related polypeptide alpha1168878212168883176Rat
2386Cox8bcytochrome c oxidase, subunit VIIIb1195977183195978643Rat
2396Cpt1acarnitine palmitoyltransferase 1A1200564634200627059Rat
3888Klk1c2kallikrein 1-related peptidase C219449233294496480Rat
2047Admadrenomedullin1164745484164747655Rat
2969Klk1kallikrein 119464264494646760Rat
3003Lgals4galectin 418412476684132481Rat
68440Rps19ribosomal protein S1918048071880486511Rat
67398TbpTATA box binding protein15646333056480430Rat
2651Gabrb3gamma-aminobutyric acid type A receptor subunit beta 31108467047108702522Rat
68396Inppl1inositol polyphosphate phosphatase-like 11156183043156197500Rat
2315Cd81Cd81 molecule1198235861198251660Rat
2330CebpgCCAAT/enhancer binding protein gamma18768306087692772Rat
2689Giprgastric inhibitory polypeptide receptor17880428778814462Rat
62040Hpxhemopexin1159932819159940327Rat
62052Tnni3troponin I3, cardiac type16929990069303582Rat
62057Ltbp3latent transforming growth factor beta binding protein 31203029412203045975Rat
71051Bet1lBet1 golgi vesicular membrane trafficking protein-like1195931407195935072Rat
2196Bckdhabranched chain keto acid dehydrogenase E1 subunit alpha18113894681167765Rat
3212Ntf4neurotrophin 419589356095896391Rat
3231Ompolfactory marker protein1152440278152440828Rat
3234Oprm1opioid receptor, mu 114316005743413409Rat
3049Mas1MAS1 proto-oncogene, G protein-coupled receptor14787995647911500Rat
69363Nupr1nuclear protein 1, transcriptional regulator1181213292181215327Rat
69366Ldhclactate dehydrogenase C19738598497403382Rat
3895Tph1tryptophan hydroxylase 119715737597178415Rat
2442Ctf1cardiotrophin 11182328035182336346Rat
3601Rps5ribosomal protein S517353877673543073Rat
61993Plcb3phospholipase C beta 31204143257204160384Rat
3806Syt5synaptotagmin 516927735169285071Rat
3853Thtyrosine hydroxylase1198071500198078832Rat
70959Apoc4apolipoprotein C417933574579339942Rat
69360Sec11aSEC11 homolog A, signal peptidase complex subunit1134881448134909427Rat
620187Galpgalanin-like peptide16768402367703121Rat
628858Olr59olfactory receptor 591157193051157227707Rat
71007Prdx5peroxiredoxin 51204099826204103589Rat
620951Arhgef1Rho guanine nucleotide exchange factor 118049902680520954Rat
621019Stx4syntaxin 41182451108182459701Rat
621026Rps11ribosomal protein S1119560569095607798Rat
628826Muc6mucin 6, oligomeric mucus/gel-forming1196726678196764842Rat
620306Hbg1hemoglobin subunit gamma 11158271871158273426Rat
628713Sbk1SH3 domain binding kinase 11180807092180851910Rat
628807Cacng7calcium voltage-gated channel auxiliary subunit gamma 716580005965831246Rat
628808Cacng8calcium voltage-gated channel auxiliary subunit gamma 816575533465775567Rat
3175Klk1b3kallikrein 1-related peptidase B319470910594713308Rat
708435Ceacam4CEA cell adhesion molecule 418037666780382943Rat
708442Vom2r27vomeronasal 2 receptor, 2716610263166137116Rat
621169Syt9synaptotagmin 91161275882161456384Rat
628800Smim38small integral membrane protein 381200366561200371976Rat
621225Ppp4cprotein phosphatase 4, catalytic subunit1181392899181399703Rat
631380Zfp180zinc finger protein 18017965244179672737Rat
619842Pex11aperoxisomal biogenesis factor 11 alpha1133680091133687172Rat
619918Spon1spondin 11167929049168228239Rat
628819Trpc2transient receptor potential cation channel subfamily C member 21156460009156473039Rat
69326Arl2ADP-ribosylation factor like GTPase 21203434129203446156Rat
620511Crxcone-rod homeobox17653981276553694Rat
631336Itpkcinositol-trisphosphate 3-kinase C18250095782522533Rat
620030Nucb1nucleobindin 119596832595999183Rat
628677Hspbp1HSPA (Hsp70) binding protein 116916539469189062Rat
631424Itgalintegrin subunit alpha L1181918183181955735Rat
631429Myod1myogenic differentiation 119688486496887574Rat
632282Mrgprx3MAS related GPR family member X319772037797746953Rat
68358Acanaggrecan1132981582133044416Rat
727836Kir3dl1killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 116971552969754050Rat
727837Or6f2olfactory receptor family 6 subfamily F member 21194976929194977864Rat
621503Kcnq1potassium voltage-gated channel subfamily Q member 11198291711198624683Rat
61940Napsanapsin A aspartic peptidase19506472695077101Rat
621310Rhogras homolog family member G1156618713156630710Rat
621690Pou2f2POU class 2 homeobox 218068233080769756Rat
621695Gp2glycoprotein 21173797057173812619Rat
621739Foxi2forkhead box I21190222857190226657Rat
68378Bcambasal cell adhesion molecule (Lutheran blood group)17941501679429403Rat
727928Acsm4acyl-CoA synthetase medium-chain family member 41174053931174078345Rat
2358Ckmcreatine kinase, M-type17906139079071721Rat
2381Coq7coenzyme Q7, hydroxylase1172836359172851173Rat
2385Cox6a2cytochrome c oxidase subunit 6A21182788528182790746Rat
68340Or6a2olfactory receptor family 6 subfamily A member 21160827258160828241Rat
68343Mrpl23mitochondrial ribosomal protein L231197687452197695222Rat
621358Kcnc3potassium voltage-gated channel subfamily C member 319508096095095165Rat
2522Drd4dopamine receptor D41196396366196400824Rat
2746Grm5glutamate metabotropic receptor 51141310069141884980Rat
628830Myo7amyosin VIIA1152342611152414171Rat
628897Selenosselenoprotein S1119659779119669546Rat
619939Rps15aribosomal protein S15a1172420151172427021Rat
2740Grin2dglutamate ionotropic receptor NMDA type subunit 2D19630687196346994Rat
620902Mpc1mitochondrial pyruvate carrier 115243774552449399Rat
71059Hnrnplheterogeneous nuclear ribonucleoprotein L18409855884111568Rat
621293Atp2a1ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 11181026606181044859Rat
628638Rnf40ring finger protein 401182202475182217899Rat
621223Slc28a1solute carrier family 28 member 11135079375135122791Rat
628834Art5ADP-ribosyltransferase 51156473362156483324Rat
621788Gde1glycerophosphodiester phosphodiesterase 11173016984173032396Rat
621416Rabep2rabaptin, RAB GTPase binding effector protein 21181010305181026651Rat
620663Igsf6immunoglobulin superfamily, member 61175610167175620662Rat
620932Msx3msh homeobox 31194839041194842209Rat
621432Klc3kinesin light chain 317904584279055809Rat
620542Rbm14RNA binding motif protein 141202076940202105688Rat
621367Gab2GRB2-associated binding protein 21151429844151625708Rat
708409Vom2r18vomeronasal 2 receptor, 1816365133263668610Rat
708412Vom2r31vomeronasal 2 receptor, 3117118305571211273Rat
621398Rnh1ribonuclease/angiogenin inhibitor 11196269293196281763Rat
708512Slc1a5solute carrier family 1 member 517745684977470952Rat
620705Homer2homer scaffold protein 21135558977135659780Rat
620211Nrxn2neurexin 21203726420203842301Rat
620217Slc5a2solute carrier family 5 member 21182847185182853309Rat
620907Ppp2r1aprotein phosphatase 2 scaffold subunit A alpha16054022360559467Rat
620398Cyth2cytohesin 219628318296291094Rat
620244Trpm4transient receptor potential cation channel, subfamily M, member 419578180595812095Rat
621628Slc22a12solute carrier family 22 member 121203845039203852496Rat
628772Shank2SH3 and multiple ankyrin repeat domains 21199146210199590962Rat
628755Cavin3caveolae associated protein 31159826549159828138Rat
631376Egln2egl-9 family hypoxia-inducible factor 218245155482459809Rat
621405Hey2hes-related family bHLH transcription factor with YRPW motif 212682213126832218Rat
621410Slc5a11solute carrier family 5 member 111177735511177795193Rat
61936Slc22a2solute carrier family 22 member 214812106148163268Rat
620662Banf1BAF nuclear assembly factor 11202672170202674215Rat
708561Afdnafadin, adherens junction formation factor15390534454034216Rat
628696Zfp689zinc finger protein 6891182065885182074343Rat
628697Rpl13aribosomal protein L13A19560937495612557Rat
628700FaddFas associated via death domain1199743200199745746Rat
628701Macrod1mono-ADP ribosylhydrolase 11204246238204387027Rat
628702Ppp1r14bprotein phosphatase 1, regulatory (inhibitor) subunit 14B1204165210204167320Rat
628727Hsd3b7hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 71182412216182415447Rat
621288Ncr1natural cytotoxicity triggering receptor 116961474469622594Rat
620101Slc17a7solute carrier family 17 member 719564970995661591Rat
62001Muc5acmucin 5AC, oligomeric mucus/gel-forming1196864336196896475Rat
68325Ighmbp2immunoglobulin mu DNA binding protein 21200506641200529293Rat
2445Ctsccathepsin C1142028386142059841Rat
632284Mrgprx1MAS related GPR family member X119780609997807070Rat
620830Fxyd7FXYD domain-containing ion transport regulator 718627767886286954Rat
620931Rab4bRAB4B, member RAS oncogene family18246139682472784Rat
620933Dctpp1dCTP pyrophosphatase 11181877440181880833Rat
621424Lig1DNA ligase 117416568874204400Rat
708478MrgprfMAS related GPR family member F1200464100200473588Rat
621511Ctsdcathepsin D1197527467197539343Rat
69236Lsrlipolysis stimulated lipoprotein receptor18618576986201952Rat
632286Slc22a8solute carrier family 22 member 81205496331205516378Rat
620460Nphs1NPHS1 adhesion molecule, nephrin18572081285749079Rat
621523Nkg7natural killer cell granule protein 719384474893845975Rat
620150Gapdhsglyceraldehyde-3-phosphate dehydrogenase, spermatogenic18597909685994153Rat
620173Tgfb1i1transforming growth factor beta 1 induced transcript 11182828553182835465Rat
620175Fgf21fibroblast growth factor 2119608336096084911Rat
620553Ptprhprotein tyrosine phosphatase, receptor type, H16924370469276294Rat
61930Sart1spliceosome associated factor 1, recruiter of U4/U6.U5 tri-snRNP1202690472202699136Rat
61932Fahfumarylacetoacetate hydrolase1138548830138571599Rat
621719Calycalcyon neuron-specific vesicular protein1194862671194873861Rat
727784Tskstestis-specific serine kinase substrate19541431295441670Rat
727786Ppp2r5bprotein phosphatase 2, regulatory subunit B', beta1203527268203535442Rat
727787Hs3st2heparan sulfate-glucosamine 3-sulfotransferase 21175956161176077400Rat
628752Rab38RAB38, member RAS oncogene family1142182566142262923Rat
2916Ins2insulin 21197843277197992522Rat
621647Vipvasoactive intestinal peptide14206487842073219Rat
620132Sh2b1SH2B adaptor protein 11181048622181057036Rat
620133Cib1calcium and integrin binding 11134178331134183895Rat
621102Psmc4proteasome 26S subunit, ATPase 418334912783357497Rat
620188Ap2s1adaptor related protein complex 2 subunit sigma 117741749677428903Rat
620576CdiptCDP-diacylglycerol--inositol 3-phosphatidyltransferase1181583098181587409Rat
620578Sh3gl3SH3 domain containing GRB2 like 3, endophilin A31136124500136255669Rat
621557Sdhasuccinate dehydrogenase complex flavoprotein subunit A12893596528960936Rat
621603Hint3histidine triad nucleotide binding protein 312703593627045799Rat
621614Plekhb1pleckstrin homology domain containing B11154998798155013094Rat
619823Xrcc1X-ray repair cross complementing 118014049580168705Rat
3274Furinfurin (paired basic amino acid cleaving enzyme)1134348142134361182Rat
621590Taok2TAO kinase 21181475708181494738Rat
620722Zfp36zinc finger protein 3618366908483671564Rat
735035Lgi4leucine-rich repeat LGI family, member 418629453986305909Rat
621449Kcnk4potassium two pore domain channel subfamily K member 41204117941204129494Rat
620943Crymcrystallin, mu1174560423174575660Rat
620518Doc2adouble C2 domain alpha1181457415181462528Rat
621852Tnnt1troponin T1, slow skeletal type16930636269316721Rat
620103BadBCL2-associated agonist of cell death1204133502204142829Rat
621752Lnpepleucyl and cystinyl aminopeptidase15825864258355532Rat
3419Klk6kallikrein related-peptidase 619427886394286136Rat
620531Slc17a6solute carrier family 17 member 61101212489101252543Rat
620536Ppp1r14aprotein phosphatase 1, regulatory (inhibitor) subunit 14A18458312784590743Rat
620538Ppp1r14cprotein phosphatase 1, regulatory (inhibitor) subunit 14c13977340339886970Rat
620546Syne1spectrin repeat containing nuclear envelope protein 114151214641983382Rat
620476Rasgrp4RAS guanyl releasing protein 418443303384452841Rat
619916Agpat41-acylglycerol-3-phosphate O-acyltransferase 414852513148633798Rat
619716Sv2bsynaptic vesicle glycoprotein 2b1128978471129152479Rat
68399Syt8synaptotagmin 81197588126197593598Rat
708526Asrgl1asparaginase and isoaspartyl peptidase 11206006103206027115Rat
2464Cyp2a2cytochrome P450, family 2, subfamily a, polypeptide 218226383382289487Rat
2342Chrm1cholinergic receptor, muscarinic 11205567226205583001Rat
620975Usf2upstream transcription factor 2, c-fos interacting18617470386185942Rat
621724Oatornithine aminotransferase1187347862187367644Rat
71086Krtdapkeratinocyte differentiation associated protein18603829686041594Rat
2348Chrna7cholinergic receptor nicotinic alpha 7 subunit1116711559116837269Rat
621450Kcnk6potassium two pore domain channel subfamily K member 618452561384533948Rat
628749Yif1aYip1 interacting factor homolog A, membrane trafficking protein1202394923202399125Rat
620987Naaladl1N-acetylated alpha-linked acidic dipeptidase-like 11203400632203414195Rat
620988Rtn3reticulon 31204612675204669212Rat
620997Calcbcalcitonin-related polypeptide, beta1168965383168970259Rat
620998Nell1neural EGFL like 1199709305100573872Rat
2991Anpepalanyl aminopeptidase, membrane1133767332133810137Rat
2996Ldhalactate dehydrogenase A19737182397381247Rat
621748Gpha2glycoprotein hormone subunit alpha 21203525952203527271Rat
628803Cacng3calcium voltage-gated channel auxiliary subunit gamma 31177201361177297019Rat
628806Cacng6calcium voltage-gated channel auxiliary subunit gamma 616573291065747377Rat
2463Cyp2a1cytochrome P450, family 2, subfamily a, polypeptide 118223161182244887Rat
621161Ezrezrin14696796147011505Rat
708576Syt17synaptotagmin 171172695275172761906Rat
621193Rpl28ribosomal protein L2816905214869054735Rat
621205Zfp260zinc finger protein 26018533656785349896Rat
619839Cttncortactin1199599710199635254Rat
619843Gpr26G protein-coupled receptor 261186766001186805435Rat
628866Npas4neuronal PAS domain protein 41202281260202298681Rat
628872Kcnj14potassium inwardly-rectifying channel, subfamily J, member 1419629315996300810Rat
620771Ptpreprotein tyrosine phosphatase, receptor type, E1190344331190494815Rat
620506Gmfgglia maturation factor, gamma18372879783739189Rat
727955Ldhal6blactate dehydrogenase A-like 6B14599784545999268Rat
61938FauFAU ubiquitin like and ribosomal protein S30 fusion1203350226203351741Rat
621061Kat5lysine acetyltransferase 51202895751202903178Rat
621092Psmb1proteasome 20S subunit beta 115644243256463544Rat
621094Emp3epithelial membrane protein 319638865196391946Rat
621475Il11interleukin 1116906982969076129Rat
621476Kcnn4potassium calcium-activated channel subfamily N member 417995638079974354Rat
621481Sirt2sirtuin 218405388384076975Rat
621482Lim2lens intrinsic membrane protein 219383759793843769Rat
708549Nlrp6NLR family, pyrin domain containing 61196004854196011615Rat
2334Psg19pregnancy specific glycoprotein 1917842118378431449Rat
620671Deaf1DEAF1 transcription factor1196401857196435541Rat
620676Rps6ka2ribosomal protein S6 kinase A215263158252906739Rat
620645Sf1splicing factor 11203670016203683432Rat
621011Shank1SH3 and multiple ankyrin repeat domains 119480787994857356Rat
68372Ctbp2C-terminal binding protein 21187782064187918115Rat
68384Ccnd1cyclin D11200089002200098524Rat
620269P2ry6pyrimidinergic receptor P2Y61155295110155330610Rat
621769Dhcr77-dehydrocholesterol reductase1199015081199031055Rat
727795Tfb1mtranscription factor B1, mitochondrial14411524044161737Rat
727798Trmt11tRNA methyltransferase 11 homolog12705443727109765Rat
727892Cdkn1ccyclin-dependent kinase inhibitor 1C1198655394198658097Rat
61943Pde3bphosphodiesterase 3B1168606762168770078Rat
61944Chkacholine kinase alpha1201076804201125517Rat
619799Vegfbvascular endothelial growth factor B1204172297204178046Rat
621429Pglyrp1peptidoglycan recognition protein 117853181578537001Rat
727893Akap13A-kinase anchoring protein 131129313183129619647Rat
727895Ldaf1lipid droplet assembly factor 11174484438174503037Rat
621054Picalmphosphatidylinositol binding clathrin assembly protein1144056415144138045Rat
1304666Paip2l1polyadenylate-binding protein-interacting protein 2-like 11179077576179079040Rat
1304682Sptbn4spectrin, beta, non-erythrocytic 418265075082738345Rat
2135Apoc2apolipoprotein C217932942979334397Rat
620985Ust5rintegral membrane transport protein UST5r1205210558205286868Rat
2809Foxa3forkhead box A317866206778672321Rat
62086Acsm3acyl-CoA synthetase medium-chain family member 31174133260174159966Rat
1303192Klk1c12kallikrein 1-related peptidase C1219437810394382140Rat
621048Gtf3c1general transcription factor IIIC subunit 11180203995180270201Rat
621384Kcne3potassium voltage-gated channel subfamily E regulatory subunit 31154523903154530865Rat
621391Slco2b1solute carrier organic anion transporter family, member 2b11153959288154007294Rat
1303214Emc10ER membrane protein complex subunit 1019498026094988847Rat
1303220Klk1c6kallikrein 1-related peptidase C619446762694475842Rat
621526Ppp1r15aprotein phosphatase 1, regulatory subunit 15A19600005396003128Rat
620346Zg16zymogen granule protein 161181657722181660079Rat
621166Lmo1LIM domain only 11163132338163168521Rat
1304580Syne4spectrin repeat containing nuclear envelope family member 418556940985573775Rat
619844Cnga4cyclic nucleotide gated channel subunit alpha 41159752357159756369Rat
619856Trdntriadin12395565124410494Rat
1303154rnf141ring finger protein 1411164933972164957081Rat
621002Rabac1Rab acceptor 118056402980567164Rat
620638Cox8acytochrome c oxidase subunit 8A1204402118204404439Rat
69235Htra1HtrA serine peptidase 11185497815185547380Rat
620329Dgat2diacylglycerol O-acyltransferase 21153454078153484432Rat
1304920Ubqln3ubiquilin 31158604629158607318Rat
1304930Cnih2cornichon family AMPA receptor auxiliary protein 21202399416202405110Rat
621631Ascl3achaete-scute family bHLH transcription factor 31163755306163755951Rat
62050Tnni2troponin I2, fast skeletal type1197595012197597554Rat
70949Dll1delta like canonical Notch ligand 115631206256320177Rat
1304811Tmc4transmembrane channel-like 416553977765551683Rat
1304812Fchsd2FCH and double SH3 domains 21155444471155685350Rat
3640Scnn1bsodium channel epithelial 1 subunit beta1176430063176484451Rat
621127Dpp3dipeptidylpeptidase 31202204683202228501Rat
2192BaxBCL2 associated X, apoptosis regulator19594000195945407Rat
1303242Klk10kallikrein related-peptidase 1019423453694239369Rat
1303245Rtn2reticulon 217893505678948069Rat
2270Capns1calpain, small subunit 118544461385454861Rat
2727Gpiglucose-6-phosphate isomerase18682821186856077Rat
620194Slc8a2solute carrier family 8 member A217681658376852928Rat
2382Coro1bcoronin 1B1201442977201448416Rat
708528Has1hyaluronan synthase 115869341158705653Rat
2871Igf2rinsulin-like growth factor 2 receptor14797910948067501Rat
1305803Snx15sorting nexin 151203417029203426173Rat
1305167Fsd2fibronectin type III and SPRY domain containing 21135484002135522517Rat
1306710Pitpnm1phosphatidylinositol transfer protein, membrane-associated 11201394099201407523Rat
621296Tpp1tripeptidyl peptidase 11160097984160104108Rat
620084Capn5calpain 51152416252152472923Rat
3767Sult1a1sulfotransferase family 1A member 11181272022181276750Rat
1303027C5ar2complement C5a receptor 217693038176945432Rat
1303085Nop53NOP53 ribosome biogenesis factor17662908476636902Rat
1304831Il4i1interleukin 4 induced 119529945795324564Rat
1304836Gatd1glutamine amidotransferase class 1 domain containing 11196504533196512561Rat
1304686Eif1adeukaryotic translation initiation factor 1A domain containing1202674362202679662Rat
1303204Arfip2ADP-ribosylation factor interacting protein 21159974255159980398Rat
620845Apba2amyloid beta precursor protein binding family A member 21118053270118286858Rat
620730Lin7blin-7 homolog B, crumbs cell polarity complex component19584688895849628Rat
619778Nav2neuron navigator 219895762999322339Rat
628627Cyp2b3cytochrome P450, family 2, subfamily b, polypeptide 318165276281732153Rat
628637PycardPYD and CARD domain containing1182601657182603013Rat
1303171Clcf1cardiotrophin-like cytokine factor 11201507763201517607Rat
1303184Sipa1signal-induced proliferation-associated 11202938532202950672Rat
1307341Capn12calpain 1218417105984183161Rat
621554Hspb6heat shock protein family B (small) member 618580689885809072Rat
3224Slc22a1solute carrier family 22 member 114807665748103679Rat
621104Slc22a25solute carrier family 22, member 251205338698205498486Rat
620126Fgf3fibroblast growth factor 31200001162200005539Rat
621792Actn3actinin alpha 31202159081202175012Rat
621599Stip1stress-induced phosphoprotein 11204209433204228452Rat
69269SnurfSNRPN upstream open reading frame1111101327111123634Rat
735136Tcirg1T-cell immune regulator 1, ATPase H+ transporting V0 subunit A31201127034201138787Rat
727872Synmsynemin1121333712121363652Rat
3351Plin1perilipin 11133664294133676854Rat
619737Rab6aRAB6A, member RAS oncogene family1154957870155008922Rat
620595Zfp111zinc finger protein 11117976289779774274Rat
620597Plaurplasminogen activator, urokinase receptor18005344080068384Rat
620600Nox4NADPH oxidase 41140900886141078844Rat
620605Zp2zona pellucida glycoprotein 21174513507174525288Rat
708406Vom2r40vomeronasal 2 receptor, 401139409429139457552Rat
727835Myadmmyeloid-associated differentiation marker16586418065874701Rat
708504Arid1bAT-rich interaction domain 1B14556799145923644Rat
620227Slco3a1solute carrier organic anion transporter family, member 3a11128106232128388043Rat
621672Slc7a10solute carrier family 7 member 1018782908487845073Rat
621887NfkbibNFKB inhibitor beta18404629284053862Rat
3883Tnnt3troponin T3, fast skeletal type1197652535197669736Rat
3073Slc3a2solute carrier family 3 member 21205604468205618931Rat
1304823Kdm8lysine demethylase 81180013969180028829Rat
620808Gng8G protein subunit gamma 817756451277568371Rat
1304946Vom2r26vomeronasal 2 receptor, 2616512947565166916Rat
2491DbpD-box binding PAR bZIP transcription factor19617579696180745Rat
620333Pafah1b3platelet-activating factor acetylhydrolase 1b, catalytic subunit 318088126380883789Rat
735133Plekha4pleckstrin homology domain containing A419600582496028826Rat
620883MiaMIA SH3 domain containing18247367782476378Rat
620888Nucb2nucleobindin 21170750830170787356Rat
628612Bles03basophilic leukemia expressed protein BLES031202734555202736809Rat
628613Ffar1free fatty acid receptor 118611136886112272Rat
1302961Scgb1d4secretoglobin family 1D member 41206330454206333329Rat
1302964Tsga10iptestis specific 10 interacting protein1202700576202714668Rat
1304950Il21rinterleukin 21 receptor1180168028180195690Rat
1304956Ebf3EBF transcription factor 31191996726192114593Rat
1304959Rdh13retinol dehydrogenase 1316937301469401454Rat
708385Zfp382zinc finger protein 38218537761485400832Rat
708398Vom2r32vomeronasal 2 receptor, 3217167425071693744Rat
69051Tgfb1transforming growth factor, beta 118119653281212848Rat
3940Umoduromodulin1173816341173829681Rat
621290Cd151CD151 molecule (Raph blood group)1196564744196568753Rat
2062Grk2G protein-coupled receptor kinase 21201580823201601580Rat
1559143Zscan5bzinc finger and SCAN domain containing 5B16766668467674238Rat
3720Slc9a3solute carrier family 9 member A312912463329167912Rat
620403Ccscopper chaperone for superoxide dismutase1202113792202134931Rat
735078Lamtor1late endosomal/lysosomal adaptor, MAPK and MTOR activator 11156272116156277687Rat
735174Cyp2b21cytochrome P450, family 2, subfamily b, polypeptide 2118188609781915066Rat
3715Slc6a3solute carrier family 6 member 312970944329750413Rat
727805Klk1c9kallikrein 1-related peptidase C919459735994601245Rat
620800Bnip3BCL2 interacting protein 31193708164193725348Rat
620802Latlinker for activation of T cells1180936536180941561Rat
2611Fgfr2fibroblast growth factor receptor 21184745418184850655Rat
2638Fut1fucosyltransferase 119608693496090352Rat
620965Pde2aphosphodiesterase 2A1155823590155915434Rat
620855NapaNSF attachment protein alpha17678703676805869Rat
620861Copb1COPI coat complex subunit beta 11168404334168438589Rat
620862Sycnsyncollin18382383683833542Rat
620976UST4rintegral membrane transport protein UST4r1205072204205142718Rat
621337Sult2a1sulfotransferase family 2A member 117545117875508113Rat
1304591Art1ADP-ribosyltransferase 11156478096156487172Rat
621306Snrpnsmall nuclear ribonucleoprotein polypeptide N1111101327111123400Rat
3352Plk1polo-like kinase 11176716420176726400Rat
620351Gsk3aglycogen synthase kinase 3 alpha18081584380825732Rat
620839TfptTCF3 fusion partner16558763365597407Rat
621817Pola2DNA polymerase alpha 2, accessory subunit1203227183203251350Rat
621824Slc6a5solute carrier family 6 member 519964538999697016Rat
1304722Cadm4cell adhesion molecule 418007516380097423Rat
621027Rps13ribosomal protein S131170572925170575355Rat
621031Rps16ribosomal protein S1618364306683646056Rat
621775Rplp2ribosomal protein lateral stalk subunit P21196546086196548636Rat
621790Exoc3exocyst complex component 312909129829122056Rat
70954Ceacam9CEA cell adhesion molecule 917740561977410154Rat
620674Taldo1transaldolase 11196493634196503965Rat
2475Cyp2e1cytochrome P450, family 2, subfamily e, polypeptide 11195840330195850728Rat
620289Trim28tripartite motif-containing 2817365244173659388Rat
2193Bc1brain cytoplasmic RNA 11200073610200073763Rat
708483Mark2microtubule affinity regulating kinase 21204461029204526247Rat
1306831Stim1stromal interaction molecule 11156656246156818777Rat
1306836Rnf217ring finger protein 21712601666826108736Rat
1306813Acsm1acyl-CoA synthetase medium-chain family member 11173985715174020565Rat
1306820Edrf1erythroid differentiation regulatory factor 11188441514188478743Rat
1306821Myh14myosin heavy chain 1419509626695158861Rat
2122Apbb1amyloid beta precursor protein binding family B member 11159896889159920505Rat
621463Wnt11Wnt family member 111153134503153154294Rat
3010Lipelipase E, hormone sensitive type18096561280984313Rat
3813PvrPVR cell adhesion molecule17956129479576700Rat
621735Gabrg3gamma-aminobutyric acid type A receptor subunit gamma 31107627450108247483Rat
735205Arl6ip1ADP-ribosylation factor like GTPase 6 interacting protein 11172430475172439990Rat
735118Lcmt1leucine carboxyl methyltransferase 11177904119177960111Rat
620268Abcc6ATP binding cassette subfamily C member 619644722496501464Rat
620827Fxyd5FXYD domain-containing ion transport regulator 518626793786277329Rat
2138Apoeapolipoprotein E17935392479357852Rat
69257Aplp1amyloid beta precursor like protein 118569688085707215Rat
620086Cyp2t1cytochrome P450, family 2, subfamily t, polypeptide 118244632182451564Rat
735224Nudt22nudix hydrolase 221204182797204186421Rat
71033Nup98nucleoporin 98 and 96 precursor1156494423156591415Rat
3933Ucp3uncoupling protein 31154815777154828764Rat
620805Gng3G protein subunit gamma 31205731837205733603Rat
727801Nadsyn1NAD synthetase 11198981559199009853Rat
621876Syt12synaptotagmin 121201729307201760192Rat
620504Cdhr5cadherin-related family member 51196373110196381609Rat
621182Rpl18ribosomal protein L1819618881196191452Rat
621373Tex101testis expressed 10118025507680259442Rat
619889Rps9ribosomal protein S916551172365515076Rat
735199Yif1bYip1 interacting factor homolog B, membrane trafficking protein18453967384549906Rat
1304637Lto1LTO1 maturation factor of ABCE11200074247200080951Rat
620142Chrna10cholinergic receptor nicotinic alpha 10 subunit1156487279156494277Rat
61816Actn4actinin alpha 418418278384251867Rat
1304579Trim5tripartite motif-containing 51158720407158737393Rat
1303329Ush1cUSH1 protein network component harmonin19669530396743671Rat
1303331Pnkppolynucleotide kinase 3'-phosphatase19534146595346921Rat
1303312Etfbelectron transfer flavoprotein subunit beta19385190893866072Rat
2465Cyp2a3cytochrome P450, family 2, subfamily a, polypeptide 318217191482179980Rat
1304658Tenm4teneurin transmembrane protein 41149895097151263315Rat
2466Cyp2b1cytochrome P450, family 2, subfamily b, polypeptide 118151838781544999Rat
735123Spint2serine peptidase inhibitor, Kunitz type, 218455815984580616Rat
735125Pde8aphosphodiesterase 8A1135166143135288986Rat
1304847Zfp444zinc finger protein 44416770905267729283Rat
628763Aqp11aquaporin 111152046515152056675Rat
621323Phox2apaired-like homeobox 2a1156178754156183118Rat
621839Pold1DNA polymerase delta 1, catalytic subunit19502546295041559Rat
3562Rgs10regulator of G-protein signaling 101182946334182987729Rat
621066Eml2EMAP like 217882759578859342Rat
1305013Tmem143transmembrane protein 14319637193496387991Rat
1305014C1h10orf88similar to human chromosome 10 open reading frame 881186132360186149932Rat
620261Dynlt1dynein light chain Tctex-type 114688701746893956Rat
3701Slc22a3solute carrier family 22 member 314823547648324617Rat
1307416Snrpasmall nuclear ribonucleoprotein polypeptide A18248177082490540Rat
2476Cyp2f4cytochrome P450, family 2, subfamily f, polypeptide 418241610782429897Rat
1305529Pcnx3pecanex 31202951322202974167Rat
727889RelaRELA proto-oncogene, NF-kB subunit1202925001202935484Rat
735032Klk1c3kallikrein 1-related peptidase C319467163694675417Rat
1305145Nars2asparaginyl-tRNA synthetase 2, mitochondrial1151300446151412086Rat
1305154Asb7ankyrin repeat and SOCS box-containing 71120222835120267411Rat
1305852Fkrpfukutin related protein17747964177486954Rat
1305855Dnah3dynein, axonemal, heavy chain 31174305929174479490Rat
1306015Pgghgprotein-glucosylgalactosylhydroxylysine glucosidase1196038276196044561Rat
1306078Cyp2s1cytochrome P450, family 2, subfamily s, polypeptide 118130994881325303Rat
1307511Ndufc2NADH:ubiquinone oxidoreductase subunit C21151711965151718188Rat
1307525Kiaa0408LKiaa0408-like12861560028630309Rat
1305579Swap70switching B-cell complex subunit SWAP701164267588164328796Rat
1305084Zfp473zinc finger protein 47319522268395243328Rat
1305211Lipt2lipoyl(octanoyl) transferase 21154504563154506890Rat
71017Fzd4frizzled class receptor 41143279934143288799Rat
70953Dll3delta like canonical Notch ligand 318356201183570008Rat
620024Phkg2phosphorylase kinase catalytic subunit gamma 21182184362182197124Rat
1305115Hbe1hemoglobin subunit epsilon 11158282931158458855Rat
1306080Blvrbbiliverdin reductase B18273864682756312Rat
1306083Cabp4calcium binding protein 41201428671201442950Rat
1306322Tshz3teashirt zinc finger homeobox 318938673289460719Rat
1306764Kdelr1KDEL endoplasmic reticulum protein retention receptor 119634725896358145Rat
1306765Ggngametogenetin18447048884474120Rat
1306766Ccdc81coiled-coil domain containing 811143739472143791026Rat
1306133Lsp1lymphocyte-specific protein 11197614677197648414Rat
708405Scaf1SR-related CTD-associated factor 119548544895499389Rat
727864Hrchistidine rich calcium binding protein19581326295816987Rat
1304706Tmem147transmembrane protein 14718597702885978848Rat
1304707Lrfn1leucine rich repeat and fibronectin type III domain containing 118374244283761450Rat
1304717Cxcl17C-X-C motif chemokine ligand 1718098475180996842Rat
1304718Ifitm6interferon induced transmembrane protein 61196117043196118315Rat
621284Polr2gRNA polymerase II subunit G1205689160205692537Rat
621843St8sia2ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 21127762573127838017Rat
1305592Pagr1Paxip1-associated glutamate-rich protein 11181622698181625024Rat
1305695Lsm14aLSM14A mRNA processing body assembly factor18696480087009325Rat
1308541TicrrTOPBP1-interacting checkpoint and replication regulator1133597618133639513Rat
1308544Cfap90cilia and flagella associated protein 9013482589434849916Rat
1305619Ndufab1NADH:ubiquinone oxidoreductase subunit AB11176644696176658131Rat
727932Psgb1pregnancy-specific beta 1-glycoprotein17792317077932605Rat
1306359Fiz1FLT3-interacting zinc finger 116882274168835723Rat
1306361Ube3aubiquitin protein ligase E3A1110070260110161675Rat
1306375Mrpl36mitochondrial ribosomal protein L3612996548129968896Rat
1305864Stk32cserine/threonine kinase 32C1193900718193981723Rat
1307362BccipBRCA2 and CDKN1A interacting protein1188512544188524957Rat
1305824Tmem134transmembrane protein 1341201419225201424778Rat
735031Scgb2a1secretoglobin, family 2A, member 11206497848206501211Rat
727796Chp2calcineurin-like EF hand protein 21176757945176772443Rat
1306610Otogotogelin19674633696815416Rat
1306614Ubfd1ubiquitin family domain containing 11176626003176640993Rat
1306051Nipa2NIPA magnesium transporter 21106799979106824206Rat
1306407Isg20interferon stimulated exonuclease gene 201132829303132837027Rat
1305567Lrfn3leucine rich repeat and fibronectin type III domain containing 318561686285623725Rat
1306256Ttc9btetratricopeptide repeat domain 9B18295343482955659Rat
1306257Zfp629zinc finger protein 6291182217499182258585Rat
1306339Zfp110zinc finger protein 11017344530373461112Rat
1306343Fam18b-ps1family with sequence similarity 18, member B, pseudogene 11200971080200972723Rat
1305043Clrn3clarin 31190319025190334648Rat
620644Vps33bVPS33B, late endosome and lysosome associated1134223967134247232Rat
1306735Sympksymplekin scaffold protein17867237278700684Rat
1306743Mta2metastasis associated 1 family, member 21205838181205846903Rat
1306744Nkx1-2NK1 homeobox 21187386370187391252Rat
3521Art2bADP-ribosyltransferase 2b1155956601155974252Rat
1307311Mthfd1lmethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like14044392640632911Rat
1307330Scyl1SCY1 like pseudokinase 11203045776203059550Rat
1306992Ercc1ERCC excision repair 1, endonuclease non-catalytic subunit17897131079007963Rat
1306725Ahspalpha hemoglobin stabilizing protein1182879901182885508Rat
1306289Plpp4phospholipid phosphatase 41183829794183959319Rat
1305468Alg8ALG8, alpha-1,3-glucosyltransferase1151684344151704310Rat
1306892Zfp580zinc finger protein 58016878711868789286Rat
620413Prmt3protein arginine methyltransferase 319949271299581774Rat
1307579NumblNUMB-like, endocytic adaptor protein18254981482573788Rat
1307581Bbs1Bardet-Biedl syndrome 11202184812202204118Rat
1305654Dctn5dynactin subunit 51176689176176705907Rat
1307896Clptm1lCLPTM1-like12966754529683530Rat
1305713C1h15orf40similar to human chromosome 15 open reading frame 401135725869135732028Rat
1306420Klk7kallikrein-related peptidase 719426717094271361Rat
1306425Dusp8dual specificity phosphatase 81197167392197184285Rat
1306429Wdr73WD repeat domain 731134860329134868475Rat
1306430Kctd14potassium channel tetramerization domain containing 141151761688151766693Rat
1307454Tcp10bt-complex protein 10b15293782352961307Rat
1307456Hnrnpul1heterogeneous nuclear ribonucleoprotein U-like 118122840481264121Rat
1305137Med25mediator complex subunit 2519535996195375827Rat
1305144Rps6kb2ribosomal protein S6 kinase B21201451265201458096Rat
1309941Htatip2HIV-1 Tat interactive protein 219947341199488632Rat
1308854Thumpd1THUMP domain containing 11174078875174084915Rat
1307972Obox2oocyte specific homeobox 216819123868199383Rat
1307978Tm6sf1transmembrane 6 superfamily member 11135799844135828515Rat
1307601Ifitm1interferon induced transmembrane protein 11196067163196069169Rat
1307603Gstp3glutathione S-transferase pi 31201355682201358216Rat
1305810Tspan4tetraspanin 41196571307196593842Rat
1306538Orai3ORAI calcium release-activated calcium modulator 31182381196182386055Rat
1306542Sult2a2sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 217590958575976600Rat
1306548Stard10StAR-related lipid transfer domain containing 101155722637155748007Rat
1306553Armc5armadillo repeat containing 51182820141182826913Rat
1305050Chmp2acharged multivesicular body protein 2A17366004573662894Rat
1305051Aenapoptosis enhancing nuclease1132815094132824522Rat
1305749Tmem86atransmembrane protein 86A19759591097600260Rat
1305757Zfp112zinc finger protein 11217967693379691994Rat
1307441Siglec10sialic acid binding Ig-like lectin 1019381730193826376Rat
1307446Nlrp5NLR family, pyrin domain containing 516777803767810941Rat
1305187Gpr31G protein-coupled receptor 3115292695352927912Rat
1308562Ccr6C-C motif chemokine receptor 615247447752508301Rat
1308573Zfp53zinc finger protein 5316128401661313242Rat
708459Scgb1d2secretoglobin, family 1D, member 21206228546206233587Rat
1302939Eef1geukaryotic translation elongation factor 1 gamma1205860713205871319Rat
1304755Phlda2pleckstrin homology-like domain, family A, member 21198696897198699292Rat
1304756Fank1fibronectin type III and ankyrin repeat domains 11188577512188685501Rat
1307159Sf3b2splicing factor 3b, subunit 21202570423202590774Rat
1307861Exosc5exosome component 518116812881177266Rat
1305025Zfp575zinc finger protein 57518017501680177176Rat
1304771Cnot3CCR4-NOT transcription complex, subunit 316555592465572167Rat
1304777Nrip3nuclear receptor interacting protein 31163789738163815036Rat
1307356Tent4aterminal nucleotidyltransferase 4A13376594933799405Rat
1307359Brd9bromodomain containing 912932998129357285Rat
1307361Bcl2l12Bcl2 like 1219547227295480991Rat
1306730Mcmbpminichromosome maintenance complex binding protein1183270598183316975Rat
1306732Sigirrsingle Ig and TIR domain containing1196195363196208692Rat
1307017Zfp507zinc finger protein 50718843578788468577Rat
628902Atf5activating transcription factor 519529560295299755Rat
2159Ascl2achaete-scute family bHLH transcription factor 21198148999198151406Rat
1306219Paf1PAF1 homolog, Paf1/RNA polymerase II complex component18368365483689233Rat
1306221Mrps12mitochondrial ribosomal protein S1218402589684028896Rat
738040MrgprdMAS related GPR family member D1200479204200487902Rat
738043Mrgprb4MAS-related GPR, member B419785270497853675Rat
738044MrgprgMAS related GPR family member G1198947648198951556Rat
738045MrgpreMAS related GPR family member E1198963786198969862Rat
738048Mrgprx2MAS related GPR family member X219811619298135534Rat
738049Mas1lMAS1 proto-oncogene like, G protein-coupled receptor14787159247879942Rat
738051Mrgprb13MAS-related GPR, member B1319804101398041999Rat
738052Mrgprb5MAS-related G protein-coupled receptor, member B519795919397960254Rat
738053Mrgprx2lMAS-related G protein-coupled receptor, member X2-like19818544198186385Rat
1302935Nudt19nudix hydrolase 1918821447588226072Rat
2290Cckbrcholecystokinin B receptor1159771733159781738Rat
735150P4ha3prolyl 4-hydroxylase subunit alpha 31154628723154663779Rat
1307377Klc2kinesin light chain 21202414555202424787Rat
1307378Scart1scavenger receptor family member expressed on T-cells 11195020750195031807Rat
1307387Nlrp10NLR family, pyrin domain containing 101162922806162930363Rat
1307390Ccdc61coiled-coil domain containing 6117853749478557686Rat
1310608Fuzfuzzy planar cell polarity protein19537954295384532Rat
1310609Sgf29SAGA complex associated factor 291181238458181271931Rat
1308515Folr2folate receptor beta1156200044156218380Rat
1308516Trip13thyroid hormone receptor interactor 1312935709329402078Rat
1308519Pold4DNA polymerase delta 4, accessory subunit1201526591201528406Rat
1305040Six5SIX homeobox 517874081278745890Rat
1307366C2cd3C2 domain containing 3 centriole elongation regulator1154715151154812955Rat
1307371Saa4serum amyloid A419724758097251882Rat
1307409Rfpl4aret finger protein-like 4A16872896468735423Rat
1306463Hirip3HIRA interacting protein 31181472537181475082Rat
1305335Ccdc89coiled-coil domain containing 891144386252144387514Rat
620127Fgf4fibroblast growth factor 41200023937200027793Rat
1310022RamacRNA guanine-7 methyltransferase activating subunit1135708529135714417Rat
1310028Cimap1aciliary microtubule associated protein 1A1195926034195929250Rat
1310121Tppptubulin polymerization promoting protein12925711129281134Rat
1310123Taf6lTATA-box binding protein associated factor 6 like1205672147205684721Rat
1308000Lrrk1leucine-rich repeat kinase 11119844360119972885Rat
1305903Zfp771zinc finger protein 7711181864035181875136Rat
1305907Taf10TATA-box binding protein associated factor 101160095108160096401Rat
1307737Syngr4synaptogyrin 419635867996371840Rat
1307738Zfp54zinc finger protein 5416119080661205841Rat
1305542Fblfibrillarin18346983283478932Rat
1307202Ubqlnlubiquilin-like1158615177158617426Rat
735159Ipcef1interaction protein for cytohesin exchange factors 114323790343451735Rat
1307614Ube2mubiquitin-conjugating enzyme E2M17366257673666113Rat
1305384Cpt1ccarnitine palmitoyltransferase 1c19544281495457347Rat
1305391Nap1l4nucleosome assembly protein 1-like 41198709697198746093Rat
1305393Tigd3tigger transposable element derived 31203178456203182775Rat
1305394Acy3aminoacylase 31201279751201285803Rat
1309505Nectin2nectin cell adhesion molecule 217937212379407379Rat
1309507Rab30RAB30, member RAS oncogene family1146803719146898369Rat
1309510Gprc5bG protein-coupled receptor, class C, group 5, member B1173316904173340933Rat
1307576Mrpl48mitochondrial ribosomal protein L481154896663154939285Rat
1305344Iglon5IgLON family member 519388090693898929Rat
1304759Palb2partner and localizer of BRCA21176665076176689053Rat
1305374B3gnt8UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 818113560281138501Rat
3396Prkcbprotein kinase C, beta1176832173177163539Rat
1307209Lrrc28leucine rich repeat containing 281121116833121245805Rat
1305989Peli3pellino E3 ubiquitin protein ligase family member 31202230034202242900Rat
1307030Strn4striatin 417748226777511862Rat
1307033Ltbp4latent transforming growth factor beta binding protein 418260013682634346Rat
1307037Tmc5transmembrane channel-like 51172914915172999478Rat
1307043Tssc4tumor suppressing subtransferable candidate 41198251986198254810Rat
1306801Clvs2clavesin 212373566023842685Rat
1306786Rsph6aradial spoke head 6 homolog A17870080178720444Rat
1306714Wdr62WD repeat domain 6218549153185530643Rat
1305832Prpf31pre-mRNA processing factor 3116557588765587561Rat
1305254Cemipcell migration inducing hyaluronidase 11137906921138062430Rat
1307439Lmntd2lamin tail domain containing 21196315112196320880Rat
1305155Adamtsl3ADAMTS-like 31136288793136596986Rat
68426Stx5syntaxin 51205637401205653563Rat
70932Mvpmajor vault protein1181594734181622336Rat
1303107Vkorc1vitamin K epoxide reductase complex, subunit 11182502491182505012Rat
1304800Gga2golgi associated, gamma adaptin ear containing, ARF binding protein 21176552046176585332Rat
1305412Rexo5RNA exonuclease 51174168633174264526Rat
1306647Far1fatty acyl CoA reductase 11167644622167705868Rat
1306648Usp29ubiquitin specific peptidase 2916687421667097731Rat
1306654Bub3BUB3 mitotic checkpoint protein1186330358186340969Rat
1305998Klk8kallikrein related-peptidase 819425180394258646Rat
620166Fgf19fibroblast growth factor 191200056526200060980Rat
1306411WtipWT1 interacting protein18673121486764939Rat
735189Kctd13potassium channel tetramerization domain containing 131181534534181552843Rat
1306385BicraBRD4 interacting chromatin remodeling complex associated protein17666189776736146Rat
1306386Ceacam16CEA cell adhesion molecule 16, tectorial membrane component17951497579524871Rat
1305200Ttll2tubulin tyrosine ligase like 215296718352976690Rat
69338Slc22a6solute carrier family 22 member 61205522579205531179Rat
2198Bckdkbranched chain ketoacid dehydrogenase kinase1182515335182520007Rat
1304689Tubgcp5tubulin gamma complex component 51106636526106672175Rat
708360Phrf1PHD and ring finger domains 11196333663196366901Rat
1306112Eif3feukaryotic translation initiation factor 3, subunit F1162934220162943204Rat
1305597Samd4bsterile alpha motif domain containing 4B18368941383728652Rat
1305600U2af1l4U2 small nuclear RNA auxiliary factor 1-like 418581626885818462Rat
1306098Sae1SUMO1 activating enzyme subunit 117703096177086937Rat
1307757Sphk2sphingosine kinase 219618087296188592Rat
1307759Sdccag1-ps1serologically defined colon cancer antigen 1, pseudogene 118234191482345530Rat
1307760Nsmce1NSE1 homolog, SMC5-SMC6 complex component1180030355180058541Rat
1306754Ceacam12CEA cell adhesion molecule 1217821647178223526Rat
1306759Dennd5aDENN domain containing 5A1163928183163994207Rat
1306761Prodh2proline dehydrogenase 218575355885767165Rat
1307794Bag3BAG cochaperone 31183103038183126862Rat
1306387Mrpl18mitochondrial ribosomal protein L1814783716947841987Rat
1307120Snrnp70small nuclear ribonucleoprotein U1 subunit 7019585603895876434Rat
1307121Lrrc4bleucine rich repeat containing 4B19492203494956309Rat
1307216Septin1septin 11181832700181836566Rat
1307219Pira2paired-Ig-like receptor A216535212565422842Rat
1307223Dyrk1bdual specificity tyrosine phosphorylation regulated kinase 1B18347916883497011Rat
3246Pcsk6proprotein convertase subtilisin/kexin type 61119428978119627626Rat
2409Dpysl4dihydropyrimidinase-like 41193883039193898916Rat
620825Fxyd3FXYD domain-containing ion transport regulator 318630553186312455Rat
1304676Tolliptoll interacting protein1196961585196984252Rat
620009Coro1acoronin 1A1181295561181300566Rat
708402Vom2r-ps45vomeronasal 2 receptor, pseudogene 4516646317766490650Rat
708362Scaf8SR-related CTD-associated factor 814372768643855889Rat
1305613Spns1SPNS lysolipid transporter 1, lysophospholipid1180942088180949415Rat
1306300Eef1akmt2EEF1A lysine methyltransferase 21187616156187640934Rat
1306301Btbd10BTB domain containing 101167431311167489320Rat
1306305Tjp1tight junction protein 11118849838119094492Rat
1305036Ints4integrator complex subunit 41151790062151853827Rat
1305381ReltRELT, TNF receptor1155206976155224609Rat
1306070Rom1retinal outer segment membrane protein 11205824050205826058Rat
1306075Srp72-ps1signal recognition particle 72, pseudogene 117538412775387772Rat
1333909Or10a4olfactory receptor family 10 subfamily A member 41160957099160958046Rat
1332767Or51i2olfactory receptor family 51 subfamily I member 21158513673158514611Rat
1332768Or14a257olfactory receptor family 14 subfamily A member 2571140276678140277619Rat
1332769Or5p76olfactory receptor family 5 subfamily P member 761162617193162618137Rat
1332771Or6z1olfactory receptor family 6 subfamily Z member 116735338867354326Rat
1332773Or51f2olfactory receptor family 51 subfamily F member 21157292342157293292Rat
1332776Or52l1olfactory receptor family 52 subfamily L member 11159582521159583471Rat
1332780Or52e4olfactory receptor family 52 subfamily E member 41159454581159455519Rat
1333236Olr2-psolfactory receptor pseudogene 216725188867252553Rat
1333934Or52j3olfactory receptor family 52 subfamily J member 31157605177157606115Rat
1333949Or2ag17b-ps1olfactory receptor family 2 subfamily AG member 17B, pseudogene 11160491806160492754Rat
1333371Or51b6olfactory receptor family 51 subfamily B member 61158347649158348596Rat
1333372Or13a23olfactory receptor family 13 subfamily A member 231195517786195518718Rat
1311097Ctr9CTR9 homolog, Paf1/RNA polymerase II complex component1165137277165167303Rat
1311107Irgcimmunity related GTPase cinema18002011480025797Rat
1333828Or13a19colfactory receptor family 13 subfamily A member 19C1195334233195335162Rat
1308623Zfp668zinc finger protein 6681182474633182484957Rat
1308637Ccdc90bcoiled-coil domain containing 90B1146632756146646314Rat
1333287Or6al1olfactory receptor family 6 subfamily A member L116590685065907824Rat
1308678Pnldc1PARN like ribonuclease domain containing exonuclease 114784322447861675Rat
1308679Ssh3slingshot protein phosphatase 31201557167201565577Rat
1333636Or2ag18olfactory receptor family 2 subfamily AG member 181160512174160513124Rat
1333639Or5p60colfactory receptor family 5 subfamily P member 60C1162080213162081184Rat
1333647Or14a258olfactory receptor family 14 subfamily A member 2581139960934139961884Rat
1311703C1h11orf58similar to human chromosome 11 open reading frame 581170334950170346864Rat
1333421Or5p5bolfactory receptor family 5 subfamily P member 5B1161735695161736633Rat
1333424Or52s19olfactory receptor family 52 subfamily S member 191157742232157743176Rat
1308827Sephs2selenophosphate synthetase 21181893146181895464Rat
1310203Mrpl21mitochondrial ribosomal protein L211200529416200542568Rat
1333293Or52k1olfactory receptor family 52 subfamily K member 11157037381157038325Rat
1311983Rgmarepulsive guidance molecule BMP co-receptor a1127128934127172918Rat
1311984Unc93b1unc-93 homolog B1, TLR signaling regulator1201167388201178343Rat
1311991ErfEts2 repressor factor18082993580838388Rat
1309133Pkp3plakophilin 31196187914196198843Rat
1311610Cd22CD22 molecule18611637686132782Rat
1333500Or2d2olfactory receptor family 2 subfamily D member 21160979415160980362Rat
1333505Or55b3olfactory receptor family 55 subfamily B member 31156859322156860519Rat
1308399Tmem80transmembrane protein 801196435999196444368Rat
1308098Hapln3hyaluronan and proteoglycan link protein 31133046465133064665Rat
1310526Ndnnecdin, MAGE family member1115849168115850767Rat
1308421Cyb5r2cytochrome b5 reductase 21161655862161664359Rat
1308428Garre1granule associated Rac and RHOG effector 118686212186939725Rat
1333218Or51f23colfactory receptor family 51 subfamily F member 23C1157231467157232417Rat
1308935Gpatch1G patch domain containing 118792560687974544Rat
1308950Ap3b2adaptor related protein complex 3 subunit beta 21135412580135445191Rat
1332789Or56a5olfactory receptor family 56 subfamily A member 51159500672159501610Rat
1310883Fpr1formyl peptide receptor 115874501958756776Rat
1307277Rps6ka4ribosomal protein S6 kinase A41204021805204032781Rat
1307280Nkx6-2NK6 homeobox 21194380149194383533Rat
1309747Ice1interactor of little elongation complex ELL subunit 113264037232682669Rat
1560558Pdzd9PDZ domain containing 91175188270175217491Rat
1560565Ano9anoctamin 91196208863196230381Rat
1560566Tmem219transmembrane protein 2191181496195181509259Rat
1332928Or5p72olfactory receptor family 5 subfamily P member 721162293541162294485Rat
1332929Or14a260olfactory receptor family 14 subfamily A member 2601139918531139919472Rat
1332931Or51k1olfactory receptor family 51 subfamily K member 11158486849158487799Rat
1310396Urosuroporphyrinogen III synthase1188490832188513659Rat
1310399Ttll13tubulin tyrosine ligase like 131134197801134213083Rat
1310401Siglechsialic acid binding Ig-like lectin H1106593721106604191Rat
1310404Cd248CD248 molecule1202373676202376240Rat
1311379InscINSC, spindle orientation adaptor protein1168993032169100438Rat
1308439Bcl7cBAF chromatin remodeling complex subunit BCL7C1182277163182324274Rat
1332840Or5p61-ps1olfactory receptor family 5 subfamily P member 61, pseudogene 11162179357162180300Rat
1332841Or52e7olfactory receptor family 52 subfamily E member 71159422789159423742Rat
1332846Or2ag2olfactory receptor family 2 subfamily AG member 21160695621160696571Rat
1333923Or12j4olfactory receptor family 12 subfamily J member 41195362981195363904Rat
1333336Or5p50olfactory receptor family 5 subfamily P member 501161742688161743632Rat
1333387Or14a257colfactory receptor family 14 subfamily A member 257C1140365515140366522Rat
1332659Or52ae8bolfactory receptor family 52 subfamily AE member 8B1158097260158098213Rat
1332664Or14c43olfactory receptor family 14 subfamily C member 431140171652140172647Rat
1309649Rlbp1retinaldehyde binding protein 11133308920133322296Rat
1333377Or51a25bolfactory receptor family 51 subfamily A member 25B1157170104157171066Rat
1333379Or51a42olfactory receptor family 51 subfamily A member 421158542552158543496Rat
1333958Or5p52olfactory receptor family 5 subfamily P member 521161782220161785357Rat
1311009Med29mediator complex subunit 2918367796183683365Rat
1333513Or13a27dolfactory receptor family 13 subfamily A member 27D1195652234195653166Rat
1333514Or51r1olfactory receptor family 51 subfamily R member 11156998692156999642Rat
1333522Or6b9olfactory receptor family 6 subfamily B member 91160795402160831530Rat
1309316Fam83efamily with sequence similarity 83, member E19619158196201182Rat
1308106Spindocspindlin interactor and repressor of chromatin binding1204541647204565109Rat
1310979Thbs2thrombospondin 215567039455699789Rat
1310985Rhodras homolog family member D1201708699201724405Rat
1310509Ccp110centriolar coiled-coil protein 1101173042238173072873Rat
1308032Nova2NOVA alternative splicing regulator 217857225378613703Rat
1309578Acsm5acyl-CoA synthetase medium-chain family member 51173870873173896838Rat
1309546Rmnd1required for meiotic nuclear division 1 homolog14085982940894376Rat
1308308Fbxo17F-box protein 1718400227684024455Rat
1308402Osbpl5oxysterol binding protein-like 51198862071198916469Rat
1333199Or12j3olfactory receptor family 12 subfamily J member 31195264681195265604Rat
1333201Or52n4olfactory receptor family 52 subfamily N member 41158919013158919978Rat
1333202Or52b6-ps1olfactory receptor family 52 subfamily B member 6, pseudogene 11158675191158676157Rat
1333205Or13a25olfactory receptor family 13 subfamily A member 251195730853195731788Rat
1333207Or52e3olfactory receptor family 52 subfamily E member 31157626717157627652Rat
1333441Or5p66olfactory receptor family 5 subfamily P member 661162235096162236037Rat
1359365Rcn3reticulocalbin 319556450395573762Rat
1359374Vom1r8vomeronasal 1 receptor 815990198359902959Rat
1359382Vom1r44vomeronasal 1 receptor 4417224981872250935Rat
1359187Lhppphospholysine phosphohistidine inorganic pyrophosphate phosphatase1187403390187494577Rat
1311201Pabpc6poly(A) binding protein, cytoplasmic 615104526451048340Rat
1309147Opa3outer mitochondrial membrane lipid metabolism regulator OPA317887961278910453Rat
1309156Ankrd13dankyrin repeat domain 13D1201565712201577987Rat
1333901Or5p78colfactory receptor family 5 subfamily P member 78C1162420650162421594Rat
1333130Or52x1b-ps1olfactory receptor family 52 subfamily X member 1B, pseudogene 11159554499159555417Rat
1333141Or52a5olfactory receptor family 52 subfamily A member 51158182988158183935Rat
1308381Map3k10mitogen activated protein kinase kinase kinase 1018295578482974084Rat
1308382Cdc42ep5CDC42 effector protein 517003592170038990Rat
1308386Gdpd3glycerophosphodiester phosphodiesterase domain containing 31181373505181383063Rat
1308391Mzf1myeloid zinc finger 117367052273682885Rat
1308393Fbxo46F-box protein 4617877005978786582Rat
1333180Or14e1-ps1olfactory receptor family 14 subfamily E member 1, pseudogene 11140262826140263202Rat
1333161Or51s1olfactory receptor family 51 subfamily S member 11157315393157316319Rat
1333083Or13o2-ps1olfactory receptor family 13 subfamily O member 2, pseudogene 11195188443195188890Rat
1333090Or5p56b-ps1olfactory receptor family 5 subfamily P member 56B, pseudogene 11161871812161872744Rat
1359484Vom1r57vomeronasal 1 receptor 5717388793173888815Rat
1333316Or52z12olfactory receptor family 52 subfamily Z member 121157933667157934632Rat
620088Cyp2b12cytochrome P450, family 2, subfamily b, polypeptide 1218200760982019409Rat
620579Pacs1phosphofurin acidic cluster sorting protein 11202437503202569473Rat
1334002Or10a2olfactory receptor family 10 subfamily A member 21160948001160948954Rat
1332630Or51l4olfactory receptor family 51 subfamily L member 41158146732158147691Rat
1310756Zfp541zinc finger protein 54117675023676786567Rat
1334160Or2d2bolfactory receptor family 2 subfamily D member 2B1160964638160965585Rat
1334165Or5p53olfactory receptor family 5 subfamily P member 531161813580161814512Rat
1334168Or5p68olfactory receptor family 5 subfamily P member 681162283866162284822Rat
1334171Or10a3colfactory receptor family 10 subfamily A member 3C1162870107162871051Rat
1309771Rpl27aribosomal protein L27A1163539732163542771Rat
1309775Ganabglucosidase II alpha subunit1205793910205813704Rat
1309782Eedembryonic ectoderm development1143867875143895008Rat
1309788Tesmintestis expressed metallothionein like protein1200629688200648434Rat
1333263Or52e18olfactory receptor family 52 subfamily E member 181159307874159308812Rat
1309878Dchs1dachsous cadherin-related 11160104931160138958Rat
1333167Or52n4colfactory receptor family 52 subfamily N member 4C1158972002158972967Rat
1333174Or5p1olfactory receptor family 5 subfamily P member 11162267801162268733Rat
1333176Or52s1bolfactory receptor family 52 subfamily S member 1B1157587391157589170Rat
1332638Or52n2eolfactory receptor family 52 subfamily N member 2E1159256560159257516Rat
1332641Or51g2olfactory receptor family 51 subfamily G member 21157421637157422575Rat
1332644Or13a27bolfactory receptor family 13 subfamily A member 27B1195393485195394417Rat
1332645Or5p56olfactory receptor family 5 subfamily P member 561161842163161843095Rat
1332675Or5p76bolfactory receptor family 5 subfamily P member 76B1162591358162592302Rat
1333584Or13g1olfactory receptor family 13 subfamily G member 11139864790139865713Rat
1333589Or52z15-ps1olfactory receptor family 52 subfamily Z member 15, pseudogene 11158058298158059264Rat
1332950Or5p78olfactory receptor family 5 subfamily P member 781162473821162474765Rat
1311663Zfp418zinc finger protein 41816658140666594247Rat
1311666Tlnrd1talin rod domain containing 11137864340137866359Rat
1311904Chsy1chondroitin sulfate synthase 11119689626119750711Rat
1311906Fcgbpl1Fc fragment of IgG binding protein-like 118342478883462802Rat
1334236Or52d1b-ps1olfactory receptor family 52 subfamily D member 1B, pseudogene 11158565007158565881Rat
1334238Or52z14olfactory receptor family 52 subfamily Z member 141157970990157971952Rat
1334239Or14a261-ps1olfactory receptor family 14 subfamily A member 261, pseudogene 11140385246140385832Rat
1334240Or14c43b-ps1olfactory receptor family 14 subfamily C member 43B, pseudogene 11140139131140140070Rat
1559891Sycp3l1synaptonemal complex protein 3 like 11186108544186111598Rat
1559894Nlrp4bNLR family, pyrin domain containing 4B17042602170457919Rat
1333767Or6al2olfactory receptor family 6 subfamily A member L216591740665918380Rat
1333770Or52e15bolfactory receptor family 52 subfamily E member 15B1159391482159392420Rat
1333771Or52h9olfactory receptor family 52 subfamily H member 91158826164158827105Rat
1309729Fastkd3FAST kinase domains 313485834234866988Rat
1309736Zdhhc13zinc finger DHHC-type palmitoyltransferase 1319848731998525906Rat
1333953Or51a10olfactory receptor family 51 subfamily A member 101158520743158521687Rat
1333955Or52e8bolfactory receptor family 52 subfamily E member 8B1159412927159413880Rat
1333956Or52ab2olfactory receptor family 52 subfamily AB member 21157681873157682820Rat
1332687Or56a3bolfactory receptor family 56 subfamily A member 3B1159476168159477115Rat
1308312Irf2bp1interferon regulatory factor 2 binding protein 117865273678655437Rat
1311542Vaspvasodilator-stimulated phosphoprotein17891000978925791Rat
1311544Fam89bfamily with sequence similarity 89, member B1203015772203017890Rat
1332781Or5p6olfactory receptor family 5 subfamily P member 61161900087161901031Rat
1333155Or51f23-ps1olfactory receptor family 51 subfamily F member 23, pseudogene 11157243704157244405Rat
1333156Or10a49olfactory receptor family 10 subfamily A member 491162843548162844492Rat
1333157Or52e15colfactory receptor family 52 subfamily E member 15C1159401875159402816Rat
1333158Or52s1olfactory receptor family 52 subfamily S member 11157619852157620835Rat
1333093Or6z5olfactory receptor family 6 subfamily Z member 516738596167386902Rat
1333752Or10a3olfactory receptor family 10 subfamily A member 31162856896162857876Rat
1333753Or51a5b-ps1olfactory receptor family 51 subfamily A member 5B, pseudogene 11157461693157462619Rat
1333757Or56b2olfactory receptor family 56 subfamily B member 21158943205158944164Rat
1333763Or14c39olfactory receptor family 14 subfamily C member 391140414652140415590Rat
1306891Rbm4RNA binding motif protein 41202078442202087506Rat
1333691Or2ag2bolfactory receptor family 2 subfamily AG member 2B1160565659160566609Rat
1333185Or12j2olfactory receptor family 12 subfamily J member 21195209804195210721Rat
1308234Carns1carnosine synthase 11201459061201470019Rat
1309693Tnfrsf26tumor necrosis factor receptor superfamily, member 261198802968198823032Rat
1310421Cpeb1cytoplasmic polyadenylation element binding protein 11135300048135407688Rat
1311253Spcs2signal peptidase complex subunit 21154163724154183152Rat
1334008Or5p4olfactory receptor family 5 subfamily P member 41161949772161950710Rat
1334009Or52m2olfactory receptor family 52 subfamily M member 21157048003157048962Rat
1334173Or13n4olfactory receptor family 13 subfamily N member 41160570018160570944Rat
1334174Or52n2d-ps1olfactory receptor family 52 subfamily N member 2D, pseudogene 11159219730159220348Rat
1334175Or51a24-ps1olfactory receptor family 51 subfamily A member 24, pseudogene 11158552371158553319Rat
1334048Or56b6bolfactory receptor family 56 subfamily B member 6B1159657311159658276Rat
1334051Or12j2bolfactory receptor family 12 subfamily J member 2B1195315038195315949Rat
1334054Or14a257bolfactory receptor family 14 subfamily A member 257B1140313700140314707Rat
1359149Zfp52zinc finger protein 5216132696061363105Rat
1359150Uqcrc2ubiquinol cytochrome c reductase core protein 21175167933175198499Rat
631434Bbc3Bcl-2 binding component 317701328177022509Rat
1332618Or52e7b-ps1olfactory receptor family 52 subfamily E member 7B, pseudogene 11159437067159438014Rat
1311329Otub1OTU deubiquitinase, ubiquitin aldehyde binding 11204387215204395495Rat
1310864Lyve1lymphatic vessel endothelial hyaluronan receptor 11164962872164976309Rat
1333997Or51af1olfactory receptor family 51 subfamily AF member 11157864549157865508Rat
1333998Or6aa1olfactory receptor family 6 subfamily A member A11139968839139969795Rat
1311356Coq8bcoenzyme Q8B18252557882549182Rat
1310799Fam53bfamily with sequence similarity 53, member B1187500061187591186Rat
1310803Pnma8aPNMA family member 8A17762927277643156Rat
1310831Trpt1tRNA phosphotransferase 11204186295204191294Rat
1334024Or52e55-ps1olfactory receptor family 52 subfamily E member 55, pseudogene 11159396920159397344Rat
1334028Or2d3olfactory receptor family 2 subfamily D member 31160701351160702274Rat
1310706Ciccapicua transcriptional repressor18085392080880537Rat
1310712EmsyEMSY transcriptional repressor, BRCA2 interacting1152881485152960420Rat
1310717Olfm5olfactomedin 51158620451158628289Rat
1303228Klk4kallikrein-related peptidase 419434419594349425Rat
1310995Klk15kallikrein-related peptidase 1519469942294706626Rat
1311866Cyp2r1cytochrome P450, family 2, subfamily r, polypeptide 11168749302168798079Rat
1333707Or51ac3olfactory receptor family 51 subfamily AC member 31157921167157922120Rat
1333708Or51f23b-ps1olfactory receptor family 51 subfamily F member 23B, pseudogene 11157204792157205735Rat
1311142Garin5agolgi associated RAB2 interactor 5A19498895994995971Rat
1310870Tmem41btransmembrane protein 41B1164012585164026967Rat
1309025Nsmce4aNSE4 homolog A, SMC5-SMC6 complex component1185102075185109166Rat
1310323Frmd8FERM domain containing 81203143216203163868Rat
1310332Cyfip1cytoplasmic FMR1 interacting protein 11106710924106799393Rat
1333621Or2d36olfactory receptor family 2 subfamily D member 361161028174161029118Rat
1310849Ipo7importin 71164062702164102938Rat
1311512Kat8lysine acetyltransferase 81182524355182536638Rat
1311884Iqgap1IQ motif containing GTPase activating protein 11134679581134769776Rat
1311886Kif22kinesin family member 221181635347181650351Rat
1311306Rsph3radial spoke head 314710196147155201Rat
1311467Myct1myc target 114201813742029410Rat
1333358Or6b13olfactory receptor family 6 subfamily B member 131195003659195004615Rat
1310341Kptnkaptin (actin binding protein)17680873776809531Rat
1310344Mesdmesoderm development LRP chaperone1137866707137879999Rat
1333320Or52d3olfactory receptor family 52 subfamily D member 31158849336158850289Rat
1333325Olr36olfactory receptor 361154052762154053742Rat
1310920Zbtb45zinc finger and BTB domain containing 4517363489573639802Rat
1310926B3gnt6UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 61152484572152496226Rat
1311773Mical2microtubule associated monooxygenase, calponin and LIM domain containing 21166345853166530575Rat
1311779Tpcn2two pore segment channel 21200416538200446252Rat
1309086Cd19CD19 molecule1180987286180993920Rat
1309087Lrrc32leucine rich repeat containing 321152785709152802997Rat
1308334Dpy19l3dpy-19 like C-mannosyltransferase 318835030388417339Rat
1308371Tmem126btransmembrane protein 126B1144437142144451508Rat
1333117Or51af1b-ps1olfactory receptor family 51 subfamily AF member 1B, pseudogene 11157804670157805625Rat
1332591Or14e2-ps1olfactory receptor family 14 subfamily E member 2, pseudogene 11140358793140359187Rat
1332595Or51m1-ps1olfactory receptor family 51 subfamily M member 1, pseudogene 11158367523158368480Rat
1332598Or10a5olfactory receptor family 10 subfamily A member 51160863556160864509Rat
1332599Or52n2bolfactory receptor family 52 subfamily N member 2B1159248753159249718Rat
1311630Rasgrp2RAS guanyl releasing protein 21203705777203722993Rat
1311281Ceacam20CEA cell adhesion molecule 2017962207779643782Rat
1311957Mus81MUS81 structure-specific endonuclease subunit1202790295202796008Rat
628662Aldh1a3aldehyde dehydrogenase 1 family, member A31119982272120017416Rat
1310930Zim1zinc finger, imprinted 116713207667157843Rat
1308128Qpctlglutaminyl-peptide cyclotransferase-like17878673078797956Rat
1310765Zfp688zinc finger protein 6881182039366182043035Rat
1310775Tmem9bTMEM9 domain family, member B1163755307163783880Rat
1310815Klhl25kelch-like family member 251129724894129750142Rat
1310786Ano1anoctamin 11199751439199900099Rat
1310789Ankrd42ankyrin repeat domain 421146648080146691086Rat
1311568Slx1bSLX1 homolog B, structure-specific endonuclease subunit1181286190181291739Rat
1333221Or6ae1olfactory receptor family 6 subfamily A member E11194957151194958089Rat
1333223Or52s6olfactory receptor family 52 subfamily S member 61157756757157757701Rat
1333227Or56b6olfactory receptor family 56 subfamily B member 61159619288159620253Rat
1333228Or51f4olfactory receptor family 51 subfamily F member 41157257231157258175Rat
1333229Or52b1olfactory receptor family 52 subfamily B member 11159684419159685363Rat
1312037Psenenpresenilin enhancer gamma secretase subunit18581490585816654Rat
1310742Dact2dishevelled-binding antagonist of beta-catenin 215518102355191026Rat
1310747Cars1cysteinyl-tRNA synthetase 11198753689198796016Rat
1311432Sipa1l3signal-induced proliferation-associated 1 like 318461871484825956Rat
1312049Akt1s1AKT1 substrate 119533318695339678Rat
1309032Fpr2l1formyl peptide receptor 2 like 115968651959687550Rat
1309036C1h19orf81simlar to human chromosome 19 open reading frame 8119485730194871323Rat
1311964Rbbp6RB binding protein 6, ubiquitin ligase1177503988177537397Rat
1311968B3gat3beta-1,3-glucuronyltransferase 31205817374205823928Rat
1359358Vom1r58vomeronasal 1 receptor 5817398458973991005Rat
1359360Mef2amyocyte enhancer factor 2a1120847874120982488Rat
1333874Or52ae10olfactory receptor family 52 subfamily AE member 101157824326157825276Rat
1332833Or51e1olfactory receptor family 51 subfamily E member 11157142232157151114Rat
1332813Or5p69bolfactory receptor family 5 subfamily P member 69B1162396498162397442Rat
1308366Rhpn2rhophilin, Rho GTPase binding protein 218799114388051895Rat
1309044Pnpla2patatin-like phospholipase domain containing 21196552723196557805Rat
1311481Batf2basic leucine zipper ATF-like transcription factor 21203467291203479428Rat
1311490Tbc1d10cTBC1 domain family, member 10C1201476258201484876Rat
1311491Xpo6exportin 61180672114180761543Rat
1311741Cd2bp2Cd2 (cytoplasmic tail) binding protein 21181809399181815269Rat
1311751Mesp1mesoderm posterior bHLH transcription factor 11133738357133739875Rat
1311754Prc1protein regulator of cytokinesis 11134250086134271765Rat
1303022Tomm40translocase of outer mitochondrial membrane 4017935878179370882Rat
1359155Vom1r30vomeronasal 1 receptor 3016496552864966786Rat
1333278Or8af1-ps1olfactory receptor family 8 subfamily AF member 1, pseudogene 11162273789162274537Rat
1333281Or6aa1bolfactory receptor family 6 subfamily A member A1B1140016536140017495Rat
1333605Or5p81olfactory receptor family 5 subfamily P member 811162544353162545297Rat
1333614Olr301-psolfactory receptor pseudogene 3011195366554195367209Rat
1310168Fermt3FERM domain containing kindlin 31204189483204207683Rat
1310169Garin5bgolgi associated RAB2 interactor family member 5B16907683969093877Rat
1311604Gpr4G protein-coupled receptor 417886537678877126Rat
1332754Or13a26colfactory receptor family 13 subfamily A member 26C1195702019195702951Rat
1332760Or52e5olfactory receptor family 52 subfamily E member 51159429383159430324Rat
1332761Or6z7olfactory receptor family 6 subfamily Z member 716738201667382954Rat
1310890Ptgirprostaglandin I2 receptor17757959677581979Rat
1310965Ikzf5IKAROS family zinc finger 51186169108186188847Rat
1311531Scgb1b30secretoglobin, family 1B, member 3018671751086718775Rat
1333390Or52e5bolfactory receptor family 52 subfamily E member 5B1159461887159462828Rat
1333394Or51b17olfactory receptor family 51 subfamily B member 171158327466158328389Rat
1308374Sirt3sirtuin 31195942066195964472Rat
1308376Plaat5phospholipase A and acyltransferase 51204847600204878456Rat
1310912Eps8l2EPS8-like 21196446260196471544Rat
1309000Sox6SRY-box transcription factor 61169723306170334846Rat
1309009Ppfia1PTPRF interacting protein alpha 11199641277199718371Rat
1311634Anapc15anaphase promoting complex subunit 151156238640156266005Rat
1311637Kmt5blysine methyltransferase 5B1201000444201049819Rat
1307914Ptdss2phosphatidylserine synthase 21196241439196267632Rat
1333353Or13a26olfactory receptor family 13 subfamily A member 261195779448195780380Rat
1333356Or55b4olfactory receptor family 55 subfamily B member 41156866390156867379Rat
1309888Smg9SMG9 nonsense mediated mRNA decay factor17998854080011262Rat
1308663Vom1r54vomeronasal 1 receptor 5417284374172844664Rat
1308671Mtrr5-methyltetrahydrofolate-homocysteine methyltransferase reductase13486699134899425Rat
1311654Lrrc56leucine rich repeat containing 561196299843196315170Rat
1311454Btbd16BTB domain containing 161185334971185389518Rat
1311459Nkd2NKD inhibitor of WNT signaling pathway 212944289829470839Rat
1311460Slc22a20solute carrier family 22 member 201203257374203273854Rat
1310409Ttc23tetratricopeptide repeat domain 231121245996121329500Rat
1310411Usp47ubiquitin specific peptidase 471166152104166235312Rat
1309415Nlrp12NLR family, pyrin domain containing 1216593261065969873Rat
1309419Kdm2alysine demethylase 2A1201612427201682359Rat
1309436Ndufs8NADH:ubiquinone oxidoreductase core subunit S81201140585201144573Rat
1307268Tnrc6atrinucleotide repeat containing adaptor 6A1177561898177715669Rat
1549774Irf3interferon regulatory factor 319547996695484926Rat
1549778Sertad1SERTA domain containing 118277569282778961Rat
1560544Vps51l1VPS51 subunit of GARP complex like 11203369158203370408Rat
1311713Spred3sprouty-related, EVH1 domain containing 318445877984470425Rat
1311714Mill1MHC I like leukocyte 117837279878398932Rat
1333416Or51v14olfactory receptor family 51 subfamily V member 141157980431157981372Rat
1308995Dennd2bDENN domain containing 2B1163544075163734736Rat
1309632Kcna7potassium voltage-gated channel subfamily A member 719588607395891565Rat
1309633Wdr27WD repeat domain 2715583224055950457Rat
1305662Zfp143zinc finger protein 1431164109041164144902Rat
1305677Tmem126atransmembrane protein 126A1144424481144430730Rat
1306914Lgals12galectin 121204832065204842759Rat
1309261Rce1Ras converting CAAX endopeptidase 11201899358201902593Rat
1310640Fndc1fibronectin type III domain containing 114728183947364247Rat
1306509Ruvbl2RuvB-like AAA ATPase 219590201495915247Rat
1310896Trim6tripartite motif containing 61158683746158696936Rat
1332882Or2ag1olfactory receptor family 2 subfamily AG member 11160683723160684673Rat
1332887Olr193olfactory receptor 1931159514613159515554Rat
1332889Or51f1folfactory receptor family 51 subfamily F member 1F1157479786157484201Rat
1306168Inpp5ainositol polyphosphate-5-phosphatase A1194190086194380429Rat
1309221Eif3keukaryotic translation initiation factor 3, subunit K18426012784270051Rat
1309901Rccd1RCC1 domain containing 11134271870134281556Rat
1307822Pdiltprotein disulfide isomerase-like, testis expressed1173837477173868685Rat
1308901Lin37lin-37 DREAM MuvB core complex component18580906585813235Rat
1306521Efl1elongation factor like GTPase 11136638527136763518Rat
1307260Cdc42bpgCDC42 binding protein kinase gamma1203608339203628502Rat
1309890Arhgef17Rho guanine nucleotide exchange factor 171155230607155290163Rat
1305226Kmt5clysine methyltransferase 5C16909953169107145Rat
1305235Armt1acidic residue methyltransferase 114089455840918302Rat
1309793Det1DET1 partner of COP1 E3 ubiquitin ligase1132749736132765963Rat
1309017Ehd1EH-domain containing 11203579850203602226Rat
1308606Klk14kallikrein related-peptidase 1419412313194137239Rat
1305444Prrg2proline rich and Gla domain 219553427695543364Rat
1309965Tbcbtubulin folding cofactor B18547763985483488Rat
1309966Mceemethylmalonyl CoA epimerase1117964576117987779Rat
1308475Zfp579zinc finger protein 57916884754768850751Rat
1308477Drap1Dr1 associated protein 11202731775202734468Rat
1308280Klk9kallikrein related-peptidase 919424633994250631Rat
1309918Rnaset2ribonuclease T215257634452603151Rat
1309920Mrpl49mitochondrial ribosomal protein L491203346068203350040Rat
1305236Psmd13proteasome 26S subunit, non-ATPase 131195964617195976895Rat
1305240Nomo1Nodal modulator 119650546096556280Rat
1305932Nccrp1NCCRP1, F-box associated domain containing18383508383838620Rat
1307633Mphosph10M-phase phosphoprotein 101117948134117964149Rat
1310620Trpm5transient receptor potential cation channel, subfamily M, member 51198254956198277824Rat
1311409Ppp6r1protein phosphatase 6, regulatory subunit 116919085669217598Rat
1333961Or52ad1olfactory receptor family 52 subfamily AD member 11157733568157734512Rat
1333965Or51a6-ps1olfactory receptor family 51 subfamily A member 6, pseudogene 11157376150157377038Rat
1333966Or51a5-ps1olfactory receptor family 51 subfamily A member 5, pseudogene 11157495818157496386Rat
1333967Or14c44b-ps1olfactory receptor family 14 subfamily C member 44B, pseudogene 11139937745139938682Rat
1333972Or52d1olfactory receptor family 52 subfamily D member 11158578401158579372Rat
1333974Or52n3olfactory receptor family 52 subfamily N member 31159196782159197732Rat
1333977Or5p79olfactory receptor family 5 subfamily P member 791162479829162480773Rat
1308721Tspan32tetraspanin 321198190128198204447Rat
1307872Sema4bsemaphorin 4B1134136646134177777Rat
1305795Trim21tripartite motif-containing 211156964896156987504Rat
1306482Rnf146ring finger protein 14612845886428475758Rat
1308181Ctsfcathepsin F1202152777202158525Rat
1308183Usp31ubiquitin specific peptidase 311176211334176278183Rat
1308215Tlcd3bTLC domain containing 3B1181421104181439744Rat
1308225Gtf2h1general transcription factor IIH subunit 119732141797349455Rat
1307541Hipk4homeodomain interacting protein kinase 418281070882821080Rat
1307544Cnksr3Cnksr family member 314349927343591630Rat
1307554C1h19orf47similar to human chromosome 19 open reading frame 4718284430982871187Rat
1309405Fbxo5F-box protein 514219606842202437Rat
1308893Dcun1d3defective in cullin neddylation 1 domain containing 31174243001174285647Rat
1308896Dbx1developing brain homeobox 119934863899354173Rat
1308302Rrp8ribosomal RNA processing 81160081092160088709Rat
1311308Tars3threonyl-tRNA synthetase 31119213189119265492Rat
1311420Zfp574zinc finger protein 57418066798480678257Rat
1306235Vstm2bV-set and transmembrane domain containing 2B19259207092620491Rat
1309309Irx4iroquois homeobox 413003056130039549Rat
1309992Nosipnitric oxide synthase interacting protein19554332995559101Rat
1333560Or52z13olfactory receptor family 52 subfamily Z member 131157958861157959808Rat
1309393Ccdc97coiled-coil domain containing 9718121922581227017Rat
1309395Polr2iRNA polymerase II subunit I18548351585484952Rat
1309401Cend1cell cycle exit and neuronal differentiation 11196525153196528152Rat
1309849Upk1auroplakin 1A18585967285870147Rat
1308135Bscl2BSCL2 lipid droplet biogenesis associated, seipin1205731828205743430Rat
1311588Riok2RIO kinase 215810313258119397Rat
1310955Cpxm2carboxypeptidase X (M14 family), member 21186836797186947222Rat
1306244Rassf7Ras association domain family member 71196319600196323787Rat
1306245Clip3CAP-GLY domain containing linker protein 318554717085563187Rat
1305463Map4k1mitogen activated protein kinase kinase kinase kinase 118427095184292496Rat
1308975Klk12kallikrein related-peptidase 1219422277894227637Rat
1309206Nsmce3NSE3 homolog, SMC5-SMC6 complex component1118401302118402629Rat
1308690Klk11kallikrein related-peptidase 1119422874194233281Rat
1308693Dnajc4DnaJ heat shock protein family (Hsp40) member C41204178189204182412Rat
1310603Etv2ETS variant transcription factor 218589056285894025Rat
1306956Ovol1ovo like transcriptional repressor 11202855261202868858Rat
1306959Akip1A-kinase interacting protein 11163734730163743648Rat
1309370Ints5integrator complex subunit 51205788906205793685Rat
1309374ErmardER membrane-associated RNA degradation15598331256004569Rat
1305955Pop4POP4 homolog, ribonuclease P/MRP subunit19096002690968360Rat
1305958Mtmr10myotubularin related protein 101117859355117910839Rat
1305959Mesp2mesoderm posterior bHLH transcription factor 21133756601133759207Rat
1310959Clptm1CLPTM1 regulator of GABA type A receptor forward trafficking17928947879321079Rat
1310962Btbd1BTB domain containing 11135734549135773067Rat
1310942Catspergcation channel sperm associated auxiliary subunit gamma18448872884519495Rat
1310945Ccdc170coiled-coil domain containing 17014094560741050010Rat
1310947Dynlt2dynein light chain Tctex-type 215597128555983249Rat
1310103Ttyh1tweety family member 117005331270071872Rat
1310111Aspdhaspartate dehydrogenase domain containing19495632794960722Rat
1310112Plekhg2pleckstrin homology and RhoGEF domain containing G218365190283665063Rat
1308198FosbFosB proto-oncogene, AP-1 transcription factor subunit17895431278961492Rat
1308199Map4k2mitogen activated protein kinase kinase kinase kinase 21203645098203660782Rat
1310561Pdcd5programmed cell death 518830586988311200Rat
1309288Iydiodotyrosine deiodinase14000399940019323Rat
1307989Herc2HECT and RLD domain containing E3 ubiquitin protein ligase 21106904789107110997Rat
1307826Slc25a22solute carrier family 25 member 221196528471196536398Rat
1307828Irf7interferon regulatory factor 71196367380196370943Rat
1307842Prcpprolylcarboxypeptidase1146931487146983891Rat
1308141Odad1outer dynein arm docking complex subunit 119639213296420926Rat
1307562Hddc2HD domain containing 212629403026313914Rat
1308532Meis3Meis homeobox 317686126776872691Rat
1308248Pld3phospholipase D family, member 318282186382844280Rat
1308254Ctf2cardiotrophin 21182334061182342406Rat
1333983Or52d13olfactory receptor family 52 subfamily D member 131157778486157782381Rat
1308241Adgra1adhesion G protein-coupled receptor A11194629744194673254Rat
1309573Aurkcaurora kinase C16684365366849775Rat
727859RhcgRh family, C glycoprotein1133531704133555902Rat
708356Ppp2r2dprotein phosphatase 2, regulatory subunit B, delta1193665918193700277Rat
1306681Smoc2SPARC related modular calcium binding 215526247255391804Rat
1307895Wee1WEE1 G2 checkpoint kinase1164173681164197688Rat
1307305Josd2Josephin domain containing 219496086794964751Rat
1306254Ap2a1adaptor related protein complex 2 subunit alpha 119538430695414170Rat
1308929Fam168afamily with sequence similarity 168, member A1155057352155203439Rat
1309541B4gat1beta-1,4-glucuronyltransferase 11202343268202345490Rat
1308738Arhgap35Rho GTPase activating protein 3517720243677319298Rat
1308740Ctu1cytosolic thiouridylase subunit 119411543194121224Rat
1308743Ern2endoplasmic reticulum to nucleus signaling 21176726454176743289Rat
1309623Galnt18polypeptide N-acetylgalactosaminyltransferase 181165593180165904268Rat
1306491Zfp710zinc finger protein 7101133966256134036593Rat
1308086Polr3eRNA polymerase III subunit E1175466091175494679Rat
1308091E2f8E2F transcription factor 819856571798584265Rat
1307145Ppp6r3protein phosphatase 6, regulatory subunit 31200693128200807578Rat
1309860Alpk3alpha-kinase 31135014455135062294Rat
1309109Ercc2ERCC excision repair 2, TFIIH core complex helicase subunit17903334279047102Rat
1310649Grwd1glutamate-rich WD repeat containing 119630126096306962Rat
1308705Zfp592zinc finger protein 5921134951286135002443Rat
1306977Ptov1PTOV1, extended AT-hook containing adaptor protein19534706595354514Rat
1306790Mex3bmex-3 RNA binding family member B1136855130136859365Rat
1306794Chd1chromodomain helicase DNA binding protein 115666174356729119Rat
1309825DmpkDM1 protein kinase17873025578740585Rat
1309828Irag1inositol 1,4,5-triphosphate receptor associated 11164981716165094232Rat
1309834Irx2iroquois homeobox 213066096030666378Rat
1307177Jakmip3janus kinase and microtubule interacting protein 31193753134193881105Rat
708383Acsm2acyl-CoA synthetase medium-chain family member 21173916368173955116Rat
1305432Siglec5sialic acid binding Ig-like lectin 519376819093776696Rat
1309326Fv1Friend virus susceptibility 119473083994736791Rat
1309328Sec23ipSEC23 interacting protein1183320950183363944Rat
1309329Lrp5LDL receptor related protein 51200814247200917581Rat
1309332Mmp21matrix metallopeptidase 211188480186188485855Rat
1309060Irx1iroquois homeobox 113129461531300444Rat
1309062Isoc2bisochorismatase domain containing 2b16897296068993760Rat
1311624Setd1aSET domain containing 1A, histone lysine methyltransferase1182386197182411695Rat
1309040Nudt8nudix hydrolase 81201293660201295233Rat
1309042Bnc1basonuclin zinc finger protein 11135917676135943333Rat
1309679Thap12THAP domain containing 121153003605153019386Rat
1309683Ppme1protein phosphatase methylesterase 11154668099154715079Rat
1309686Tbc1d17TBC1 domain family, member 1719532477095333156Rat
1307106Ankrd27ankyrin repeat domain 2718825121688303615Rat
1307108Pwwp2bPWWP domain containing 2B1194040395194059979Rat
1310238Man2a2mannosidase, alpha, class 2A, member 21134304714134327611Rat
1310304Fam120bfamily with sequence similarity 120 member B15632001556385064Rat
1309842Psmd8proteasome 26S subunit, non-ATPase 818447437784481209Rat
1307857Rnf121ring finger protein 1211156377368156439936Rat
1308049Sac3d1SAC3 domain containing 11203414184203416563Rat
1309335Ate1arginyltransferase 11184961548185081112Rat
1309337Klk13kallikrein related-peptidase 1319416538194177002Rat
1309350Urahurate (5-hydroxyiso-) hydrolase1195905763195909159Rat
1309354Ctswcathepsin W1202772395202777021Rat
1310309Qprtquinolinate phosphoribosyltransferase1181718189181733486Rat
1310310Kif7kinesin family member 71133639487133658539Rat
1306179Chrdl2chordin-like 21154343201154370651Rat
1306180Leng8leukocyte receptor cluster member 817004078570052662Rat
1306181Tmem150btransmembrane protein 150B16912494369134617Rat
1306184Rbm42RNA binding motif protein 4218589861885908569Rat
1310358Uri1URI1, prefoldin-like chaperone19064639290704811Rat
1307262Tmem242transmembrane protein 24214599271346019684Rat
1305777Inpp5finositol polyphosphate-5-phosphatase F1183190480183270276Rat
1306621Zbtb2zinc finger and BTB domain containing 214082745740846733Rat
1306631Zfp324zinc finger protein 32417359141173600601Rat
1306636Asphd1aspartate beta-hydroxylase domain containing 11181552968181556902Rat
1308792Lins1lines homolog 11120267586120295013Rat
1310690U2af2U2 small nuclear RNA auxiliary factor 216876091168779730Rat
1308270Acp4acid phosphatase 419473637694751871Rat
1310253Cdc42ep2CDC42 effector protein 21203202000203210891Rat
1310257Zswim9zinc finger SWIM-type containing 917414481874165804Rat
1308777Numa1nuclear mitotic apparatus protein 11156297907156372855Rat
1308782Zfp772zinc finger protein 77216670262866709355Rat
1308783Adamts17ADAM metallopeptidase with thrombospondin type 1 motif, 171120445800120768204Rat
1309871Atl3atlastin GTPase 31204680958204727360Rat
1333124Or13a18olfactory receptor family 13 subfamily A member 181195492445195493377Rat
1305401Nipa1NIPA magnesium transporter 11106834000106875148Rat
1308210Abhd17cabhydrolase domain containing 17C, depalmitoylase1138084632138125595Rat
1306945Mboat7membrane bound O-acyltransferase domain containing 716552520665539538Rat
1307705Pak4p21 (RAC1) activated kinase 418384990483889188Rat
1307716Tbx6T-box transcription factor 61181387851181392762Rat
1305476Mki67marker of proliferation Ki-671190496319190522983Rat
1307647Sytl2synaptotagmin-like 21144272870144379310Rat
1307651CblcCbl proto-oncogene C17943997579456755Rat
1307652Cgm4carcinoembryonic antigen gene family 417777644777789408Rat
1307664Peg12paternally expressed 121115962511115965114Rat
1309847Rassf10Ras association domain family member 101167058277167063591Rat
1305291Rasip1Ras interacting protein 119609713596109564Rat
1305292Incenpinner centromere protein1206520655206550575Rat
1333443Or2d4olfactory receptor family 2 subfamily D member 41160777353160778285Rat
1333444Or52h2olfactory receptor family 52 subfamily H member 21158659293158660225Rat
1332678Olr216-psolfactory receptor pseudogene 2161160669331160670304Rat
1309564Zfp819zinc finger protein 81919402734794048767Rat
1311389Abhd2abhydrolase domain containing 2, acylglycerol lipase1133217403133298564Rat
1311400Atg16l2autophagy related 16-like 21155687386155703419Rat
1332815Or52r1colfactory receptor family 52 subfamily R member 1C1157475119157476063Rat
1332817Or14c48-ps1olfactory receptor family 14 subfamily C member 48, pseudogene 11140107028140108065Rat
1332869Or10am5olfactory receptor family 10 subfamily AM member 516733505467336007Rat
1332871Or52n4eolfactory receptor family 52 subfamily N member 4E1159042896159043864Rat
1308864FusFus RNA binding protein1182576479182590417Rat
1310127Rusf1RUS family member 11182852257182881652Rat
1310128Med10mediator complex subunit 1013347006433481698Rat
1310130Fpr2l2formyl peptide receptor 2 like 215899709158998062Rat
1310133RinlRas and Rab interactor-like18407701184088590Rat
1305294Eif4g2eukaryotic translation initiation factor 4, gamma 21165181433165193583Rat
1310536Zfp787zinc finger protein 78716774570267771132Rat
1310544Plekhf1pleckstrin homology and FYVE domain containing 119090830490915862Rat
1310551Tulp2TUB like protein 219596249695999775Rat
1308054Prkd2protein kinase D217751362577542386Rat
1308055NfkbidNFKB inhibitor delta18567935385690415Rat
1308063Tmc3transmembrane channel-like 31137552347137597477Rat
1309471Ubxn1UBX domain protein 11205765309205769234Rat
1332712Or5m12-ps1olfactory receptor family 5 subfamily M member 12, pseudogene 11123124617123125228Rat
1333428Olr35olfactory receptor 351153994678154043281Rat
1333429Olr294-psolfactory receptor pseudogene 2941195229270195230031Rat
1333432Or51af1c-ps1olfactory receptor family 51 subfamily AF member 1C, pseudogene 11157832733157833688Rat
1333435Or52ae7olfactory receptor family 52 subfamily AE member 71157853355157854305Rat
1332852Or51v17-ps1olfactory receptor family 51 subfamily V member 17, pseudogene 11158033824158034857Rat
1311763Arrdc4arrestin domain containing 41122369355122383351Rat
1311729Gpr139G protein-coupled receptor 1391173478137173522615Rat
1311730Cep89centrosomal protein 8918805821188100114Rat
1308456Kirrel2kirre like nephrin family adhesion molecule 218570879385718670Rat
1333835Or52x1olfactory receptor family 52 subfamily X member 11159601106159602059Rat
1333841Or52n4dolfactory receptor family 52 subfamily N member 4D1159108148159109107Rat
1308871Eif3ceukaryotic translation initiation factor 3, subunit C1181134604181152489Rat
1308882Sult2b1sulfotransferase family 2B member 119620015596261295Rat
1310680Tmem151atransmembrane protein 151A1202387397202392182Rat
1308736Hmgn5bhigh mobility group nucleosome binding domain 5B1117222188117224158Rat
1309409Irgqimmunity-related GTPase Q18012392580131881Rat
1305266Phf10PHD finger protein 1015595224955968994Rat
1308274Gvinp1GTPase, very large interferon inducible 11160195394160203003Rat
1308955Chid1chitinase domain containing 11196594357196629700Rat
1308918Abraxas2abraxas 2, BRISC complex subunit1187647078187672660Rat
1308618TagapT-cell activation RhoGTPase activating protein14717072547179705Rat
1307918Znhit2zinc finger, HIT-type containing 21203354297203355578Rat
1307933Leng1leukocyte receptor cluster member 116555198365556915Rat
1309281Shkbp1Sh3kbp1 binding protein 118263679782650330Rat
1308810BlmBLM RecQ like helicase1134409832134496073Rat
1309454Lix1limb and CNS expressed 115812896158187554Rat
1305281Hiatl3hippocampus abundant transcript-like 316675619366758919Rat
1305981Abca15ATP-binding cassette, subfamily A (ABC1), member 151174686666174794395Rat
1305357Unc45aunc-45 myosin chaperone A1134281930134296661Rat
1305359Klk1c8kallikrein 1-related peptidase C819454777494552287Rat
1307900Ifitm5interferon induced transmembrane protein 51196045836196052554Rat
1307904Ears2glutamyl-tRNA synthetase 2, mitochondrial1176597986176625848Rat
1308585Zfp511zinc finger protein 5111194817697194822102Rat
1309948Tmem135transmembrane protein 1351143006343143279824Rat
1309896Prr12proline rich 1219551001595534002Rat
1310578Cdr2cerebellar degeneration-related protein 21175502837175527746Rat
1309666Crtc3CREB regulated transcription coactivator 31134552830134655929Rat
1332718Olr220olfactory receptor 2201160730837160731760Rat
1309597Tubgcp2tubulin gamma complex component 21194791113194817807Rat
1309456Sars2seryl-tRNA synthetase 2, mitochondrial18402897284040725Rat
1306150Atp10aATPase phospholipid transporting 10A (putative)1109556760109730440Rat
1307473Doc2gdouble C2-like domains, gamma1201295377201299867Rat
1309815Zfp84zinc finger protein 8418498735285015478Rat
1305501TufmTu translation elongation factor, mitochondrial1181073788181077395Rat
1305502Xrra1X-ray radiation resistance associated 11154183330154247883Rat
1305515Rgs17regulator of G-protein signaling 1714222224842324625Rat
1310141TbxtT-box transcription factor T15229810452309813Rat
1310040Npas1neuronal PAS domain protein 117716737577187887Rat
1310046Adamts16ADAM metallopeptidase with thrombospondin type 1 motif, 1613243043632562481Rat
1310052B4galnt4beta-1,4-N-acetyl-galactosaminyl transferase 41196171394196182294Rat
1310056Chd2chromodomain helicase DNA binding protein 21127188146127317041Rat
1333240Or51a25olfactory receptor family 51 subfamily A member 251157179120157180082Rat
1333255Or5p66bolfactory receptor family 5 subfamily P member 66B1162053881162054825Rat
1333257Olr134-psolfactory receptor pseudogene 1341158382033158382413Rat
1333576Or52ab4olfactory receptor family 52 subfamily AB member 41157725793157726740Rat
1333577Or13a27olfactory receptor family 13 subfamily A member 271195235583195236515Rat
1305247Prdm9PR/SET domain 915650557956525726Rat
1309191Tbc1d10bTBC1 domain family, member 10b1181814972181826628Rat
1308979Chst8carbohydrate sulfotransferase 818729414487435900Rat
1308981Nlrp9NLR family, pyrin domain containing 916829118068341512Rat
1310371Cfap161cilia and flagella associated protein 1611137743783137768685Rat
1310385Arap1ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 11155748622155814186Rat
1310389Pik3c2aphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha1170577942170684353Rat
1359672Slc12a7solute carrier family 12 member 712947269229554246Rat
1359673Vom1r49vomeronasal 1 receptor 4917250178772502731Rat
1563363Zfp536zinc finger protein 53619000035990463423Rat
1564524Hbe2hemoglobin, epsilon 21158279285158280913Rat
1562283C1h10orf120similar to human chromosome 10 open reading frame 1201185910420185913478Rat
1303082FcarFc alpha receptor16962645869660558Rat
1563892Dact3dishevelled-binding antagonist of beta-catenin 317754690077558631Rat
1563905Rpl19-ps23ribosomal protein L19, pseudogene 2319516357095164284Rat
1565741Psg29pregnancy-specific beta-1-glycoprotein 2917797484977997680Rat
1559862Wdr93WD repeat domain 931133687254133737449Rat
1563849Psg16pregnancy specific glycoprotein 1617780629677821775Rat
1561430Abol1ABO, alpha 1-3-N-acetylgalactosaminyltransferase and alpha 1-3-galactosyltransferase like 118643908686442406Rat
1561432Scgb1c1secretoglobin, family 1C, member 11195922660195925022Rat
1564195Prrt2proline-rich transmembrane protein 21181625243181628833Rat
1561403Klk1c10kallikrein 1-related peptidase C1019440299394407052Rat
1562941Cd177CD177 molecule18034003480360599Rat
1311239Pdcd6programmed cell death 612896651828982188Rat
1334421Or51a39olfactory receptor family 51 subfamily A member 391157152386157153348Rat
1334424Or52a20olfactory receptor family 52 subfamily A member 201158108489158109439Rat
1303117Fam98cfamily with sequence similarity 98, member C18445280684456414Rat
1333715Or52h1olfactory receptor family 52 subfamily H member 11158644763158645713Rat
70988Akap12A-kinase anchoring protein 1214073012340819863Rat
1563497Sergefsecretion regulating guanine nucleotide exchange factor19694966097152529Rat
628619Aiparyl-hydrocarbon receptor-interacting protein1201408002201419220Rat
628799Cst6cystatin E/M1202655322202657030Rat
1566271Rpl7-ps20ribosomal protein L7, pseudogene 201137123201137130636Rat
1560234Rsrc1-ps3arginine and serine rich coiled-coil 1, pseudogene 314364087643641971Rat
1565210Tmem238transmembrane protein 23816905708369062477Rat
1562625Pira12paired-Ig-like receptor A1216530440865313090Rat
1563921Apeg3antisense paternally expressed gene 316712140267122333Rat
1359632Vom1r28vomeronasal 1 receptor 2816483365964834624Rat
1359665mrpl11mitochondrial ribosomal protein L111202264419202267288Rat
1359709Vom1r59vomeronasal 1 receptor 5917403142474032371Rat
1359717Ccdc8coiled-coil domain containing 817767952177682849Rat
1359719Vom1r21vomeronasal 1 receptor 2116096393960964862Rat
1359724Vom1r27vomeronasal 1 receptor 2716468972664690643Rat
1564380Lypd10Ly6/PLAUR domain containing 1018027301980278238Rat
1564382Spry3-ps1sprouty RTK signaling antagonist 3, pseudogene 113515836535158967Rat
1564385FesFES proto-oncogene, tyrosine kinase1134337698134346934Rat
1563319Ifitm10interferon induced transmembrane protein 101197507501197524180Rat
1560280Agbl1AGBL carboxypeptidase 11130043914130950739Rat
1564746Ube2subiquitin-conjugating enzyme E2S16902885369032914Rat
1561459Aamdcadipogenesis associated, Mth938 domain containing1151861990151893621Rat
1561767Polr3g-ps1RNA polymerase III subunit G, pseudogene 115455194254552612Rat
1560958Fam24bfamily with sequence similarity 24 member B1186112544186115957Rat
1562011Mrgprgl1MAS related GPR family member G like 11198937757198938662Rat
1559600RGD1559600RGD15596001173973318173988758Rat
1561133Vom2r30vomeronasal 2 receptor, 3017098442671006924Rat
1561983Muc5bmucin 5B, oligomeric mucus/gel-forming1196916861196948830Rat
1561992Sytl3synaptotagmin-like 314689630846967461Rat
1566426Ncoa7nuclear receptor coactivator 712685622827016950Rat
1563886Majinmembrane anchored junction protein1203487777203524098Rat
1563721Otud7aOTU deubiquitinase 7A1117064428117388217Rat
1565064Serac1serine active site containing 114662074146656801Rat
1560911Cracr2bcalcium release activated channel regulator 2B1196558407196563961Rat
1303190Nox3NADPH oxidase 314423801244302851Rat
1334348Or2ag16olfactory receptor family 2 subfamily AG member 161160417660160418607Rat
1564617Rpl36Al2ribosomal protein L36A like 217250502172505474Rat
1564485Vps35lVPS35 endosomal protein sorting factor like1173076219173179663Rat
1564487Tulp4TUB like protein 414668241646813167Rat
1564471Vom2r-ps59vomeronasal 2 receptor, pseudogene 5917296084472961764Rat
1563397Pcf11PCF11 cleavage and polyadenylation factor subunit1146694045146724030Rat
1563402Cited1l1Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 like 11204760742204761351Rat
1564801Minpp1-ps1multiple inositol-polyphosphate phosphatase 1, pseudogene 117401724874019633Rat
1563970Trim30dtripartite motif-containing 30D1158795288158813913Rat
1564255Itpripl2ITPRIP like 21172801152172803047Rat
1561420Il27interleukin 271181173108181178720Rat
1564982Vsig10lV-set and immunoglobulin domain containing 10 like19387148793880157Rat
1311205Tm7sf2transmembrane 7 superfamily member 21203355930203360287Rat
1561121Phldb3pleckstrin homology-like domain, family B, member 318020108380219541Rat
1561122Vom2r-ps47vomeronasal 2 receptor, pseudogene 4716869458068709322Rat
1561125Paoxpolyamine oxidase1194919655194928498Rat
1334354Or51q1dolfactory receptor family 51 subfamily Q member 1D1158426462158427427Rat
1561509Lrtomtleucine rich transmembrane and O-methyltransferase domain containing1156266655156268704Rat
1565215Rpl26-ps2ribosomal protein L26, pseudogene 212891793728918420Rat
1559927Hmx3H6 family homeobox 31186313237186315201Rat
1563982Fbxo27F-box protein 2718396542683987781Rat
1565899SpibSpi-B transcription factor19501893995024804Rat
1565905C1h11orf16similar to human chromosome 11 open reading frame 161163742987163754920Rat
1562433Ubqln5ubiquilin 51158592368158594244Rat
1565856Lrrc51leucine rich repeat containing 511156278617156297838Rat
1563539Ceacam18CEA cell adhesion molecule 1819407103994085649Rat
1562741Otoaotoancorin1175642978175710528Rat
1562948Acat2l1acetyl-CoA acetyltransferase 2-like 114780382247829012Rat
1560015Tecrl2trans-2,3-enoyl-CoA reductase like 214726364747264682Rat
1562710Nmbneuromedin B1134869446134875507Rat
1563268Brsk1BR serine/threonine kinase 116913416669159947Rat
1565363Bola2bolA family member 21181291967181292833Rat
1564079Prr18proline rich 1815240021552403998Rat
1311245Rsf1remodeling and spacing factor 11151892055152015089Rat
1311916Hps5HPS5, biogenesis of lysosomal organelles complex 2 subunit 219728162697320945Rat
1560088Ndufb4l3NADH:ubiquinone oxidoreductase subunit B4 like 318747986787480354Rat
1561845Sprnshadow of prion protein1194944602194948448Rat
1562967Mctp2multiple C2 and transmembrane domain containing 21125769932126002886Rat
1562983Mob2MOB kinase activator 21197092991197149978Rat
1563223Zfp74zinc finger protein 7418515815985183407Rat
1561491Abca14ATP-binding cassette, subfamily A (ABC1), member 141174577466174683407Rat
1563167Gas2growth arrest-specific 21101452361101582619Rat
1334324Or51a45-ps1olfactory receptor family 51 subfamily A member 45, pseudogene 11157446294157447224Rat
1334362Or5p6bolfactory receptor family 5 subfamily P member 6B1161968555161969499Rat
1334364Or52e8olfactory receptor family 52 subfamily E member 81159360430159361380Rat
1560430Zfp94zinc finger protein 9417985818879879702Rat
1560435Pnma8bPNMA family member 8B17762228777626525Rat
1563998Scube2signal peptide, CUB domain and EGF like domain containing 21163831876163899925Rat
1564265Ano5anoctamin 51101086490101187547Rat
1564267Tmc7transmembrane channel-like 71172853531172905796Rat
1564271Sertad3SERTA domain containing 318276353582767271Rat
1564272Tarm1T cell-interacting, activating receptor on myeloid cells 116566674265682402Rat
1564281Zdhhc11zinc finger, DHHC-type containing 1112929633429327227Rat
1560188Zfp14ZFP14 zinc finger protein18526864985286125Rat
1359695Vom1r24vomeronasal 1 receptor 2416427323764274187Rat
1359700Vom1r47vomeronasal 1 receptor 4717239840272402091Rat
1565669Vom2r38vomeronasal 2 receptor, 3819335855093420097Rat
1561308Zfp954zinc finger protein 95416677627966782224Rat
1562943Selenovselenoprotein V18355147383558756Rat
1564636Ovch2ovochymase 21161693619161713952Rat
1562400Or5p58olfactory receptor family 5 subfamily P member 581162007132162008103Rat
1562402Rpl27al3ribosomal protein L27A like 318956303489563540Rat
1563285RGD1563285similar to RIKEN cDNA 1700022C211185084823185091961Rat
1561140Zbtb3zinc finger and BTB domain containing 31205693906205703277Rat
1563239Zfp566zinc finger protein 56618531844985342186Rat
1563246Rspo3R-spondin 312828391428368661Rat
1560948Fam24afamily with sequence similarity 24, member A1186119918186122932Rat
1561579Zfp646zinc finger protein 6461182485009182494961Rat
1565655Cd177l2CD177 molecule like 218032318880328311Rat
1564300Pstkphosphoseryl-tRNA kinase1186157730186168145Rat
1565712Proser3proline and serine rich 318579336385806682Rat
1565730Cdv3l1carnitine deficiency-associated gene expressed in ventricle 3 like 11161678311161681564Rat
1566058Cog7component of oligomeric golgi complex 71176489795176549455Rat
1565772Ssc5dscavenger receptor cysteine rich family member with 5 domains16889194268910462Rat
1560854Actmapactin maturation protease18249031382499841Rat
1560856Ehd2EH-domain containing 217663956876658747Rat
1560863Cdca5cell division cycle associated 51203378550203392027Rat
1561783Stard5StAR-related lipid transfer domain containing 51137606151137616017Rat
1561027Pacrgparkin coregulated14988267150305564Rat
1561034C1h11orf42similar to human chromosome 11 open reading frame 421159722255159725863Rat
1561043Tut1terminal uridylyl transferase 1, U6 snRNA-specific1205848691205859767Rat
1549719Smpd1sphingomyelin phosphodiesterase 11159892946159896789Rat
1359495Vom1r3vomeronasal 1 receptor 315936386559364761Rat
15618854930433I11RiklRIKEN cDNA 4930433I11 gene like19267146192678000Rat
1359496Efemp2EGF containing fibulin extracellular matrix protein 21202781692202789784Rat
1560046Zfp51l1zinc finger protein 51 like 116146041761474179Rat
1560048Lair1leukocyte-associated immunoglobulin-like receptor 117006857170187851Rat
1359612Vom1r10vomeronasal 1 receptor 1016006470460065639Rat
1359614Ffar2free fatty acid receptor 218607185586075049Rat
1311021Arpinactin-related protein 2/3 complex inhibitor1133864288133873124Rat
1311022Gramd1aGRAM domain containing 1A18636700186393348Rat
1311699Dpf2double PHD fingers 21203183674203199037Rat
1334153Or56b6colfactory receptor family 56 subfamily B member 6C1159635655159636605Rat
1334156Or5p80-ps1olfactory receptor family 5 subfamily P member 80, pseudogene 11162488901162490033Rat
1560108Zftazinc finger translocation associated1204604557204612688Rat
1560986RGD1560986similar to Gene model 108218576931785776345Rat
1560991Gtf2h5general transcription factor IIH subunit 514665680446663512Rat
1562278Gsg1lGSG1-like1180440398180654342Rat
1562436Nanos2nanos C2HC-type zinc finger 217863566878637128Rat
1566289Scgb1d2l1secretoglobin, family 1D, member 2 like 11206197290206201254Rat
1563574Igflr1IGF-like family receptor 118581842885821032Rat
1563577Cnfncornifelin18094969980953747Rat
1563217C1h16orf92similar to human chromosome 16 open reading frame 921181434524181441000Rat
1333806Or51a7bolfactory receptor family 51 subfamily A member 7B1157415212157416180Rat
1333809Or14c40olfactory receptor family 14 subfamily C member 401140234383140235375Rat
1332721Or52j3bolfactory receptor family 52 subfamily J member 3B1157572005157572943Rat
1559673Gdpd5glycerophosphodiester phosphodiesterase domain containing 51153679718153761452Rat
1559687Vom2r80vomeronasal 2 receptor, 8016282060562834089Rat
1334107Olr238-psolfactory receptor pseudogene 2381161751470161752093Rat
1561870Rpl27l2ribosomal protein L27 like 21153154498153154902Rat
1564853Vom2r25vomeronasal 2 receptor, 2516402600264068674Rat
1562784Hnrnpul2heterogeneous nuclear ribonucleoprotein U-like 21205713431205725553Rat
1334304Or5p75-ps1olfactory receptor family 5 subfamily P member 75, pseudogene 11162438130162439074Rat
1334316Or52ae8olfactory receptor family 52 subfamily AE member 81158002968158003921Rat
1359287Vom1r29vomeronasal 1 receptor 2916487813964879100Rat
1359311Tskutsukushi, small leucine rich proteoglycan1152660259152671682Rat
1359317Zfand6zinc finger AN1-type containing 61138581002138652052Rat
1359330Vom1r63vomeronasal 1 receptor 6316476384564764786Rat
1309123Mrpl46mitochondrial ribosomal protein L461132698872132707639Rat
1309809Pih1d1PIH1 domain containing 119563959795645295Rat
1309810Zfp606zinc finger protein 60617298192073022423Rat
1310488Syvn1synoviolin 11203339235203346137Rat
1334251Or13a27eolfactory receptor family 13 subfamily A member 27E1195639216195640148Rat
1334255Or5p60dolfactory receptor family 5 subfamily P member 60D1162219346162220290Rat
1560730Mrgprb3lMAS-related GPR, member B3 like19837743398378401Rat
1561337Epc2l1enhancer of polycomb homolog 2 (Drosophila)-like 118193196381934681Rat
1333728Or5p69olfactory receptor family 5 subfamily P member 691162461108162462052Rat
1333730Or12j5olfactory receptor family 12 subfamily J member 51195417480195418403Rat
2154Arnt2aryl hydrocarbon receptor nuclear translocator 21138236235138392868Rat
1359507Vom1r6vomeronasal 1 receptor 615982655759830125Rat
1359512Vom1r12vomeronasal 1 receptor 1216019044360191387Rat
1563807Supt5hSPT5 homolog, DSIF elongation factor subunit18358671383616971Rat
1334260Or51k2olfactory receptor family 51 subfamily K member 21158389143158390081Rat
1334262Or52ae7bolfactory receptor family 52 subfamily AE member 7B1157797762157798709Rat
1334267Or14a257dolfactory receptor family 14 subfamily A member 257D1140204646140205587Rat
1334270Or56a41-ps1olfactory receptor family 56 subfamily A member 41, pseudogene 11159481250159481948Rat
1333778Olr293-psolfactory receptor pseudogene 2931195220868195221101Rat
1311933Leg1liver enriched gene 112879990228816230Rat
1549734Vom1r42vomeronasal 1 receptor 4217211063072140964Rat
1359095Vom1r43vomeronasal 1 receptor 4317221891072219833Rat
1359101Vom1r2vomeronasal 1 receptor 215927585159276759Rat
1333307Or6i2-ps1olfactory receptor family 6 subfamily I member 2, pseudogene 11160824097160824727Rat
1359253Ttc9ctetratricopeptide repeat domain 9C1205701768205712782Rat
1359261Map3k11mitogen-activated protein kinase kinase kinase 111202975353202988655Rat
1559613Smim17small integral membrane protein 1716744227067493140Rat
1359090Lilrb4leukocyte immunoglobulin like receptor B416980502069810628Rat
1359091Vom1r4vomeronasal 1 receptor 415942756059428456Rat
1359340Vom1r37vomeronasal 1 receptor 3716865145068652448Rat
1359343Rbm4bRNA binding motif protein 4B1202047934202058025Rat
621846Dkk3dickkopf WNT signaling pathway inhibitor 31166237969166281271Rat
727957Ric8aRIC8 guanine nucleotide exchange factor A1195935162195941469Rat
1333452Or56b2bolfactory receptor family 56 subfamily B member 2B1158956989158957948Rat
1333459Or10a5c-ps1olfactory receptor family 10 subfamily A member 5C, pseudogene 11160897439160898390Rat
1333469Or52ad1b-ps1olfactory receptor family 52 subfamily AD member 1B, pseudogene 11157702587157703531Rat
1334037Or51ab3olfactory receptor family 51 subfamily AB member 31157901417157902370Rat
1334043Or2d3colfactory receptor family 2 subfamily D member 3C1160756927160757850Rat
1359467Rcor2REST corepressor 21204453403204461403Rat
1332741Or2ag17olfactory receptor family 2 subfamily AG member 171160531819160532769Rat
1332743Or5p60bolfactory receptor family 5 subfamily P member 60B1162153461162154426Rat
1311034Ethe1ETHE1, persulfide dioxygenase18018403780199092Rat
1311035Ffar3free fatty acid receptor 318610538886106728Rat
1562792Tdrd12tudor domain containing 1218813327188205729Rat
1311443RrasRAS related19550058295504362Rat
1334180Or10ab4olfactory receptor family 10 subfamily AB member 41161927803161928786Rat
1332984Or52ac1olfactory receptor family 52 subfamily AC member 11158871618158872517Rat
1332985Or56b2kolfactory receptor family 56 subfamily B member 2K1159075031159077896Rat
1359476Actl9bactin-like 9b16383048163831818Rat
1311146Eps8l1EPS8-like 116934320269359778Rat
1333984Or51k1b-ps1olfactory receptor family 51 subfamily K member 1B, pseudogene 11158432453158433446Rat
1312023Uba2ubiquitin-like modifier activating enzyme 218677523986802685Rat
1312027Pold3DNA polymerase delta 3, accessory subunit1154417893154456687Rat
1311954Nsun2NOP2/Sun RNA methyltransferase 213366213933685887Rat
1333791Or51ag1olfactory receptor family 51 subfamily AG member 11157878427157879374Rat
1333794Or52s20olfactory receptor family 52 subfamily S member 201157748451157749422Rat
1559509Znf568l-ps1zinc finger protein 568 like, pseudogene 118522979485231191Rat
1311670Vwa3avon Willebrand factor A domain containing 3A1175293782175355588Rat
1311676Tescltescalcin-like17989655479920998Rat
1561338Slc6a16solute carrier family 6, member 1619572169095750191Rat
1549692Vrk3VRK serine/threonine kinase 319524334495270780Rat
1549698Dmac2distal membrane arm assembly component 218112876081134810Rat
1549713Scgb1b24secretoglobin, family 1B, member 2418652134886522498Rat
1559853Syce1synaptonemal complex central element protein 11195852171195863174Rat
1559857Ahrraryl-hydrocarbon receptor repressor12899363429088673Rat
1309710Trmt112tRNA methyltransferase activator subunit 11-21204103298204104151Rat
1359235Vom1r15vomeronasal 1 receptor 1516045620360457135Rat
1359238Hcsthematopoietic cell signal transducer18567697685679083Rat
1559691Dnmt3a-ps3DNA methyltransferase 3 alpha, pseudogene 31107153094107163738Rat
1559700Vom2r-ps41vomeronasal 2 receptor, pseudogene 4116504573265058478Rat
1359114Zfp667zinc finger protein 66716760180367622041Rat
1359116Vom1r1vomeronasal 1 receptor 115454317354544143Rat
1359119Sft2d1SFT2 domain containing 115240968752425583Rat
1359121Vom1r45vomeronasal 1 receptor 4517229069272291637Rat
1359129Scgb2b24-ps1secretoglobin, family 2B, member 24, pseudopgene 118670760286709529Rat
1333531Or52p2olfactory receptor family 52 subfamily P member 21157010581157011528Rat
1333532Or51l1olfactory receptor family 51 subfamily L member 11157516210157517157Rat
1333535Olr55-psolfactory receptor pseudogene 551157236148157236449Rat
1359608Vom1r62vomeronasal 1 receptor 6217413566974137211Rat
1334127Or51i1olfactory receptor family 51 subfamily I member 11158502581158503525Rat
1334129Or52b3-ps1olfactory receptor family 52 subfamily B member 3, pseudogene 11156963553156964495Rat
1334140Olr296-psolfactory receptor pseudogene 2961195260637195260964Rat
1563823Ehbp1l1EH domain binding protein 1-like 11202994115203014320Rat
1563824WtapWT1 associated protein14766596547691067Rat
1559601Ptprcapprotein tyrosine phosphatase, receptor type, C-associated protein1201449133201451293Rat
1560365Vom2r36vomeronasal 2 receptor, 3617326879573294065Rat
1334015Or52e2olfactory receptor family 52 subfamily E member 21157561070157562023Rat
1334018Or2ag19bolfactory receptor family 2 subfamily AG member 19B1160458552160459502Rat
1334089Or52n20olfactory receptor family 52 subfamily N member 201158933757158934725Rat
1334090Or56b37-ps1olfactory receptor family 56 subfamily B member 37, pseudogene 11159068812159069569Rat
1334093Or52p1olfactory receptor family 52 subfamily P member 11158889800158890789Rat
1334099Or13a26bolfactory receptor family 13 subfamily A member 26B1195754003195754938Rat
1359306Vom1r46vomeronasal 1 receptor 4617235982372360773Rat
628773Hdgfl3HDGF like 31135822600135876719Rat
628715FibpFGF1 intracellular binding protein1202768065202772405Rat
1562118Prdx1-ps2peroxiredoxin 1, pseudogene 21151735733151737057Rat
1333043Olr100-psolfactory receptor pseudogene 1001157813825157814045Rat
1560265Ybx1-ps18Y box binding protein 1, pseudogene 181164469576164471095Rat
1311057Brms1BRMS1, transcriptional repressor and anoikis regulator1202345766202355028Rat
1311070Me3malic enzyme 31143534024143735551Rat
1311740Dhx32DEAH-box helicase 32 (putative)1188524512188577500Rat
1549742Tead1TEA domain transcription factor 11166791900167010591Rat
1564862Zfp428zinc finger protein 42818009952080108875Rat
1562091Ppm1nprotein phosphatase, Mg2+/Mn2+ dependent 1N17892935078934435Rat
1559593Ceacam11CEA cell adhesion molecule 1117813882278145058Rat
1560591Snx32sorting nexin 321202801090202818731Rat
1333075Or2d36bolfactory receptor family 2 subfamily D member 36B1160930225160931169Rat
1559529Kctd21potassium channel tetramerization domain containing 211151650074151669775Rat
1333881Or52n1olfactory receptor family 52 subfamily N member 11159128222159129187Rat
1333885Or2ag16bolfactory receptor family 2 subfamily AG member 16B1160476725160477672Rat
1310793Rras2RAS related 21168233693168303111Rat
1311475Ccdc88bcoiled-coil domain containing 88B1204036913204052878Rat
1359524Vom1r53vomeronasal 1 receptor 5317282707972828032Rat
1334142Or8i6-ps1olfactory receptor family 8 subfamily I member 6, pseudogene 11161737746161738184Rat
1559901Mrps11mitochondrial ribosomal protein S111132707601132717253Rat
1559902Txn1l1thioredoxin 1 like 11152735541152735798Rat
1359652Vom1r20vomeronasal 1 receptor 2016090839660913865Rat
1359654Echdc1ethylmalonyl-CoA decarboxylase 112847635428507173Rat
1359659Vom1r36vomeronasal 1 receptor 3616862428968625461Rat
1303081Tyrobptransmembrane immune signaling adaptor Tyrobp18567293185676856Rat
1334081Or52b4olfactory receptor family 52 subfamily B member 41156939068156940009Rat
1333861Or51q1olfactory receptor family 51 subfamily Q member 11158456134158457081Rat
1333865Or52ab2bolfactory receptor family 52 subfamily AB member 2B1157689725157690675Rat
1333866Or2ag20olfactory receptor family 2 subfamily AG member 201160656583160657530Rat
1332980Or51b4bolfactory receptor family 51 subfamily B member 4B1158308648158309583Rat
1332982Or2at1olfactory receptor family 2 subfamily AT member 11154089219154090184Rat
628881Chst15carbohydrate sulfotransferase 151187028860187107908Rat
628885Slc22a19solute carrier family 22, member 191204910450204965538Rat
1334397Or51a7olfactory receptor family 51 subfamily A member 71157395779157396717Rat
1334399Or6f1olfactory receptor family 6 subfamily F member 11139888779139889705Rat
1334402Or2ag21-psolfactory receptor family 2 subfamily AG member 21, pseudogene 11160599025160599427Rat
1334411Or56b1olfactory receptor family 56 subfamily B member 11158910597158911556Rat
1562044Zfp583zinc finger protein 58316757585467594476Rat
1560355Lypd5Ly6/Plaur domain containing 517992981879941791Rat
1334060Or52e15olfactory receptor family 52 subfamily E member 151159349202159350140Rat
1549752Scgb2b2secretoglobin, family 2B, member 218652803586530028Rat
1332902Or13n4bolfactory receptor family 13 subfamily N member 4B1160609645160610571Rat
1332903Or52n2olfactory receptor family 52 subfamily N member 21159204524159205480Rat
1332905Or14n1olfactory receptor family 14 subfamily N member 11140064224140065216Rat
1332927Or5p78b-ps1olfactory receptor family 5 subfamily P member 78B, pseudogene 11162357696162358623Rat
1334292Or51g1olfactory receptor family 51 subfamily G member 11157438123157439064Rat
1333025Or10a48b-ps1olfactory receptor family 10 subfamily A member 48B, pseudogene 11162825264162826252Rat
1333026Or6b6olfactory receptor family 6 subfamily B member 61160812705160813649Rat
1333028Or52k2olfactory receptor family 52 subfamily K member 21157026845157027798Rat
1359530Vom1r110vomeronasal 1 receptor 11016481715464818074Rat
1359531Vom1r22vomeronasal 1 receptor 2216153716561567974Rat
1333057Or14c39bolfactory receptor family 14 subfamily C member 39B1140329678140330607Rat
1311596Mybpc2myosin binding protein C219499412195017584Rat
1311599Lpcat1lysophosphatidylcholine acyltransferase 112976607029816401Rat
1333445Olr5olfactory receptor 516736398067364918Rat
1333720Or51a41olfactory receptor family 51 subfamily A member 411157454391157455398Rat
1311946C1h11orf24similar to human chromosome 11 open reading frame 241200945188200953953Rat
1333546Or52ae9olfactory receptor family 52 subfamily AE member 91158130946158131893Rat
1333547Or52m1olfactory receptor family 52 subfamily M member 11157065217157066170Rat
1333554Or52n5-ps1olfactory receptor family 52 subfamily N member 5, pseudogene 11159288667159289619Rat
1311197Mkrn3makorin, ring finger protein, 31115926774115929288Rat
1333481Or51k7olfactory receptor family 51 subfamily K member 71158401733158402686Rat
1333486Or51l14olfactory receptor family 51 subfamily L member 141157767340157768296Rat
1559980Ccdc179coiled-coil domain containing 1791101600369101604288Rat
1559981Lrrc27leucine rich repeat containing 271194004967194035087Rat
1333697Or52e51olfactory receptor family 52 subfamily E member 511157656899157657837Rat
1333699Olr258-psolfactory receptor pseudogene 2581162227180162228025Rat
1333700Or6z3olfactory receptor family 6 subfamily Z member 316739625767397201Rat
1332939Or52h7olfactory receptor family 52 subfamily H member 71158835924158836898Rat
1563793Zfp773-ps1zinc finger protein 773, pseudogene 116676407366769897Rat
1334370Or5p59olfactory receptor family 5 subfamily P member 591162033893162034840Rat
1359541Vom1r38vomeronasal 1 receptor 3816867305368674000Rat
1333037Or14c44-ps1olfactory receptor family 14 subfamily C member 44, pseudogene 11140004210140005185Rat
1359479Vom1r5vomeronasal 1 receptor 515956663959567535Rat
1334204Or55b10olfactory receptor family 55 subfamily B member 101156884142156885092Rat
1311186Fuomfucose mutarotase1194888535194893046Rat
1311192Map3k4mitogen activated protein kinase kinase kinase 414843180148519358Rat
619893Plgplasminogen14832518648367643Rat
1334327Or52z1olfactory receptor family 52 subfamily Z member 11158206284158207246Rat
1334329Olr314-psolfactory receptor pseudogene 3141195766783195767129Rat
1559839Ankrd49-ps3ankyrin repeat domain 49, pseudogene 31159492560159493383Rat
735106Ccdc127coiled-coil domain containing 12712892842028935885Rat
621190Megf8multiple EGF-like-domains 818090223680951614Rat
1334216Or13a18bolfactory receptor family 13 subfamily A member 18B1195581371195582303Rat
1334219Or5p5olfactory receptor family 5 subfamily P member 51161759509161760447Rat
1334373Or5ae1olfactory receptor family 5 subfamily AE member 11138860924138861871Rat
1564695Fam181bfamily with sequence similarity 181, member B1147166428147167925Rat
1334208Or5p84-ps1olfactory receptor family 5 subfamily P member 84, pseudogene 11161974994161975991Rat
1334212Or51v8olfactory receptor family 51 subfamily V member 81158080680158081624Rat
1333008Or52a5bolfactory receptor family 52 subfamily A member 5B1158160904158161854Rat
1560122Wdr88WD repeat domain 8818788431687924719Rat
1564719Faap24FA core complex associated protein 2418805152388057997Rat
1334425Or51b6bolfactory receptor family 51 subfamily B member 6B1158072748158073701Rat
1334427Or14f1-ps1olfactory receptor family 14 subfamily F member 1, pseudogene 11140305863140306292Rat
1334387Or10a48olfactory receptor family 10 subfamily A member 48B1162793841162794776Rat
1564153Plekha1pleckstrin homology domain containing A11185427982185479157Rat
1359419Vom1r56vomeronasal 1 receptor 5617386710373868131Rat
1359420Vom1r23vomeronasal 1 receptor 2316161755561618520Rat
1333662Or52r1olfactory receptor family 52 subfamily R member 11157301200157302174Rat
1333664Or2ag19olfactory receptor family 2 subfamily AG member 191160633102160634052Rat
1333669Or2ag13olfactory receptor family 2 subfamily AG member 131160362110160363057Rat
1563843Zfp61zinc finger protein 6117985001379857993Rat
1334432Or51f1golfactory receptor family 51 subfamily F member 1G1157502544157503494Rat
1560154Scgb2b24secretoglobin, family 2B, member 2418658150486582416Rat
1333032Or13a18colfactory receptor family 13 subfamily A member 18C1195610776195611708Rat
1559690DdiasDNA damage-induced apoptosis suppressor1146906150146930462Rat
1359734Vom1r32vomeronasal 1 receptor 3216827615868277075Rat
1308108Cabp5calcium binding protein 517435081174363830Rat
1359545Prss23serine protease 231143402725143422182Rat
1359546Aldh3b1aldehyde dehydrogenase 3 family, member B11201145309201162675Rat
1359552Vom1r35vomeronasal 1 receptor 3516856686568567906Rat
1311839Hddc3HD domain containing 31134299469134301757Rat
1332957Or13a27colfactory receptor family 13 subfamily A member 27C1195454589195455521Rat
1332958Or52b2olfactory receptor family 52 subfamily B member 21159695507159696475Rat
1333816Or51b4olfactory receptor family 51 subfamily B member 41158317228158318151Rat
1333818Or52n1bolfactory receptor family 52 subfamily N member 1B1159015174159016139Rat
1333820Or51b6c-ps1olfactory receptor family 51 subfamily B member 6C, pseudogene 11158025825158026778Rat
1334301Or5p73olfactory receptor family 5 subfamily P member 731162325587162326531Rat
1334302Or51aa2olfactory receptor family 51 subfamily AA member 21157888966157889937Rat
1359582Vom1r61vomeronasal 1 receptor 6117410655174110046Rat
1359585Fhip1bFHF complex subunit HOOK interacting protein 1B1159718679159748449Rat
1562305Sbsnsuprabasin18597897086006034Rat
1334277Or51q1eolfactory receptor family 51 subfamily Q member 1E1158482153158483100Rat
1334283Or52l1bolfactory receptor family 52 subfamily L member 1B1159543892159544842Rat
1334284Or5p83-ps1olfactory receptor family 5 subfamily P member 83, pseudogene 11162382685162383211Rat
1311792Pidd1p53-induced death domain protein 11196536815196542808Rat
1359168Vom1r50vomeronasal 1 receptor 5017251151172515762Rat
1359169Vom1r7vomeronasal 1 receptor 715987173959872733Rat
1311854Olfml1olfactomedin-like 11161478129161502541Rat
1332894Or51ah3olfactory receptor family 51 subfamily AH member 31157917326157918267Rat
1560082Vom2r-ps24vomeronasal 2 receptor, pseudogene 2416174907661758285Rat
1334390Or51v8bolfactory receptor family 51 subfamily V member 8B1157987781157988725Rat
1334393Or52n2folfactory receptor family 52 subfamily N member 2F1159223286159224242Rat
1560836Vom2r23vomeronasal 2 receptor, 2316386856963901495Rat
1561859Pgpep1lpyroglutamyl-peptidase I-like1121835243121868368Rat
1359131Dnajb13DnaJ heat shock protein family (Hsp40) member B131154848586154863042Rat
1359179Vom1r31vomeronasal 1 receptor 3116636855166369492Rat
1332953Or51f5olfactory receptor family 51 subfamily F member 51157224045157224989Rat
1332954Or52u1olfactory receptor family 52 subfamily U member 11158863988158864959Rat
1359568Zkscan2zinc finger with KRAB and SCAN domains 21178006003178028239Rat
1359572Ino80eINO80 complex subunit E1181461406181472059Rat
1332971Or52e19olfactory receptor family 52 subfamily E member 191157668879157669817Rat
1303323Slc22a18solute carrier family 22, member 181198670626198694977Rat
1359455Hikeshiheat shock protein nuclear import factor hikeshi1143825399143849361Rat
1359457Vom1r11vomeronasal 1 receptor 1116011622860117175Rat
1359462Vom1r41vomeronasal 1 receptor 4117176866571769585Rat
1333302Or13a19bolfactory receptor family 13 subfamily A member 19B1195160617195161546Rat
1310989Fbxl19F-box and leucine-rich repeat protein 191182356899182380839Rat
1584238Rps24-ps2ribosomal protein S24, pseudogene 218543353585438711Rat
1583028Snrpgl1small nuclear ribonucleoprotein polypeptide G like 118798262987983056Rat
1585050Ybx1-ps11Y box binding protein 1, pseudogene 111102914612102916158Rat
1583514LOC681177similar to GTPase activating protein testicular GAP113567520035781741Rat
1564929Tm2d3TM2 domain containing 31119267194119277094Rat
1564933Olr271-ps1olfactory receptor 271, pseudogene 11162580418162589573Rat
1559985Cfap46cilia and flagella associated protein 461194403212194482790Rat
1565281Sez6l2seizure related 6 homolog like 21181557109181577456Rat
1565464Vom2r10vomeronasal 2 receptor, 1015902779659075351Rat
3932Ucp2uncoupling protein 21154839242154845612Rat
628767Arhgap17Rho GTPase activating protein 171177807579177897027Rat
1566256Brsk2BR serine/threonine kinase 21197035505197088624Rat
1565431Mapk1ip1mitogen-activated protein kinase 1 interacting protein 11193655319193665817Rat
1565432Svipsmall VCP interacting protein1101587128101592818Rat
1585077Stip1-ps1stress-induced phosphoprotein 1, pseudogene 11101898734101900378Rat
1565454Izumo1izumo sperm-oocyte fusion 119609081796096893Rat
1585057Cct6a-ps14chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 1416844889968450882Rat
1583564tuba1c-ps2tubulin, alpha 1C, pseudogene 21152835411152837618Rat
1587451Zfp418l1zinc finger protein 418 like 116663811266649875Rat
1566262Prelid1-ps5PRELI domain containing 1, pseudogene 51203927355203928317Rat
1566248Ndn-ps1necdin, MAGE family member, pseudogene 116260611962615778Rat
1584794Mifl2macrophage migration inhibitory factor like 217743257777433425Rat
1303004Tacc2transforming, acidic coiled-coil containing protein 21185139223185327881Rat
1566394Adam8ADAM metallopeptidase domain 81194776559194789330Rat
1583954Hnrnpa1-ps16heterogeneous nuclear ribonucleoprotein A1, pseudogene 161106395841106397127Rat
1359096Nfatc2ipnuclear factor of activated T-cells 2 interacting protein1180954834180971847Rat
1585799Gdpd4glycerophosphodiester phosphodiesterase domain containing 41152233516152342329Rat
708535Slc27a5solute carrier family 27 member 517361655673627149Rat
1586688Tnfrsf22tumor necrosis factor receptor superfamily, member 221198840452198860713Rat
1562437Tcerg1ltranscription elongation regulator 1-like1193012937193201860Rat
1566132Trim30ctripartite motif-containing 30C1158766401158787915Rat
1582754Vom2r29vomeronasal 2 receptor, 2917052219370542510Rat
1583734Ngrnneugrin, neurite outgrowth associated1134213235134219348Rat
1583735Top1-ps1DNA topoisomerase 1, pseudogene 11127423431127432141Rat
1583288Rnf169ring finger protein 1691154250462154311867Rat
1583290Unc93aunc-93 homolog A15297314353029578Rat
1561918Nlrp4aNLR family, pyrin domain containing 4A16617103766258045Rat
1561909Rnf225ring finger protein 22517354359873546269Rat
1565272Rps23-ps4ribosomal protein S23, pseudogene 41187683563187684283Rat
1563498Lyrm1LYR motif containing 11174284116174305053Rat
1560671Zscan18zinc finger and SCAN domain containing 1817333288373349846Rat
1559147Vom2r35vomeronasal 2 receptor, 3517321041773227703Rat
1583786Rpl26-ps7ribosomal protein L26, pseudogene 71127659594127660098Rat
1583787Mif-ps8macrophage migration inhibitory factor, pseudogene 81126777227126777631Rat
1583788Commd9-ps1COMM domain containing 9, pseudogene 11111426330111428933Rat
1583789Hsdl1-ps1hydroxysteroid dehydrogenase like 1, pseudogene 11108780156108781131Rat
1583792Rpl18a-ps4ribosomal protein L18A, pseudogene 41101322809101323617Rat
1583794Far1-ps1fatty acyl CoA reductase 1, pseudogene 119818881698190338Rat
1583796Fam32al1family with sequence similarity 32, member A like 119107958991083390Rat
1583798Kpna3-ps1karyopherin subunit alpha 3, pseudogene 118666586186667440Rat
1583799Hsp90aa1-ps10heat shock protein 90 alpha family class A member 1, pseudogene 1018663359986636012Rat
1583800Ovol3ovo-like zinc finger 318548495685488592Rat
1583801Csde1-ps2cold shock domain containing E1, pseudogene 218305155483056439Rat
1583802Pgk1-ps6phosphoglycerate kinase 1, pseudogene 618234585682348568Rat
1564214Zfp108zinc finger protein 10817982044579827564Rat
1565868Atxn2lataxin 2-like1181078293181090079Rat
1584748Cycsl1cytochrome c, somatic like 114039100640392349Rat
1584766Brms1-ps1BRMS1, transcriptional repressor and anoikis regulator, pseudogene 114039663240399871Rat
1584097Cox6b1cytochrome c oxidase subunit 6B118587508085884081Rat
1585883Fam169bfamily with sequence similarity 169, member B1121878670121968272Rat
1582722Acp1l2acid phosphatase 1 like 217091776470918195Rat
1563506WhammWASP homolog associated with actin, golgi membranes and microtubules1135526363135557091Rat
1559897Oscarosteoclast associated Ig-like receptor16560721465615395Rat
1565838Naa40N(alpha)-acetyltransferase 40, NatD catalytic subunit1204410636204430890Rat
1582732Vom2r-ps54vomeronasal 2 receptor, pseudogene 5417087880470896261Rat
1582880Fpr2l3formyl peptide receptor 2 like 315918155559182586Rat
1582881Wdr74WD repeat domain 741205631769205636558Rat
1583981Slc22a27l-ps1solute carrier family 22, member 27 like, pseudogene 11205008429205015514Rat
1584003Fpr2-ps2formyl peptide receptor 2, pseudogene 215885422558855366Rat
1586434Actg1-ps6actin, gamma 1, pseudogene 618565924485661088Rat
1582763Mfsd13bmajor facilitator superfamily domain containing 13B1175528077175560263Rat
1584548Zscan2zinc finger and SCAN domain containing 21134833701134848957Rat
1566403Tmem181transmembrane protein 18114683081246885173Rat
1583609Dlat-ps1dihydrolipoamide S-acetyltransferase, pseudogene 113323121133233823Rat
1583965Sbk3SH3 domain binding kinase family, member 316886784768873249Rat
1587241Zfp273l-ps1zinc finger protein 273 like, pseudogene 113522232535238553Rat
1564503C1h16orf54similar to human chromosome 16 open reading frame 541181702447181705128Rat
1564508MicbMHC class I polypeptide-related sequence B17849577978513030Rat
1359247Ndufv1NADH:ubiquinone oxidoreductase core subunit V11201300365201305461Rat
1586703C1h19orf85similar to human chromosome 19 open reading frame 8516892918468937113Rat
1583652Adam12ADAM metallopeptidase domain 121188686984189014206Rat
1563523Dkkl1dickkopf like acrosomal protein 119569401095699259Rat
1563529Nlrp4NLR family, pyrin domain containing 416808932168132429Rat
1563538ClasrpCLK4-associating serine/arginine rich protein17923226079256462Rat
1562524Rpl27l6ribosomal protein L27 like 614254115942541467Rat
1587398Mrgprb3MAS-related GPR, member B319827080098286263Rat
1584667Lypd10l1Ly6/PLAUR domain containing 10 like 118030823480312967Rat
1582907Rsl24d1-ps2ribosomal L24 domain containing 1, pseudogene 21160336026160337165Rat
1583676Plekhg1pleckstrin homology and RhoGEF domain containing G114034868440434063Rat
1585067Trim25-ps1tripartite motif-containing 25, pseudogene 11102350230102400041Rat
1585068Cct6a-ps6chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 616843216768434145Rat
1585091Obox2l1oocyte specific homeobox 2 like 116818272568184559Rat
1583872Il16interleukin 161137617702137718022Rat
1583889Eri2ERI1 exoribonuclease family member 21174140831174168757Rat
1584121Zbtb32zinc finger and BTB domain containing 3218584193185851116Rat
1584204Anks4bankyrin repeat and sterile alpha motif domain containing 4B1174534195174557798Rat
1585783Zfp748-ps1zinc finger protein 748, pseudogene 116164836861674769Rat
1583226Pgm2l1phosphoglucomutase 2-like 11154571410154620901Rat
1584935Nosip-ps1nitric oxide synthase interacting protein, pseudogene 116599616765997001Rat
1584936Bud23-ps2BUD23, rRNA methyltransferase and ribosome maturation factor, pseudogene 216484570364846726Rat
1584938Opa3-ps1outer mitochondrial membrane lipid metabolism regulator OPA3, pseudogene 116099661060998123Rat
1584940Tpi1-ps1triosephosphate isomerase 1, pseudogene 115782019357820963Rat
1584942Brcc3-ps5BRCA1/BRCA2-containing complex, subunit 3, pseudogene 515361623653617108Rat
1587415Ckap2-ps3cytoskeleton-associated protein 2, pseudogene 31167203062167213037Rat
1587416UevldUEV and lactate/malate dehyrogenase domains19745418897486004Rat
1587424Peli1-ps1pellino 1, pseudogene 117429829574300674Rat
1585230Aldh3b3aldehyde dehydrogenase 3 family, member B31201193832201201666Rat
1582829Tmem223transmembrane protein 2231205668716205670077Rat
1582830C1h2orf78similar to human chromosome 2 open reading frame 7819274378892752219Rat
1582831Taf5l-ps1TATA-box binding protein associated factor 5 like, pseudogene 115989012759892594Rat
1563073Siglec8sialic acid binding Ig-like lectin 819409273794103134Rat
1564991Gal3st3galactose-3-O-sulfotransferase 31202593635202603446Rat
1565029Zfp329zinc finger protein 32917340306773498349Rat
1565984Usp35ubiquitin specific peptidase 351151626195151649926Rat
1583497Lypd4Ly6/Plaur domain containing 418046048780466105Rat
1583906Sarnp-ps1SAP domain containing ribonucleoprotein, pseudogene 11108457981108458724Rat
1565152Flrt1fibronectin leucine rich transmembrane protein 11204275785204292844Rat
1564549Tmem160transmembrane protein 16017716444877167156Rat
1584883Ppp1r12cprotein phosphatase 1, regulatory subunit 12C16932024069343200Rat
1584885Krt18-ps4keratin 18, pseudogene 415062105250622592Rat
1584886QkiQKI, KH domain containing RNA binding15038771650501568Rat
1561747Rgs9bpregulator of G protein signaling 9 binding protein18824943888250151Rat
1583927Tmem190transmembrane protein 19016906270969064938Rat
3805Syt3synaptotagmin 319488083594895518Rat
621328ClpbClpB family mitochondrial disaggregase1156028740156158183Rat
1559948Sec61g-ps3Sec61 translocon subunit gamma, pseudogene 31195892846195913494Rat
1566209Polr2lRNA polymerase II, I and III subunit L1196570051196572060Rat
1565160MypopMyb-related transcription factor, partner of profilin17863969978650555Rat
1584082Gpr152G protein-coupled receptor 1521201435878201438373Rat
1566295Aldh16a1aldehyde dehydrogenase 16 family, member A119562672795639808Rat
1566307Lilrb3leukocyte immunoglobulin like receptor B316992894869939461Rat
1566318Alkbh6alkB homolog 618556351185568977Rat
1583473Vom2r19l1vomeronasal 2 receptor 19 like 116314968363163412Rat
1563034ErflETS repressor factor like18052137880526262Rat
1583866Esrraestrogen related receptor, alpha1204104100204114182Rat
1565786Vom2r28vomeronasal 2 receptor, 2816652757166556896Rat
1565787Pinlypphospholipase A2 inhibitor and Ly6/Plaur domain containing18013464280140488Rat
1566127Prss53serine protease 531182494944182501607Rat
1582781Lilra5leukocyte immunoglobulin like receptor A516997329269978750Rat
1564978Lrrc14bleucine rich repeat containing 14B12892147528925646Rat
1566044Fpr3formyl peptide receptor 315888442758893472Rat
1582815Agap1l1ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 like 119284049592856281Rat
1562778Trim72tripartite motif containing 721182613753182621613Rat
1562228Coa4cytochrome c oxidase assembly factor 4 homolog1154882199154885445Rat
1562619Izumo2IZUMO family member 219519645995209131Rat
1561206Slc25a19l1solute carrier family 25 member 19 like 11111433195111435231Rat
1566336Cep72centrosomal protein 7212922531229255294Rat
1565991Nat14N-acetyltransferase 1416891059968913452Rat
1566410Tex36testis expressed 361188390062188404448Rat
1566413Cldnd2claudin domain containing 219384853393851693Rat
1565630Zdhhc24zinc finger, DHHC-type containing 241202175832202181943Rat
1565642SrcapSnf2-related CREBBP activator protein1182123562182172643Rat
1584013Fpr2formyl peptide receptor 215877659258785227Rat
1565261Kndc1kinase non-catalytic C-lobe domain containing 11194689962194738353Rat
1560718Smok2al1sperm motility kinase 2A like 115370504253713934Rat
1565025Kcnk7potassium two pore domain channel subfamily K member 71202988801202992842Rat
1564579Ypel3yippee-like 31181384385181387706Rat
1566222Ccdc106coiled-coil domain containing 10616877988268783975Rat
1561972Kash5KASH domain containing 519566891895691353Rat
1565584CrebzfCREB/ATF bZIP transcription factor1144416864144423540Rat
1583990Egln1-ps2egl-9 family hypoxia-inducible factor 1, pseudogene 21160266448160268021Rat
1565895Klhl35kelch-like family member 351153767138153773550Rat
1562657Ap5b1adaptor related protein complex 5 subunit beta 11202876272202880303Rat
1563481Or51t1olfactory receptor, family 51, subfamily T, member 11157370394157371434Rat
1563279Sbk2SH3 domain binding kinase family, member 216887408168881918Rat
1565169Apobrapolipoprotein B receptor1181169019181173206Rat
1563508Smg1SMG1, nonsense mediated mRNA decay associated PI3K related kinase1172441892172543667Rat
1582795Ankrd62lankyrin repeat domain 62 like1175074189175162056Rat
1583982Fpr2-ps4formyl peptide receptor 2, pseudogene 415890896458957093Rat
1566284Hnrnpa1-ps47heterogeneous nuclear ribonucleoprotein A1, pseudogene 4713960157639603128Rat
1563307Setl2SET-like protein 218644948286450302Rat
1566323Fan1FANCD2 and FANCI associated nuclease 11117915323117945044Rat
1566325Zfp874bzinc finger protein 874b13500232135014324Rat
1566122B9d2B9 domain containing 218118939581195383Rat
1562653Saxo2stabilizer of axonemal microtubules 21136596445136638444Rat
1583989Dnajb6-ps10DnaJ heat shock protein family (Hsp40) member B6, pseudogene 101204990626204992065Rat
1584422Ccdc9coiled-coil domain containing 917697831276991673Rat
1584144Tbx10T-box transcription factor 101201285729201292676Rat
1584166Aldh3b2aldehyde dehydrogenase 3 family, member B21201250260201264699Rat
1563534Abca16ATP-binding cassette, subfamily A (ABC1), member 161174795054174975193Rat
1565197Ntn5netrin 519615694896165997Rat
1560277Gdpgp1GDP-D-glucose phosphorylase 11134184119134193281Rat
1565485Zfp524zinc finger protein 52416882480368828363Rat
1565487Crxos1Crx opposite strand transcript 117657782776580677Rat
1584930Gapdh-ps111Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 11117096571670976124Rat
1584931Fgd4-ps1FYVE, RhoGEF and PH domain containing 4, pseudogene 116956760369589473Rat
1582848Etf1-ps2eukaryotic translation termination factor 1, pseudogene 219266128392668713Rat
1582850Tmem179btransmembrane protein 179B1205670126205672112Rat
1565877Zdhhc14zinc finger DHHC-type palmitoyltransferase 1414606912746340806Rat
1561456FancfFA complementation group F1101449120101451936Rat
1565590Nsd2l1nuclear receptor binding SET domain protein 2 like 117623003776239579Rat
1564356Cers3ceramide synthase 31120316930120422926Rat
1564357Igsf23immunoglobulin superfamily, member 2317959105979606323Rat
1564651Smokl2sperm motility kinase like 216813268368153057Rat
1359366Acat2acetyl-CoA acetyltransferase 214769583347713879Rat
1565096Knop1lysine-rich nucleolar protein 11173180400173199253Rat
1565097Slc7a3l1solute carrier family 7 member 3 like 116605313566067042Rat
1565099Klf13KLF transcription factor 131117505857117536626Rat
1563323Top6blTOP6B like initiator of meiotic double strand breaks1201902564201989945Rat
1565319Ccdc85bcoiled-coil domain containing 85B1202763645202764660Rat
1562492Slc6a21solute carrier family 6 member 2119575425795765854Rat
1561380Vom2r-ps60vomeronasal 2 receptor, pseudogene 6017307408873077556Rat
1565366Hmx2H6 family homeobox 21186319110186326771Rat
1565383Ppfibp2PPFIA binding protein 21161504774161687339Rat
1359564Tsen34tRNA splicing endonuclease subunit 3416551732465525194Rat
1563670Cabp2calcium binding protein 21201374649201380469Rat
1562079Sdhaf1succinate dehydrogenase complex assembly factor 118557620785577156Rat
1565545Zfp865zinc finger protein 86516880530268809780Rat
1561254Acer3alkaline ceramidase 31152504180152606596Rat
1582860Senp5l1SUMO specific peptidase 5 like 11205625490205628352Rat
1565301Rps18l4ribosomal protein S18-like 41168385938168386642Rat
1566189Ftl1l7ferritin light chain 1 like 71165377580165378490Rat
1565566Rpl18al1ribosomal protein L18A like 116149419661494783Rat
1565233Smok2asperm motility kinase 2A15357073753580441Rat
1565248Vom2r-ps52vomeronasal 2 receptor, pseudogene 5217074224470761439Rat
15829832200002J24RiklRIKEN cDNA 2200002J24 gene like18592663885949890Rat
1582803Vmn2r116l-ps36vomeronasal 2, receptor 116 like, pseudogene 361174983856174997928Rat
1562499Sec1secretory blood group 119614339096164249Rat
1583944Shisa7shisa family member 716899390069012943Rat
1593018Snrpd2small nuclear ribonucleoprotein D2 polypeptide17879837778801227Rat
1593867Trim68tripartite motif containing 681157114044157127494Rat
1592985Entrep2endosomal transmembrane epsin interactor 21118288365118700514Rat
1594328Slc6a19solute carrier family 6 member 1912958619129604964Rat
1589755Tyrtyrosinase1141115036141210207Rat
1592780Zfp551zinc finger protein 55117254381572554060Rat
1593913Bcl2l1-ps1Bcl2-like 1, pseudogene 11157042301157044415Rat
1587684Timm50translocase of inner mitochondrial membrane 5018357487283582748Rat
1593515Catsper1cation channel, sperm associated 11202643009202652059Rat
1590594Cep20-ps1centrosomal protein 20, pseudogene 11147104492147105471Rat
1590598Mob1a-ps1MOB kinase activator 1A, pseudogene 116379954163800341Rat
1583737Kctd15potassium channel tetramerization domain containing 1518725865887271979Rat
1586317Gpr137G protein-coupled receptor 1371204129636204132622Rat
1590429Mtdh-ps1metadherin, pseudogene 117205854272061303Rat
1587347Wdr11WD repeat domain 111184165260184210834Rat
1589754UvragUV radiation resistance associated1153185356153442200Rat
1586339Atp5mc1l1ATP synthase membrane subunit c locus 1 like 11204076870204077456Rat
1587126Vom2r42vomeronasal 2 receptor, 421139549127139593601Rat
1589774Or51p1olfactory receptor family 51 subfamily P member 11157523148157524089Rat
1588657Sbf2SET binding factor 21164352892164719883Rat
1591403Zfp59zinc finger protein 5918330791683330139Rat
1591436Or51h1l1olfactory receptor family 51 subfamily H member 1 like 11157358640157363279Rat
1588673Hsd17b14hydroxysteroid (17-beta) dehydrogenase 1419602922496039577Rat
1589953Slc25a45solute carrier family 25, member 451203166362203174473Rat
1589465Bcl3BCL3, transcription coactivator17947136879485908Rat
1589454Atp5f1c-ps1ATP synthase F1 subunit gamma, pseudogene 114740725947408527Rat
1589140Nlrp2NLR family pyrin domain containing 216951550569554689Rat
1593877Or52i2olfactory receptor family 52 subfamily I member 21157105171157106151Rat
1591372Vom2r8vomeronasal 2 receptor, 815468633054725985Rat
1589130Gp6glycoprotein VI16942923269492709Rat
1593681Ppp1r13lprotein phosphatase 1, regulatory subunit 13 like17901099779030714Rat
1586192Cfl1-ps5cofilin 1, pseudogene 51187296660187297219Rat
1591447Or51h5olfactory receptor family 51 subfamily H member 51157348962157350022Rat
1586888Ap3s2adaptor related protein complex 3 subunit sigma 21133818825133859269Rat
1592144Matr3-ps1matrin 3, pseudogene 11118609657118613368Rat
1588641Lmtk3lemur tyrosine kinase 319626105896280362Rat
1593127Vom2r-ps53vomeronasal 2 receptor, pseudogene 5317083178670855837Rat
1588652MamstrMEF2 activating motif and SAP domain containing transcriptional regulator19610971596116295Rat
1587090Vom2r43vomeronasal 2 receptor, 431139793253139815783Rat
1588954Cops7b-ps2COP9 signalosome subunit 7B, pseudogene 21162757275162758072Rat
1588958Gnai2-ps1G protein subunit alpha i2, pseudogene 11162752964162754015Rat
1588959Zfp526zinc finger protein 52618080779180817852Rat
1591347Vom2r9vomeronasal 2 receptor, 915485828654876546Rat
1588386LOC501391hypothetical LOC50139115331934553347305Rat
1590840Hnrnpa1-ps18heterogeneous nuclear ribonucleoprotein A1, pseudogene 1813400507334006590Rat
1590841Rpl10a-ps11ribosomal protein L10A, pseudogene 1113120294431203499Rat
1592191Ddx6-ps2DEAD-box helicase 6, pseudogene 216377535563776969Rat
1590972Stk33serine/threonine kinase 331163276176163458580Rat
1592206Vom2r22vomeronasal 2 receptor, 2216368007663706948Rat
1592197Or10ab5olfactory receptor family 10 subfamily AB member 51162529010162529975Rat
1590983Wnk3-ps1WNK lysine deficient protein kinase 3, pseudogene 116444996864458758Rat
1593885Or51h1olfactory receptor family 51 subfamily H member 11157090324157091271Rat
1593886Or51f1olfactory receptor family 51 subfamily F member 11157278651157279610Rat
1591015Vom2r24vomeronasal 2 receptor, 2416389930963947881Rat
1585286Lrfn4leucine rich repeat and fibronectin type III domain containing 41201888569201891861Rat
1590493Vom2r7l1vomeronasal 2 receptor, 7 like 115962727759643957Rat
1588836Spaca6sperm acrosome associated 615867212858689309Rat
1583739Dmrtc2DMRT-like family C218046625980473883Rat
1589241Vmn2r116l-ps23vomeronasal 2, receptor 116 like, pseudogene 2317143036371453097Rat
1587464Spaca4sperm acrosome associated 419619551496196187Rat
1588550Hspd1-ps5heat shock protein family D (Hsp60) member 1, pseudogene 51174752712174754893Rat
1585208C1h19orf12similar to human chromosome 19 open reading frame 1219087357890887205Rat
1583615Magel2MAGE family member L21115880142115884684Rat
1588939Ric3RIC3 acetylcholine receptor chaperone1163030621163086583Rat
1589046Ifnl3interferon, lambda 318381445683816096Rat
1588883Cdk2ap2cyclin-dependent kinase 2 associated protein 21201391056201393137Rat
1559447Pth2parathyroid hormone 219566652595667174Rat
1561123Itgaxintegrin subunit alpha X1182709653182740709Rat
1590509Polr3g-ps2RNA polymerase III subunit G, pseudogene 215953966859540428Rat
1587109Vom2r42l1vomeronasal 2 receptor, 42 like 11139696920139763181Rat
1588463Vom2r78vomeronasal 2 receptor, 7817190774771954622Rat
1585733LOC682259similar to Tetraspanin-7 (Tspan-7) (Transmembrane 4 superfamily member 2) (Cell surface glycoprotein A15) (T-cell acute lymphoblastic leukemia-associated antigen 1) (TALLA-1) (Membrane component, X chromosome, surface marker 1) (CD231 antigen)...1122232825122233599Rat
1586034Dnaja4-ps1DnaJ heat shock protein family (Hsp40) member A4, pseudogene 112732226827323406Rat
1586738Zfpl1zinc finger protein-like 11203374500203378518Rat
1586097Nt5c2-ps25'-nucleotidase, cytosolic II, pseudogene 214269972042701497Rat
1586100Rab1-ps1RAB1, member RAS oncogene family, pseudogene 113879930038800803Rat
1586104Hdac1-ps17Histone deacetylase 1, pseudogene 1712801008128010909Rat
1586105Hnrnpa1-ps43heterogeneous nuclear ribonucleoprotein A1, pseudogene 4312675747026758537Rat
1586106Sec24c-ps2SEC24 homolog C, COPII coat complex component, pseudogene 212671385926716732Rat
1586108Zbed4-ps1zinc finger, BED-type containing 4, pseudogene 112390376923906388Rat
1586193Gapdh-ps109Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 1091172292417172292996Rat
1585397Rpsa-ps8ribosomal protein SA, pseudogene 818394033683942080Rat
1585399Acp7acid phosphatase 7, tartrate resistant18389648583923436Rat
1589872Lilrc2leukocyte immunoglobulin-like receptor, subfamily C, member 216527213465277278Rat
1584452Dhx34DExH-box helicase 3417688086776905148Rat
1359537Cln3CLN3 lysosomal/endosomal transmembrane protein, battenin1181156071181169458Rat
1589890Atg2aautophagy related 2A1203542559203562242Rat
1589918Bcl2l13-ps1Bcl2-like 13, pseudogene 112889484128901203Rat
1584032Zfp939zinc finger protein 93919112835691142632Rat
1589798Gys1glycogen synthase 119591544395935292Rat
1590949Zik1zinc finger protein interacting with K protein 116491683164963590Rat
1589827Pirbpaired Ig-like receptor B16549919565506666Rat
1589843Snrpc-ps4small nuclear ribonucleoprotein polypeptide C, pseudogene 416538264365383428Rat
1584466Snx9sorting nexin 914642489746510096Rat
1560660Fkbp2FKBP prolyl isomerase 21204167724204170399Rat
1566072Dock1dedicator of cyto-kinesis 11189467143189983777Rat
1583255Erich4glutamate-rich 418112355681125296Rat
1561521Dmkndermokine18601323786031243Rat
1563778Vom2r11vomeronasal 2 receptor, 1115949886359518653Rat
1585764Zfp945l1zinc finger protein 945 like 116248907862528100Rat
1590620Cwc15-ps1CWC15 spliceosome-associated protein, pseudogene 11119335619119336345Rat
1589941Pdcd2lprogrammed cell death 2-like18681029286822554Rat
1590913Slc25a5-ps3solute carrier family 25 member 5, pseudogene 31106191309106192280Rat
1590920Pkm-ps7pyruvate kinase M1/2, pseudogene 71152275198152278499Rat
1590921Dcaf8-ps1DDB1- and CUL4-associated factor 8, pseudogene 11146567388146579549Rat
1584044Caap1-ps1caspase activity and apoptosis inhibitor 1, pseudogene 119106999391077845Rat
1584045Vom2r-ps20vomeronasal 2 receptor, pseudogene 2015856064158561032Rat
1584052Dnhd1dynein heavy chain domain 11159990785160077990Rat
1584053C1h2orf78l1similar to human chromosome 2 open reading frame 78 like 119105646491063841Rat
1584802Ndufs6NADH:ubiquinone oxidoreductase subunit S612996883329977423Rat
1586637Ryr1ryanodine receptor 118429257884423824Rat
1585163Uqcrb-ps1ubiquinol-cytochrome c reductase binding protein, pseudogene 119101732891017808Rat
1583370Cep43centrosomal protein 4315253341852564025Rat
1587386Fth1-ps4ferritin heavy chain 1, pseudogene 412363807123638977Rat
1587443Saal1serum amyloid A-like 119719868597218131Rat
1585448Cdca5l1cell division cycle associated 5 like 11204748183204749513Rat
1586255Rps14-ps6ribosomal protein S14, pseudogene 61168339073168339543Rat
1589010Naa38-ps1N(alpha)-acetyltransferase 38, NatC auxiliary subunit, pseudogene 11134093191134093669Rat
1586242Zfp78zinc finger protein 7816750862767524972Rat
1587036Dut-psdeoxyuridine triphosphatase pseudogene14836874848369608Rat
1588225Nt5c3a-ps15'-nucleotidase, cytosolic IIIA, pseudogene 11194832479194833350Rat
1598059Vmp1-ps1vacuole membrane protein 1, pseudogene 11195863294195875733Rat
1598060Mogat2monoacylglycerol O-acyltransferase 21153521813153545756Rat
1598061MGC94891hypothetical protein LOC68121015174032851764041Rat
1593455Tmem86btransmembrane protein 86B16921810969220474Rat
1595818Zfp296zinc finger protein 29617922864979231866Rat
1596229Rps2-ps13ribosomal protein S2, pseudogene 131183041102183041973Rat
1591760Nkpd1NTPase, KAP family P-loop domain containing 117916564279175126Rat
1594535Eif4g2-ps2eukaryotic translation initiation factor 4, gamma 2, pseudogene 218175467681757322Rat
1594536Wdr13-ps1WD repeat domain 13, pseudogene 117847144378473151Rat
1597344Uqcc3ubiquinol-cytochrome c reductase complex assembly factor 31205773591205774369Rat
1597345Zfp141zinc finger protein 14119313057493164293Rat
1597359Lrrn4clLRRN4 C-terminal like1205743580205759879Rat
1596113Tmed5-ps1transmembrane p24 trafficking protein 5, pseudogene 11158424491158425578Rat
1595446Cldn20claudin 2014413376944134428Rat
1593977Rpl21-ps17ribosomal protein L21, pseudogene 171148209812148210306Rat
1593186Prss36serine protease 361182543085182561141Rat
1596153Ccdc87coiled-coil domain containing 871202135021202137717Rat
1595416Prr19proline rich 1918088452980890712Rat
1597185Phgdh-ps2phosphoglycerate dehydrogenase, pseudogene 217841878278420350Rat
1597196Vom1r-ps59vomeronasal 1 receptor pseudogene 5917280242172803373Rat
1597421C1h11orf86similar to human chromosome 11 open reading frame 861201784009201785916Rat
1597422Hbb-bshemoglobin, beta adult s chain1158218356158219741Rat
1597448Fam187bfamily with sequence similarity 187, member B18620523486219542Rat
1593461Klk5kallikrein related-peptidase 519429657494304768Rat
1593465Cenpwcentromere protein W12752532427530464Rat
1593467Znrd2zinc ribbon domain containing 21203017682203019465Rat
1595911Tmem145transmembrane protein 14518089188880901615Rat
1596943Zc3h4zinc finger CCCH-type containing 417710630977143827Rat
1594649Bsph1binder of sperm protein homolog 117441397674450117Rat
1594658Pla2g4cphospholipase A2 group IVC17423771474275757Rat
1596105Apbhandrogen-binding protein eta18658813786589425Rat
1596054Ubtd2-ps1ubiquitin domain containing 2, pseudogene 11206219078206220329Rat
1596055Rnaseh2b-ps1ribonuclease H2, subunit B, pseudogene 116128864061289557Rat
1592235Vom2r19vomeronasal 2 receptor 1916360038263616018Rat
1592241Smapl-ps1small acidic protein like, pseudogene 11162387205162387742Rat
1592248Vom2r17vomeronasal 2 receptor, 1716347828663493714Rat
1593285Hspd1-ps7heat shock protein family D (Hsp60) member 1, pseudogene 71103645663103648170Rat
1593423Skp2-ps1S-phase kinase-associated protein 2, pseudogene 11162065613162066882Rat
1595996C1h19orf18similar to human chromosome 19 open reading frame 1817302232473049934Rat
1593979Zfp58zinc finger protein 5813502047735053203Rat
1592604Krtap5-8keratin associated protein 5-81197446125197446817Rat
1593368Cfap119cilia and flagella associated protein 1191182197171182216936Rat
1593397Klk15-ps3kallikrein-related peptidase 15, pseudogene 319449917794505830Rat
1594179DmwdDM1 locus, WD repeat containing17872243678729224Rat
1594599Zfp764l1zinc finger protein 764 like 11182003282182005886Rat
1588628Kpna1-ps9karyopherin subunit alpha 1, pseudogene 91164788138164789691Rat
1589436Ceacam19CEA cell adhesion molecule 1917954210779550927Rat
1596474Cyp2b15cytochrome P450, family 2, subfamily b, polypeptide 1518209418882106492Rat
1591707Polr1gRNA polymerase I subunit G17900749079010766Rat
1591721Pank1-ps1pantothenate kinase 1, pseudogene 11146724869146733032Rat
1593129Vom2r-ps39vomeronasal 2 receptor, pseudogene 3916411318064152375Rat
1593130Vom2r-ps23vomeronasal 2 receptor, pseudogene 2315973983659751235Rat
1593398Vom2r-ps30vomeronasal 2 receptor, pseudogene 3016302604763039702Rat
1593410Zfp40zinc finger protein 4016296245662985007Rat
1592569Rrm1ribonucleotide reductase catalytic subunit M11156823960156848262Rat
1592570Zfp780bzinc finger protein 780B18305899383182629Rat
1594860Saa3serum amyloid A 319721870697222150Rat
1594591Fbrsfibrosin1182090741182104026Rat
1594592Prr14proline rich 141182083838182089330Rat
1593138Zswim5-ps1zinc finger, SWIM-type containing 5, pseudogene 115491844454923515Rat
1593144Hnrnpa1-ps10heterogeneous nuclear ribonucleoprotein A1, pseudogene 1014818954448190737Rat
1593145Rpl13a-ps12ribosomal protein L13A, pseudogene 1214288511242885723Rat
1592737Or51d1olfactory receptor family 51 subfamily D member 11157134584157135641Rat
1597161LOC301792clone rb2 rab1a related protein pseudogene13639757136398662Rat
1592591Vom2r7vomeronasal 2 receptor, 715429248454321356Rat
1593335Parl-ps1presenilin associated, rhomboid-like, pseudogene 11183970720183973464Rat
1596020Cd33CD33 molecule19393541893940452Rat
1596035Rps24-ps19ribosomal protein S24, pseudogene 191206293099206293621Rat
1593387Vmn2r116l-ps34vomeronasal 2, receptor 116 like, pseudogene 3416319616563225205Rat
1593392Vom2r15vomeronasal 2 receptor, 1516307644063092260Rat
1594836Dr1-ps1down-regulator of transcription 1, pseudogene 112564945525650368Rat
1596000Rps15a-ps9ribosomal protein S15a, pseudogene 91179267937179268386Rat
1596870Zc3h11a-ps2zinc finger CCCH-type containing 11A, pseudogene 21116013406116016461Rat
1588968Dedd2death effector domain containing 218078908480807789Rat
1588758Usp17l8ubiquitin specific peptidase 17 like family member 81159173249159182920Rat
1594161Ccdc83coiled-coil domain containing 831144167993144225622Rat
1591724Bloc1s3biogenesis of lysosomal organelles complex-1, subunit 317915587379158247Rat
1589375Utf1undifferentiated embryonic cell transcription factor 11194740339194741465Rat
1594632MazMYC associated zinc finger protein1181629742181635193Rat
1593384Vom2r16vomeronasal 2 receptor, 1616323637863254508Rat
1594617Obox1oocyte specific homeobox 117648603376487471Rat
1594796Tpd52l1TPD52 like 112617203826290704Rat
1594809Snx12-ps1sorting nexin 12, pseudogene 11158460071158460615Rat
1597558Rpl36a-ps16ribosomal protein L36A, pseudogene 161181198779181200729Rat
1588779Frmd1FERM domain containing 115507928555090230Rat
1588686Dhdhdihydrodiol dehydrogenase19595436195965262Rat
1588687Ndufa3NADH:ubiquinone oxidoreductase subunit A316559756765600197Rat
1596282Vmn2r116l-ps12vomeronasal 2, receptor 116 like, pseudogene 1219345631293545002Rat
1588967Or5e1olfactory receptor family 5 subfamily E member 11162724328162725263Rat
1594173Zfp729bzinc finger protein 729b13510273235137107Rat
1594701Zfp758zinc finger protein 75816194128461989354Rat
1597218Vom1r-ps51vomeronasal 1 receptor pseudogene 5117233212372333075Rat
1595500Psma7-ps1proteasome 20S subunit alpha 7, pseudogene 113432412834324855Rat
1595505Lims1-ps1LIM zinc finger domain containing 1, pseudogene 114343510143436082Rat
1588614Ncr3lg1natural killer cell cytotoxicity receptor 3 ligand 119656566496581825Rat
1588619Nlrp4fNLR family, pyrin domain containing 4F16627307966294331Rat
1592887Lysmd4LysM domain containing 41120839180120845148Rat
1595515Ap2b1-ps1adaptor related protein complex 2 subunit beta 1, pseudogene 113429219034295856Rat
1591735Trappc6atrafficking protein particle complex subunit 6A17915858779165502Rat
1591792Mark4microtubule affinity regulating kinase 417907535379108882Rat
1597332Vom2r37vomeronasal 2 receptor, 3719325799393318774Rat
1597339C1h11orf98similar to human chromosome 11 open reading frame 981205782612205784578Rat
1590363Or5ae2olfactory receptor family 5 subfamily AE member 21138804766138805713Rat
1593807Bud23-ps1BUD23, rRNA methyltransferase and ribosome maturation factor, pseudogene 116478332664784275Rat
15901754930488N24RiklRIKEN cDNA 4930488N24 gene like15501996455023500Rat
1595956Vom2r34vomeronasal 2 receptor, 3417316704173188440Rat
1595960Vom2r33vomeronasal 2 receptor, 3317313753673156082Rat
1590087Or5p80olfactory receptor family 5 subfamily P member 801162509473162510405Rat
1593322Dmbt1l1deleted in malignant brain tumors 1 like 11185949897186084340Rat
1596774Tpbgltrophoblast glycoprotein-like1153923722153926548Rat
1592539Exoc3l2exocyst complex component 3-like 217911378479145359Rat
1597035Gemin7gem (nuclear organelle) associated protein 717921505479228769Rat
1593252Tead2TEA domain transcription factor 219570236695719186Rat
1591322Eid2EP300 interacting inhibitor of differentiation 218353827483539599Rat
1592552Uqcrbl1ubiquinol-cytochrome c reductase binding protein like 11133425137133425500Rat
1592568Prr33proline rich 331197644903197650774Rat
1594613Rpl35-ps12ribosomal protein L35, pseudogene 1217649258076492951Rat
1595392Rgmbrepulsive guidance molecule BMP co-receptor b15676659856792396Rat
1590388Vom1r4-ps1vomeronasal 1 receptor 4, pseudogene 117186870771869669Rat
1594571Pepdpeptidase D18753665087681233Rat
1598109Morf4l1-ps7mortality factor 4 like 1, pseudogene 71115975577115976718Rat
1591907Psme2-ps3proteasome activator subunit 2, pseudogene 31181699598181701538Rat
1591909Hbe1l-ps1hemoglobin subunit epsilon 1 like, pseudogene 11158266601158267985Rat
1591913Traf7-ps1TNF receptor associated factor 7, pseudogene 11115943129115945159Rat
1591914Ccdc137-ps1coiled-coil domain containing 137, pseudogene 11106199727106208762Rat
1591915Mrgprb2MAS-related GPR, member B219840114098403162Rat
1591916Mrpl32-ps1mitochondrial ribosomal protein L32, pseudogene 119079444290798694Rat
1596692Fam174bfamily with sequence similarity 174, member B1127515393127618591Rat
1595844Ifitm3interferon induced transmembrane protein 31196111026196112135Rat
1595845Tial1Tia1 cytotoxic granule-associated RNA binding protein-like 11183008358183045092Rat
1595846Katnipkatanin interacting protein1180270194180436766Rat
1595847Trim66tripartite motif-containing 661163468944163539633Rat
1598121Ube2ql1ubiquitin conjugating enzyme E2 QL113354881433589174Rat
1598125Vom2r-ps67vomeronasal 2 receptor, pseudogene 671140594546140625318Rat
1595848Hbb-b1hemoglobin, beta adult major chain1158224175158231675Rat
1598280Ndufa13-ps4NADH:ubiquinone oxidoreductase subunit A13, pseudogene 41181908186181908668Rat
1598282Hsp90aa1-ps12heat shock protein 90 alpha family class A member 1, pseudogene 121179298331179300568Rat
1598357Atp6v0c-ps2ATPase H+ transporting V0 subunit C, pseudogene 216896317268963648Rat
1598358Casp3-ps2caspase 3, pseudogene 216842148168422311Rat
1598359Rpl7-ps16ribosomal protein L7, pseudogene 1616422334764224171Rat
1598360Vom2r-ps33vomeronasal 2 receptor, pseudogene 3316332297463336515Rat
1591896Cox6b2cytochrome c oxidase subunit 6B216909400969095312Rat
1598291Rpl23a-ps7ribosomal protein L23a, pseudogene 71149862205149862727Rat
1598292Rnd2-ps1rho family GTPase 2, pseudogene 11143925214143926854Rat
1598293Pgk1-ps7phosphoglycerate kinase 1, pseudogene 71142700683142701985Rat
1598361Vom2r-ps27vomeronasal 2 receptor, pseudogene 2716229778062325898Rat
1598214Pkm-ps17pyruvate kinase M1/2, pseudogene 171178160227178162181Rat
1598215Hnrnpa1-ps9heterogeneous nuclear ribonucleoprotein A1, pseudogene 91174829774174831052Rat
1598216Plekha7pleckstrin homology domain containing A71170364524170547843Rat
1598217Metap2-ps3methionyl aminopeptidase 2, pseudogene 31167766146167768505Rat
1598218Nlrp14NLR family, pyrin domain containing 141161069141161089158Rat
1598223Rpl3-ps4ribosomal protein L3, pseudogene 41147589211147590404Rat
1597985T2brachyury 215231171152385194Rat
1595928Dppa3l3developmental pluripotency associated 3 like 31181255033181256222Rat
1595934Vom1r55vomeronasal 1 receptor 5517372349273724388Rat
1594988Or52w1olfactory receptor family 52 subfamily W member 11159715755159716744Rat
1598222Nrbf2-ps1nuclear receptor binding factor 2, pseudogene 11158017949158018810Rat
1598219Atmin-ps1ATM interactor, pseudogene 11160351454160353967Rat
1598220Gvin1GTPase, very large interferon inducible 11160279767160306701Rat
1598221Eef1a1-ps4eukaryotic translation elongation factor 1 alpha 1, pseudogene 41158819049158820377Rat
1594694Vom2r12vomeronasal 2 receptor, 1216202261562045322Rat
1598312Mtrf1lmitochondrial translation release factor 1 like14220855342221020Rat
1597139Idh2isocitrate dehydrogenase (NADP(+)) 21134038644134057969Rat
1597140Trpm1transient receptor potential cation channel, subfamily M, member 11117718896117835434Rat
1595870Ppp1r37protein phosphatase 1, regulatory subunit 3717918079479212612Rat
1597413Slc25a5-ps10solute carrier family 25 member 5, pseudogene 101201788617201799402Rat
1598283Rpl27a-ps4ribosomal protein L27a, pseudogene 41168336483168336924Rat
1598284Eno1-ps9enolase 1, pseudogene 91167611484167612975Rat
1598285Nhp2-ps5NHP2 ribonucleoprotein, pseudogene 51164051065164052045Rat
1598286Rbmxl2Rbmx like 21161116768161118249Rat
1598287Hspa8-ps29heat shock protein family A (Hsp70) member 8, pseudogene 291159266674159268569Rat
1598290Ldha-ps3lactate dehydrogenase A, pseudogene 31156017007156018106Rat
1592663Paics-ps5phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase, pseudogene 515238715852390972Rat
1596303C1h2orf78-ps1similar to human chromosome 2 open reading frame 78, pseudogene 119282371492824634Rat
1592677Isoc2aisochorismatase domain containing 2A16893891668957179Rat
1598667Klk5l1kallikrein related-peptidase 5 like 119456668894571882Rat
3141Myl11myosin light chain 111181829703181832546Rat
735155Car11carbonic anhydrase 1119616990096175191Rat
1594231Zfp455l1zinc finger protein 455 like 113486693434944939Rat
2304343C1h16orf82similar to human chromosome 16 open reading frame 821179913067179915467Rat
1624201Zfp715zinc finger protein 71519370600593748131Rat
1642882Rab1bRAB1B, member RAS oncogene family1202405759202413850Rat
16424154933405O20RiklRIKEN cDNA 4933405O20 gene like1100300241100301711Rat
1642421Ceacam6CEA cell adhesion molecule 618041653180434668Rat
1642424C1h6orf120similar to human chromosome 6 open reading frame 12015595044955953173Rat
1626056Vom2r-ps57vomeronasal 2 receptor, pseudogene 5717140278871416085Rat
1626057Vom2r-ps55vomeronasal 2 receptor, pseudogene 5517110749171132846Rat
1626058Vom2r-ps18vomeronasal 2 receptor, pseudogene 1815476397354790926Rat
1626060Vom2r-ps49vomeronasal 2 receptor, pseudogene 4917057181670576977Rat
1626066Vom2r-ps25vomeronasal 2 receptor, pseudogene 2516206137362076753Rat
1626013Vom2r-ps66vomeronasal 2 receptor, pseudogene 661140519846140520742Rat
1626016Vom2r-ps51vomeronasal 2 receptor, pseudogene 5117069379270693938Rat
1626017Vom2r-ps48vomeronasal 2 receptor, pseudogene 4817049113970491308Rat
1626018Vom2r-ps46vomeronasal 2 receptor, pseudogene 4616660995266610070Rat
1626019Vom2r-ps44vomeronasal 2 receptor, pseudogene 4416645899166459134Rat
1626021Vom2r-ps42vomeronasal 2 receptor, pseudogene 4216512650365126822Rat
1626022Vom2r-ps32vomeronasal 2 receptor, pseudogene 3216329059663290839Rat
1626023Vom2r-ps31vomeronasal 2 receptor, pseudogene 3116306117863061342Rat
1626024Vom2r-ps19vomeronasal 2 receptor, pseudogene 1915852331058523375Rat
1626025Vom2r-ps17vomeronasal 2 receptor, pseudogene 1715475849254759374Rat
1626026Vom2r-ps15vomeronasal 2 receptor, pseudogene 1515441160154412412Rat
1626031Vom2r-ps40vomeronasal 2 receptor, pseudogene 4016447742664482501Rat
1626035Vom2r-ps62vomeronasal 2 receptor, pseudogene 621116129167116157652Rat
1626036Vom2r-ps37vomeronasal 2 receptor, pseudogene 3716373487763738409Rat
2290038Hbbl1hemoglobin subunit beta like 11158236972158238348Rat
1626046Vom2r-ps63vomeronasal 2 receptor, pseudogene 631138892457138892798Rat
1626051Vom2r-ps26vomeronasal 2 receptor, pseudogene 2616220334962219682Rat
1641977Vom2r-ps64vomeronasal 2 receptor, pseudogene 641139409799139410704Rat
2302685Insyn2ainhibitory synaptic factor 2A1189697856189753194Rat
2291792Hiat1-ps1hippocampus abundant gene transcript 1, pseudogene 116675609366759019Rat
2301983Inafm1InaF-motif containing 117697680876978292Rat
2311609Mettl9methyltransferase 9, His-X-His N1(pi)-histidine1175575805175623065Rat
2313189FcgbpFc gamma binding protein18337497983413082Rat
2311471C1h10orf90similar to human chromosome 10 open reading frame 901189059744189293353Rat
2314256Rasl2-9RAS-like, family 2, locus 916872087968734930Rat
2314879Mir483microRNA 4831197818396197818468Rat
2314883Mir675microRNA 6751197732275197732358Rat
2314887Mir210microRNA 2101196326343196326452Rat
2314890Mir935microRNA 93516575577765755867Rat
2316375Vom1r-ps108vomeronasal 1 receptor pseudogene 10817207214372073118Rat
2316393Vom1r-ps67vomeronasal 1 receptor pseudogene 671131058349131059234Rat
2316409Vom1r-ps66vomeronasal 1 receptor pseudogene 6617400069074000806Rat
2316410Vom1r-ps65vomeronasal 1 receptor pseudogene 6517393410173934877Rat
2316411Vom1r-ps64vomeronasal 1 receptor pseudogene 6417287790672879059Rat
2316412Vom1r-ps63vomeronasal 1 receptor pseudogene 6317286494672865812Rat
2316413Vom1r-ps62vomeronasal 1 receptor pseudogene 6217285126472852372Rat
2316416Vom1r-ps58vomeronasal 1 receptor pseudogene 5817278111172782110Rat
2316417Vom1r-ps57vomeronasal 1 receptor pseudogene 5717274397072744343Rat
2316418Vom1r-ps56vomeronasal 1 receptor pseudogene 5617270786672708726Rat
2316419Vom1r-ps55vomeronasal 1 receptor pseudogene 5617266314772664066Rat
2316420Vom1r-ps54vomeronasal 1 receptor pseudogene 5417253147872532127Rat
2316421Vom1r-ps53vomeronasal 1 receptor pseudogene 5317243448372435219Rat
2316422Vom1r-ps52vomeronasal 1 receptor pseudogene 5217243197672432887Rat
2316423Vom1r-ps50vomeronasal 1 receptor pseudogene 5017210443872105320Rat
2316424Vom1r-ps49vomeronasal 1 receptor pseudogene 4917209816172098365Rat
2316425Vom1r-ps48vomeronasal 1 receptor pseudogene 4817158426471584852Rat
2316426Vom1r-ps47vomeronasal 1 receptor pseudogene 4717078531770786202Rat
2316427Vom1r-ps46vomeronasal 1 receptor pseudogene 4617056819570569130Rat
2316428Vom1r-ps45vomeronasal 1 receptor pseudogene 4516866604968667012Rat
2316429Vom1r-ps43vomeronasal 1 receptor pseudogene 4316822803768229030Rat
2316430Vom1r-ps42vomeronasal 1 receptor pseudogene 4216667521266676158Rat
2316431Vom1r-ps41vomeronasal 1 receptor pseudogene 4116632327366323819Rat
2316432Vom1r-ps40vomeronasal 1 receptor pseudogene 4016632207366322407Rat
2316433Vom1r-ps38vomeronasal 1 receptor pseudogene 3816485358364854497Rat
2316434Vom1r-ps37vomeronasal 1 receptor pseudogene 3716480059164801505Rat
2316436Vom1r-ps35vomeronasal 1 receptor pseudogene 3516467363264674530Rat
2316437Vom1r-ps34vomeronasal 1 receptor pseudogene 3416464490964645788Rat
2316438Vom1r-ps33vomeronasal 1 receptor pseudogene 3316460693564607380Rat
2316439Vom1r-ps32vomeronasal 1 receptor pseudogene 3216460221164603107Rat
2316440Vom1r-ps31vomeronasal 1 receptor pseudogene 3116457417464574700Rat
2316441Vom1r-ps30vomeronasal 1 receptor pseudogene 3016444065664441509Rat
2316442Vom1r-ps29vomeronasal 1 receptor pseudogene 2916437978464380200Rat
2316443Vom1r-ps28vomeronasal 1 receptor pseudogene 2816424550164246027Rat
2316444Vom1r-ps27vomeronasal 1 receptor pseudogene 2716421151264211696Rat
2316445Vom1r-ps26vomeronasal 1 receptor pseudogene 2616154452461545500Rat
2316446Vom1r-ps25vomeronasal 1 receptor pseudogene 2516097495360975797Rat
2316447Vom1r-ps24vomeronasal 1 receptor pseudogene 2416088943860890343Rat
2316448Vom1r-ps23vomeronasal 1 receptor pseudogene 2316084445460845360Rat
2316449Vom1r-ps22vomeronasal 1 receptor pseudogene 2216080057560801484Rat
2316450Vom1r-ps21vomeronasal 1 receptor pseudogene 2116078164160782745Rat
2316451Vom1r-ps20vomeronasal 1 receptor pseudogene 2016065209760653145Rat
2316452Vom1r-ps19vomeronasal 1 receptor pseudogene 1916061434460615217Rat
2316453Vom1r-ps18vomeronasal 1 receptor pseudogene 1816060068760601667Rat
2316454Vom1r-ps17vomeronasal 1 receptor pseudogene 1716056404360564570Rat
2316414Vom1r-ps61vomeronasal 1 receptor pseudogene 6117283983672840007Rat
2316455Vom1r-ps16vomeronasal 1 receptor pseudogene 1616053167560532572Rat
2316456Vom1r-ps15vomeronasal 1 receptor pseudogene 1516052160360522225Rat
2316457Vom1r-ps14vomeronasal 1 receptor pseudogene 1416049389560494572Rat
2316458Vom1r-ps13vomeronasal 1 receptor pseudogene 1316037721560378149Rat
2316459Vom1r-ps12vomeronasal 1 receptor pseudogene 1216034079560341757Rat
2316460Vom1r-ps11vomeronasal 1 receptor pseudogene 1116015801060158933Rat
2316461Vom1r-ps10vomeronasal 1 receptor pseudogene 1016010401360104730Rat
2316462Vom1r-ps9vomeronasal 1 receptor pseudogene 915997355059974440Rat
2316463Vom1r-ps8vomeronasal 1 receptor pseudogene 815954769359548587Rat
2316464Vom1r-ps7vomeronasal 1 receptor pseudogene 715944990559450492Rat
2316465Vom1r-ps6vomeronasal 1 receptor pseudogene 615919111759191991Rat
2316466Vom1r-ps5vomeronasal 1 receptor pseudogene 515897822558979069Rat
2316467Vom1r-ps4vomeronasal 1 receptor pseudogene 415894793858948796Rat
2316468Vom1r-ps3vomeronasal 1 receptor pseudogene 315465816854659198Rat
2316469Vom1r-ps2vomeronasal 1 receptor pseudogene 215452185454522753Rat
2316470Vom1r60vomeronasal 1 receptor 6017405859574059542Rat
2316471Vom1r39vomeronasal 1 receptor 3916838813468389051Rat
2316472Vom1r16vomeronasal 1 receptor 1616066180460662751Rat
2316473Vom1r13vomeronasal 1 receptor 1316026436760265317Rat
2316475Vom1r9vomeronasal 1 receptor 916003294960033899Rat
2316476Vom1r17vomeronasal 1 receptor 1716077020660771111Rat
2316477Vom1r-ps68vomeronasal 1 receptor pseudogene 6816473140064732295Rat
2319730Or52a20l1olfactory receptor family 52 subfamily A member 20 like 11158123097158125018Rat
2319141Rnaseh2cribonuclease H2, subunit C1202894626202895675Rat
2319766Lias-ps2lipoic acid synthetase, pseudogene 21108802590108803356Rat
2319165Vps51VPS51 subunit of GARP complex1203360434203370422Rat
2319167C1h19orf33similar to human chromosome 19 open reading frame 3318454983084550666Rat
2319808Eif3el1eukaryotic translation initiation factor 3, subunit E like 117377449173775984Rat
2319215Zfp160zinc finger protein 16016068377560706242Rat
2319903Ankrd37-ps1ankyrin repeat domain 37, pseudogene 11181915673181916779Rat
2319938Rad9aRAD9 checkpoint clamp component A1201488511201553582Rat
2318093Haus5HAUS augmin-like complex, subunit 518591237185924327Rat
2318763Catsperzcatsper channel auxiliary subunit zeta1204114816204118582Rat
2319415Spty2d1SPT2 chromatin protein domain containing 119753149597549616Rat
2318858Zfp54-ps2zinc finger protein 54, pseudogene 216110246561104428Rat
2320113Klk1c4kallikrein 1-related peptidase C419443457494438678Rat
2318883Snrpepl2small nuclear ribonucleoprotein polypeptide E like 21133709656133710137Rat
2318912Rpl28l4ribosomal protein L28 like 418305631883056902Rat
2318913Vom1r112vomeronasal 1 receptor 11216080975260810719Rat
2318344C1h10orf143similar to human chromosome 10 open reading frame 1431192184440192222676Rat
2318927Zfp494l1zinc finger protein 494 like 117207362872092260Rat
2318957Cdc42se2-ps1CDC42 small effector 2, pseudogene 119128740091290387Rat
2318958Zfp27zinc finger protein 2718511745585130578Rat
2317875Mir343microRNA 34317903845479038546Rat
2318374Arhgap33Rho GTPase activating protein 3318577611285789767Rat
2320229Set-ps1Set nuclear proto-oncogene, pseudogene 119775323397797449Rat
2318412Oca2OCA2 melanosomal transmembrane protein1107116278107446093Rat
2318452Tmem262transmembrane protein 2621203373325203374866Rat
2319700Nlrp4b-ps2NLR family, pyrin domain containing 4B, pseudogene 217101090271056467Rat
2320534Fpr2-ps1formyl peptide receptor 2, pseudogene 115882994558831557Rat
2321314Atxn1-ps1ataxin 1, pseudogene 11102516795102517889Rat
2321315Rps19l3ribosomal protein S19-like 317661007576610605Rat
2322090Ran-ps2RAN, member RAS oncogene family, pseudogene 219864557498655680Rat
2323421Or5p81bolfactory receptor family 5 subfamily P member 81B1162646352162647296Rat
2320559LOC100361204mas-related G-protein coupled receptor member B8-like19804940998050395Rat
2322792Flt3lgFms related receptor tyrosine kinase 3 ligand19561505695620463Rat
2322813Cd177l1CD177 molecule like 118028819280293773Rat
2320676Clp1-ps1cleavage factor polyribonucleotide kinase subunit 1, pseudogene 11105449881105451267Rat
2322257Rps27-ps9ribosomal protein S27, pseudogene 91128028275128028907Rat
2320729Rchy1-ps1ring finger and CHY zinc finger domain containing 1, pseudogene 11137830459137831886Rat
2322891Vstm1V-set and transmembrane domain containing 116568698965704073Rat
2322921Nmur1-ps1neuromedin U receptor 1, pseudogene 11188988752188990053Rat
2322933Srsf7-ps1serine and arginine rich splicing factor 7, pseudogene 11124210206124239378Rat
2322934Cyp2b14l1cytochrome P450, family 2, subfamily b, polypeptide 14 like 118195835481963641Rat
2322334Cdca4-ps2cell division cycle associated 4, pseudogene 21140183390140192383Rat
2323012Srrm5serine/arginine repetitive matrix 518010304280104777Rat
2320863Kctd18-ps1potassium channel tetramerization domain containing 18, pseudogene 11197301146197302301Rat
2320865Atxn1-ps2ataxin 1, pseudogene 21103672445103674674Rat
2320881Rpl36l2ribosomal protein L36 like 218606252586062968Rat
2320900Rpl36l3ribosomal protein L36 like 31180985733180986204Rat
2323071Dcaf12-ps1DDB1 and CUL4 associated factor 12, pseudogene 11123731057123733750Rat
2323073Tarm1l1T cell-interacting, activating receptor on myeloid cells 1 like 116564545965662505Rat
2321719Zfp780b-ps1zinc finger protein 780B, pseudogene 118324779383265406Rat
2323115Cyp2s1-ps1cytochrome P450, family 2, subfamily s, polypeptide 1, pseudogene 118136736581368986Rat
2322541Mrgprb13-ps1MAS-related GPR, member B13, pseudogene 119800209198004379Rat
2321003Rpl9-ps30ribosomal protein L9, pseudogene 3017662257576623279Rat
2321751Zranb1zinc finger RANBP2-type containing 11187725354187780129Rat
2321033Rps12l9ribosomal protein S12 like 917661655676617067Rat
2323231Scly-ps1selenocysteine lyase, pseudogene 11162839235162842235Rat
2321078RelbRELB proto-oncogene, NF-kB subunit17925773879285490Rat
2321863FanciFA complementation group I1133327264133383661Rat
2321883LOC100360574alcohol sulfotransferase-like17466230074719434Rat
2323264Tmem91transmembrane protein 9118117948381187005Rat
2323265Nlrp4b-ps3NLR family, pyrin domain containing 4B, pseudogene 316499629265006507Rat
2321127LOC100360933cDNA sequence BC048679-like1135445623135449427Rat
2321900Or13a19olfactory receptor family 13 subfamily A member 191195196027195196956Rat
2321930Grb2-ps1growth factor receptor bound protein 2, pseudogene 119301652893018833Rat
2322689Ncl-ps6nucleolin, pseudogene 61192181207192182026Rat
2321947Brcc3-ps2BRCA1/BRCA2-containing complex, subunit 3, pseudogene 21140762660140885589Rat
2323362Wnk3-ps2WNK lysine deficient protein kinase 3, pseudogene 216461237164626943Rat
2320477Pdzd11-ps1PDZ domain containing 11, pseudogene 11148917133148917842Rat
2320478Hsp90ab1-ps1heat shock protein 90 alpha family class B member 1, pseudogene 11105948734105951090Rat
2320494Snrpa1small nuclear ribonucleoprotein polypeptide A'1119641402119654653Rat
2323487Dnaaf3dynein, axonemal, assembly factor 316929130069299365Rat
2323573EI24-ps1EI24, autophagy associated transmembrane protein, pseudogene 116401280464014212Rat
2323590Peg3paternally expressed 316709787467124692Rat
2324317Zfp945zinc finger protein 94516263013162702850Rat
2324357Scgb1d2-ps1secretoglobin, family 1D, member 2, pseudogene 11206434271206438940Rat
2324378Mtfr2-ps2mitochondrial fission regulator 2, pseudogene 215687145256872588Rat
4888587Mir3574microRNA 35741196326337196326454Rat
4888545Mir291bmicroRNA 291b16596377465963881Rat
2324470Tm9sf3-ps1transmembrane 9 superfamily member 3, pseudogene 11160899639160905468Rat
2324488Siglecl1SIGLEC family like 119391697193924742Rat
4888589Mir3572microRNA 357216556106565561172Rat
2323809Zfp628zinc finger protein 62816891360068921186Rat
2323829Zfp420zinc finger protein 42018509281085143682Rat
2323847Bud23-ps4BUD23, rRNA methyltransferase and ribosome maturation factor, pseudogene 416472421964725168Rat
4888565Mir344a-2microRNA 344a-21115243128115243234Rat
2325357Mir708microRNA 7081150599876150599963Rat
2325374Mir290microRNA 29016596464865964728Rat
2325383Mir139microRNA 1391155878828155878895Rat
2325387Mir125amicroRNA 125a15867762658677710Rat
2323908Hnrnpk-ps7heterogeneous nuclear ribonucleoprotein K, pseudogene 717848529778491177Rat
2325398Mir8microRNA 81132806420132806514Rat
2325427Mir192microRNA 1921203564946203565055Rat
2325431Mir99bmicroRNA 99b15867701558677084Rat
2325455Mir150microRNA 15019560502495605108Rat
2325463Mir9-3microRNA 9-31133440049133440138Rat
2325474Mir294microRNA 29416596268965962759Rat
2325475Mir293microRNA 29316596305065963121Rat
2325486Mir202microRNA 2021194754730194754801Rat
4108497Mir295-2microRNA 295-217327996673280046Rat
4108498Vom1r34vomeronasal 1 receptor 3416845247768453394Rat
4108499Mir295-1microRNA 295-116596256665962646Rat
2325541Mir292microRNA 29216596406265964143Rat
2325542Mir291amicroRNA 291a16596435065964431Rat
2325549Mir211microRNA 2111117777539117777644Rat
2325554Mir194-2microRNA 194-21203564761203564845Rat
2325606Mirlet7emicroRNA let-7e15867718058677272Rat
2325614Mir344-1microRNA 344-11115306861115306958Rat
2325620Mir330microRNA 33017883317878833274Rat
2325623Mir326microRNA 3261153854029153854123Rat
2324099Rps19-ps10ribosomal protein S19, pseudogene 101142882999142883492Rat
2324101Dcun1d3-ps1defective in cullin neddylation 1 domain containing 3, pseudogene 116649543566497050Rat
2324102Mrpl46-ps1mitochondrial ribosomal protein L46, pseudogene 114484687344856699Rat
2324147Psme3-ps1proteasome activator subunit 3, pseudogene 116646821766468962Rat
2324148Tiam2TIAM Rac1 associated GEF 214391817944119499Rat
2324149LOC100362709proteasome activator complex subunit 2-like13472220534723042Rat
4888550Mir344b-1microRNA 344b-11114623759114623856Rat
4888591Mir3569microRNA 356918584161685841691Rat
4888559Mir3597-3microRNA 3597-31133440038133440152Rat
4888580Mir3596cmicroRNA 3596c15867717158677287Rat
2324726Ppp1cb-ps2protein phosphatase 1 catalytic subunit beta, pseudogene 216835582668356778Rat
2324597Npsneuropeptide S1190077040190080821Rat
2324781Sult2a1-ps1sulfotransferase family 2A member 1, pseudogene 117484178374903941Rat
2325050Ddx18l1DEAD-box helicase 18 like 118531237185314713Rat
5491045Vom1r-ps44vomeronasal 1 receptor Vom1r-ps44 pseudogene16845284668453394Rat
6486569Mrgprb13-ps2MAS-related GPR, member B13, pseudogene 219803228298033552Rat
6486912Ybx1l1Y box binding protein 1 like 11171304587171306092Rat
6487069Lilrb1leukocyte immunoglobulin like receptor B116545726465464523Rat
6488322LOC100912195protein BEX1-like1110047861110051812Rat
6488981LOC100912071uncharacterized LOC1009120711154515779154571371Rat
6489976LOC100911864uncharacterized LOC1009118641165274998165281034Rat
6489367Vmn2r116l-ps26vomeronasal 2, receptor 116 like, pseudogene 261138892454138912931Rat
6489382Eef1a1-ps10eukaryotic translation elongation factor 1 alpha 1, pseudogene 101161270336161272186Rat
6489457LOC100912031uncharacterized LOC1009120311146790018146803474Rat
6489539LOC100912041uncharacterized LOC1009120411205619202205622491Rat
6488215Leng9leukocyte receptor cluster member 917003909970041559Rat
6485855Znf431l3zinc finger protein 431 like 319301932093038483Rat
6491878Misfamitochondrial sheath formation associated19752264197528961Rat
6485222Vmn2r116l-ps1vomeronasal 2, receptor 116 like, pseudogene 11139671255139673942Rat
6484896Cd79aCD79a molecule18049358180497936Rat
6485832Klk15-ps1kallikrein-related peptidase 15, pseudogene 119453388994545793Rat
6494996LOC100911093CCA tRNA nucleotidyltransferase 1, mitochondrial-like1170720730170722745Rat
6485896Zfp950l4zinc finger protein 950 like 419360728693628363Rat
6485475Zfp790l2zinc finger protein 790 like 218506943285086477Rat
6493251Nid2-ps2nidogen 2, pseudogene 213593681635964021Rat
6493325Ybx1-ps6Y box binding protein 1, pseudogene 618033332580334830Rat
6485887Hmgb1-ps20high-mobility group box 1, pseudogene 201157313524157314172Rat
6494165Znf865zinc finger protein 86516881066468824652Rat
6493379Dppa4-ps3developmental pluripotency-associated 4, pseudogene 31146603214146604124Rat
6487744Rps3a-ps1ribosomal protein S3a, pseudogene 11146750204146756584Rat
6494479Zfp502zinc finger protein 50212888439028908726Rat
6493686Ifnl1interferon, lambda 118379865183800297Rat
6491062Smokxl-ps8sperm motility kinase X like, pseudogene 816849755268506036Rat
6486156Zfp936zinc finger protein 93619294305992949011Rat
6491275Rhoq-ps1ras homolog family member Q, pseudogene 11106623061106624411Rat
6491324Rack1-ps2receptor for activated C kinase 1, pseudogene 21160670664160674437Rat
6487791Pmis2PMIS2 transmembrane protein18593122085931993Rat
6487804Ppid-ps5peptidylprolyl isomerase D, pseudogene 51153808461153838113Rat
6490164Snx18-ps1sorting nexin 18, pseudogene 11161003246161007281Rat
6494866LOC100911184vomeronasal type-1 receptor 4-like16489568064897945Rat
6494949LOC100911081uncharacterized LOC1009110811184919721184921647Rat
6491558Gapdh-ps50Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5017129324671297525Rat
6501805Ncl-ps2nucleolin, pseudogene 217556182876001703Rat
6498800Rps4x-ps10ribosomal protein S4, X-linked, pseudogene 101140897229140897968Rat
6495554Ppid-ps12peptidylprolyl isomerase D, pseudogene 1213406515534070734Rat
6498966Ybx1-ps5Y box binding protein 1, pseudogene 51102225708102227243Rat
6495781LOC10091088860S ribosomal protein L36-like1129764986129765341Rat
6495874LOC100910905uncharacterized LOC10091090518724982587251590Rat
6499280Zim3zinc finger imprinted 316686944166870364Rat
6502457Ccer2coiled-coil glutamate-rich protein 218404169784046225Rat
6496163Luzp2leucine zipper protein 21105597291105983605Rat
6499485Zfp82zinc finger protein 8218529146285311265Rat
6499588Znf599l-ps1zinc finger protein 599 like, pseudogene 118645346586484002Rat
6502881IqckIQ motif containing K1173199308173316982Rat
6499723Ldha-ps1lactate dehydrogenase A, pseudogene 11140009867140010890Rat
6496527Cox7a1cytochrome c oxidase subunit 7A118542216285447530Rat
6499943Ldha-ps12lactate dehydrogenase A, pseudogene 121140025282140027726Rat
6503302Clec19aC-type lectin domain containing 19A1172667793172677953Rat
6496810Ecsit-ps1ECSIT signaling integrator, pseudogene 11104502481104503645Rat
6500127Usp17la2ubiquitin specific peptidase 17-like a21159151417159155192Rat
6497155Mtg1mitochondrial ribosome-associated GTPase 11194931543194944278Rat
6500398Znf780bzinc finger protein 780B18300917483030463Rat
6500406Gfygolgi-associated, olfactory signaling regulator19566162195665300Rat
6500416Ftl1-ps1ferritin light chain 1, pseudogene 11100923579100924459Rat
6503647Rbm4b-ps1RNA binding motif protein 4B, pseudogene 11113739597113740013Rat
6497368LOC100910657sperm motility kinase Y-like15502005155039555Rat
6504299Sdr42e2short chain dehydrogenase/reductase family 42E, member 21175361630175382769Rat
6501417Ube2n-ps3ubiquitin-conjugating enzyme E2N, pseudogene 318497185184972973Rat
7489047Scarna15small Cajal body-specific RNA 151135484620135484683Rat
7489017Mir344gmicroRNA 344g1115343044115343122Rat
7240857Trim34tripartite motif-containing 341158707172158720214Rat
7498933Znf235-ps1zinc finger protein 235, pseudogene 117979976679808543Rat
7489020Mir6315microRNA 63151203363908203364008Rat
7489023Mir344imicroRNA 344i1115426210115426308Rat
7514941Cd99l3CD99 molecule like 313931585739600133Rat
7489033Mir3102microRNA 31021155243756155243892Rat
7518732LOC102552287uncharacterized LOC1025522871103583677103601779Rat
7489040Mir3099microRNA 309916702398967024117Rat
7523242Tmem265transmembrane protein 2651182172704182176600Rat
7525307LOC102555078uncharacterized LOC10255507815351560553547049Rat
7526176LOC102549462uncharacterized LOC10254946215070371950723245Rat
7527404Tmem258-ps4transmembrane protein 258, pseudogene 418280074582802399Rat
7541351LOC102548820uncharacterized LOC1025488201180906441180915707Rat
7541917Zfp658zinc finger protein 65819399246794005689Rat
7505973LOC102548815uncharacterized LOC10254881519198240192029109Rat
7506405LOC102552318actin-like1199035831199062916Rat
7528935Meiosinmeiosis initiator17874450478768104Rat
7542654LOC102549608uncharacterized LOC10254960815093418450953773Rat
7507922Ervk-21l2endogenous retrovirus group K member 21 Env polyprotein-like 216095223660959469Rat
7529325Zfp94l1zinc finger protein 94 like 117988587579896601Rat
7508565LOC102548323uncharacterized LOC1025483231116995976117064301Rat
7530616Mir9-3hgMir9-3 host gene1133431075133469302Rat
7497887Mark3-ps1microtubule affinity regulating kinase 3, pseudogene 117153773971542589Rat
7499284LOC102550036uncharacterized LOC1025500361144050618144056394Rat
7500637Zfp35-ps1zinc finger protein 35, pseudogene 116111108261126052Rat
7510102Obox1l1oocyte specific homeobox 1 like 117646536976466555Rat
7510373LOC102552825uncharacterized LOC1025528251137282138137284054Rat
7510674Rpl37-ps2ribosomal protein L37, pseudogene 21202821232202849285Rat
7510716Zfp719zinc finger protein 71919400995794027342Rat
7511239LOC102546606uncharacterized LOC10254660614272165642725386Rat
7511549LOC102555775uncharacterized LOC1025557751114637762114649714Rat
7512548LOC102552153uncharacterized LOC1025521531103510363103575329Rat
7512936Afdnl1afadin, adherens junction formation factor like 115312877653138065Rat
7535253Znf431l-ps7zinc finger protein 431 like, pseudogene 715840809858425715Rat
7536417Znf235zinc finger protein 23517969898979708439Rat
7498653LOC102552864uncharacterized LOC1025528641192580494192600465Rat
7516055Thap8l1THAP domain containing 8 like 118554017285543782Rat
7536919LOC102552565uncharacterized LOC1025525651191966309191986518Rat
7537348Zfp758l1zinc finger protein 758 like 116169665161723296Rat
7537804LOC102553800uncharacterized LOC1025538001131429410131442617Rat
7538108LOC102548137uncharacterized LOC1025481371167724321167750850Rat
7540019Zfp764zinc finger protein 7641182009002182013169Rat
7646072LOC102553731uncharacterized LOC1025537311194746246194748946Rat
7612387LOC102549305uncharacterized LOC1025493051119375739119389971Rat
7612453Zfp446zinc finger protein 44617359495373612685Rat
7612505LOC102552286formyl peptide receptor-related sequence 4-like19474795394749932Rat
7631854LOC102546344uncharacterized LOC1025463441202980377202981520Rat
7631858Fbxw11-ps1F-box and WD repeat domain containing 11, pseudogene 11116428735116431543Rat
7646520Bud23-ps3BUD23, rRNA methyltransferase and ribosome maturation factor, pseudogene 316491436464916678Rat
7663810LOC102555900uncharacterized LOC1025559001175279154175293597Rat
7634635LOC102555470uncharacterized LOC1025554701114294070114303084Rat
7634877LOC102554078uncharacterized LOC1025540781126851551126852404Rat
7650527LOC102555617uncharacterized LOC1025556171114440731114448803Rat
7665911LOC102551752uncharacterized LOC1025517521186961903186967497Rat
7636033Arf1-ps5ADP-ribosylation factor 1, pseudogene 512859712228600478Rat
7651195LOC102550061uncharacterized LOC10255006119382681793836987Rat
7558063Tmem127-ps1transmembrane protein 127, pseudogene 114413524944138115Rat
7622122LOC102552773uncharacterized LOC1025527731188120174188148128Rat
7622947Utp3-ps1UTP3, small subunit processome component, pseudogene 11200799279200800009Rat
7636379LOC102552634uncharacterized LOC10255263419734491797365236Rat
76363861700028J19RiklRIKEN cDNA 1700028J19 gene like19471361394730846Rat
7559893Znf773zinc finger protein 77316678993066802405Rat
7575422LOC102549611uncharacterized LOC10254961118326552583272948Rat
7624587LOC102556135uncharacterized LOC1025561351182651431182657380Rat
7638459LOC102548889uncharacterized LOC1025488891134114350134128483Rat
7575724LOC102555770uncharacterized LOC10255577018780385387811246Rat
7625414LOC102549852ferritin light chain 1-like1143810386143811096Rat
7639269LOC102549342uncharacterized LOC10254934218098444181119329Rat
7577345Zfp420-ps2zinc finger protein 420, pseudogene 216255022862586857Rat
7577468LOC102549616uncharacterized LOC1025496161119804731119844038Rat
7587044LOC102552566uncharacterized LOC1025525661206555812206626882Rat
7625624LOC102548601uncharacterized LOC1025486011117601030117605930Rat
7655999LOC102549042uncharacterized LOC10254904219205174392123537Rat
7656358LOC102551259uncharacterized LOC1025512591173998998174001331Rat
7641285LOC102554680uncharacterized LOC1025546801142018187142025944Rat
7627463Rpl4-ps4ribosomal protein L4, pseudogene 418505551685059159Rat
7658496LOC102555354uncharacterized LOC1025553541202402316202418240Rat
7598034Rpsa-ps16ribosomal protein SA, pseudogene 1615620053756201249Rat
7628264LOC102556190uncharacterized LOC10255619019604107496047337Rat
7642645LOC102550982uncharacterized LOC10255098218484938384870079Rat
7609558Zfp768zinc finger protein 7681181966314181968950Rat
7609569LOC102555928uncharacterized LOC1025559281135445291135469930Rat
7630011Mapre1-ps1microtubule-associated protein, RP/EB family, member 1, pseudogene 114054595940552212Rat
7630023Eml3EMAP like 31205826354205837790Rat
7630088Zfp146zinc finger protein 14618540957085421835Rat
7643677LOC102556513uncharacterized LOC1025565131135894458135909734Rat
7660362LOC102551177uncharacterized LOC1025511771110294734111035350Rat
7610772LOC102551693uncharacterized LOC1025516931204675213204680568Rat
7661531LOC102553329uncharacterized LOC1025533291124017749124165290Rat
7555854Znf431l12zinc finger protein 431 like 1219365524793675372Rat
7588314LOC102553760zinc finger protein 59-like18320385083223665Rat
7616497LOC102551889uncharacterized LOC10255188915652581456559776Rat
7617005Znf829l-ps1zinc finger protein 829 like, pseudogene 116753332467558764Rat
7570512LOC102548198uncharacterized LOC10254819814507748945100267Rat
7589362LOC102552031uncharacterized LOC1025520311187595895187599379Rat
7593729LOC102548271uncharacterized LOC1025482711167886561167901539Rat
7617624Trim30al-ps1tripartite motif-containing 30A like, pseudogene 11158740434158748386Rat
7571387LOC102548472uncharacterized LOC10254847214551254745515991Rat
7571422Mageb10MAGE family member B101202810079202811086Rat
7595988LOC102550786uncharacterized LOC10255078615612187456128366Rat
7591504LOC102551255tetraspanin-7-like1122231176122236101Rat
7620815LOC102551987uncharacterized LOC10255198714723466447246436Rat
7572872Sf3a1-ps1splicing factor 3A subunit 1, pseudogene 11141432976141436428Rat
7573144Vmn2r116l-ps29vomeronasal 2, receptor 116 like, pseudogene 291139496211139515315Rat
7597569Hnrnpr-ps2heterogeneous nuclear ribonucleoprotein R, pseudogene 21204418419204420901Rat
7598618LOC102548014uncharacterized LOC10254801419110575891128497Rat
7574103E530001F21RiklRIKEN cDNA E530001F21 gene like17657782776580677Rat
7544215Vmn2r116l-ps27vomeronasal 2, receptor 116 like, pseudogene 271140688438140712736Rat
7544339LOC102555866uncharacterized LOC1025558661114688298114932765Rat
7544841LOC102555832uncharacterized LOC10255583213967915439685439Rat
7556971LOC102552971uncharacterized LOC1025529711196232907196236176Rat
7557291Ctxnd1cortexin domain containing 11138495689138547105Rat
7544889LOC102549940uncharacterized LOC1025499401172626577172632763Rat
7545650Potefam2POTE ankyrin domain family member 21116271482116447353Rat
7557829Klk15-ps2kallikrein-related peptidase 15, pseudogene 219458801894594577Rat
7578509LOC102550499uncharacterized LOC10255049918416493284178207Rat
7600894Zfp748zinc finger protein 74813507540835091416Rat
7579720Zfp780b-ps2zinc finger protein 780B, pseudogene 218309420783108245Rat
7579985LOC102550720uncharacterized LOC10255072015615987056166702Rat
7547519F11r-ps1F11 receptor, pseudogene 11202534582202537112Rat
7580217Snrpb-ps1small nuclear ribonucleoprotein polypeptides B and B1, pseudogene 11115304693115305592Rat
7563457LOC102553224uncharacterized LOC10255322414821483448221581Rat
7563768Zfp948zinc finger protein 94816136606861396300Rat
7582363LOC102557016uncharacterized LOC10255701615641922356420968Rat
7550309LOC102549783uncharacterized LOC1025497831143533778143534759Rat
7551033LOC102546790uncharacterized LOC10254679014299602243017130Rat
7604390LOC102555648uncharacterized LOC10255564818769952187729062Rat
7583660LOC102546709uncharacterized LOC10254670915320805153262172Rat
7565604LOC102548041uncharacterized LOC1025480411179870042179895619Rat
7565709LOC102553801uncharacterized LOC1025538011134346919134348781Rat
7606541Zscan22zinc finger and SCAN domain containing 2217351632873527766Rat
7606674LOC102547177uncharacterized LOC1025471771156162119156171192Rat
7606925Mosmomodulator of smoothened1175217680175288521Rat
7585495LOC102547456uncharacterized LOC1025474561154197713154236133Rat
7553300LOC102550985uncharacterized LOC1025509851173325465173358499Rat
7553817LOC102553541uncharacterized LOC1025535411193731097193739373Rat
7587874LOC102551607uncharacterized LOC1025516071205788523205789857Rat
7554390LOC102547214uncharacterized LOC1025472141119348252119351951Rat
7554600LOC102548818uncharacterized LOC1025488181134107741134110798Rat
7690555Odc1-ps5ornithine decarboxylase 1, pseudogene 51182021072182023661Rat
7734973Nid2l2nidogen 2 like 213862589138700200Rat
7736376Rpl12-ps3ribosomal protein L12, pseudogene 31156208145156208657Rat
7736402Sub1-ps1SUB1 regulator of transcription, pseudogene 117963377079634608Rat
7692144LOC102550682carcinoembryonic antigen-related cell adhesion molecule 5-like17806595378100726Rat
7692197LOC102547943uncharacterized LOC1025479431133414486133421488Rat
7692537Xndc1Xrcc1 N-terminal domain containing 11156440284156460609Rat
7692619Vmn2r116l-ps28vomeronasal 2, receptor 116 like, pseudogene 2817057187970632554Rat
7693175Zfp160lzinc finger protein 160 like15321050653226581Rat
7751286LOC102553078ubiquitin-like protein FUBI-like1154141530154141967Rat
7751312Crx-ps1cone-rod homeobox, pseudogene 117837455378376427Rat
7694563LOC102547978uncharacterized LOC1025479781167177345167193454Rat
7694619LOC102552157uncharacterized LOC1025521571191017034191039381Rat
7695090LOC102551311afadin-like15336152653399874Rat
7676282LOC102553862uncharacterized LOC1025538621132019641132025235Rat
7676646Ube3al1ubiquitin protein ligase E3A like 11110158663110291293Rat
7704573Ska2l1spindle and kinetochore associated complex subunit 2 like 11184226732184300750Rat
7704592Znf431l-ps8zinc finger protein 431 like, pseudogene 819288960692917697Rat
7704848Znf726l-ps1zinc finger protein 726 like, pseudogene 113495272434955509Rat
7676737CdiptosCDIP transferase, opposite strand1181579385181583017Rat
7677185LOC102551504vomeronasal type-1 receptor 4-like17161010871611022Rat
7678027Kmt2blysine methyltransferase 2B18582170085840987Rat
7683572Zfp619l1zinc finger protein 619 like 119117169791198293Rat
7683637LOC102553173uncharacterized LOC1025531731123943804123994246Rat
7684888LOC102551319uncharacterized LOC1025513191194845214194857999Rat
7723368Yes1-ps1YES proto-oncogene 1, Src family tyrosine kinase14336702943372347Rat
7725240LOC102551963uncharacterized LOC1025519631190441582190458258Rat
7689541Zfp677zinc finger protein 67716113668361155127Rat
7689565LOC102553046uncharacterized LOC1025530461202003101202022459Rat
7690508Klk5l-ps1kallikrein related-peptidase 5 like, pseudogene 119447831494489098Rat
7683193LOC102549532uncharacterized LOC1025495321119755503119777201Rat
7683242LOC102553528uncharacterized LOC10255352814769055147695815Rat
7712286LOC102551377uncharacterized LOC10255137714666616746682516Rat
7730631Fkbp1a-ps1FKBP prolyl isomerase 1A, pseudogene 117847001278471461Rat
7730966LOC102552387uncharacterized LOC1025523871102647014102669486Rat
7731725LOC102552485uncharacterized LOC10255248519471984694730038Rat
7736966LOC10255718260S ribosomal protein L31-like19998035899982992Rat
7732136LOC102555965uncharacterized LOC1025559651184499296184507745Rat
7732425Znf845l-ps1zinc finger protein 845 like, pseudogene 116186556361903269Rat
7714566Ceacam15l1CEA cell adhesion molecule 15 like 117735436477356099Rat
7738972Rpl35-ps4ribosomal protein L35, pseudogene 41152027322152030883Rat
7740165LOC102551020uncharacterized LOC1025510201122088458122164766Rat
7716102Zfp950l13zinc finger protein 950 like 1315845544858482226Rat
7667004LOC102552901KH homology domain-containing protein 1-like17355069073552469Rat
7667275Klk2lkallikrein related-peptidase 2 like19442608394428521Rat
7667300LOC102548890ubiquitin-like protein FUBI-like1168627468168627978Rat
7740967Nkain2sodium/potassium transporting ATPase interacting 212466862725877051Rat
7716912Prdx3-ps1peroxiredoxin 3, pseudogene 11106775624106776566Rat
7668793LOC102547319uncharacterized LOC10254731916131379661320523Rat
7742101LOC102547609uncharacterized LOC1025476091132868748132874634Rat
7697243Zfp729zinc finger protein 72913516573235183894Rat
7697895LOC102546835uncharacterized LOC1025468351115475057115720360Rat
7698003LOC102557319carcinoembryonic antigen-related cell adhesion molecule 3-like17843978478449990Rat
7669488LOC102548505uncharacterized LOC1025485051197705332197782594Rat
7669860LOC102556194uncharacterized LOC1025561941175389733175392998Rat
7698364LOC102553828spermatogenesis-associated protein 13-like1126159731126164254Rat
7698901LOC102554169uncharacterized LOC10255416918608184586086504Rat
7718701LOC102547287zinc finger protein 728-like13505253535063324Rat
7670154Rpa3-ps1replication protein A3, pseudogene 11174474378174475061Rat
7670186LOC102553043uncharacterized LOC1025530431196325398196329434Rat
7670365LOC102556873uncharacterized LOC10255687315504724155070804Rat
7744082LOC102551753uncharacterized LOC1025517531190139001190144141Rat
7699783LOC102555644zinc finger protein 182-like16243550362457346Rat
7701116LOC102550534ubiquitin-like protein FUBI-like1172860549172861181Rat
7701944Tmem65l1transmembrane protein 65 like 116163221861637216Rat
7701959Zfp788zinc finger protein 78819317257593197706Rat
7721677LOC102546680uncharacterized LOC1025466801119181972119185546Rat
7746808Zfpl2zinc finger protein like 212886591728875433Rat
7747342LOC102546796uncharacterized LOC10254679619941626999427141Rat
7747355LOC102548409uncharacterized LOC10254840914549136645497049Rat
7703204LOC102553133uncharacterized LOC10255313315856644658574216Rat
7703231LOC102555707uncharacterized LOC10255570718779216987800501Rat
7679103Zfp28zinc finger protein 2816749486267510801Rat
7748347Epb41l5-ps1erythrocyte membrane protein band 4.1 like 5, pseudogene 119658515196588057Rat
7748684Eif5-ps5eukaryotic translation initiation factor 5, pseudogene 51141500532141507333Rat
7749502LOC102552907uncharacterized LOC1025529071188413379188420695Rat
7709422Gapdh-ps69Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 691129758471129759490Rat
7750416Mgat4a-ps1alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase A, pseudogene 11113857991113864613Rat
7709992Csde1-ps1cold shock domain containing E1, pseudogene 11101128263101131688Rat
7710512Zfp619zinc finger protein 61919114801691167764Rat
7728972LOC102548165uncharacterized LOC1025481651116963210116996324Rat
7711326LOC102548568vegetative cell wall protein gp1-like1197830951197834453Rat
7711357LOC102550562uncharacterized LOC1025505621152076132152094061Rat
7681875LOC102553527uncharacterized LOC10255352713109632531105986Rat
9132574LOC103690347uncharacterized LOC1036903471188411066188424673Rat
9134980LOC103691232uncharacterized LOC1036912321179491910179525433Rat
9136205LOC103691157uncharacterized LOC1036911571121055568121061214Rat
9213265LOC103691235uncharacterized LOC1036912351181402275181421545Rat
9097294LOC103691241uncharacterized LOC1036912411185235012185242949Rat
9101016C1h19orf84similar to human chromosome 19 open reading frame 8419383537893837316Rat
9078384LOC103690946activated RNA polymerase II transcriptional coactivator p15 pseudogene12963011729632569Rat
9142791LOC103691204uncharacterized LOC1036912041164862825164886508Rat
9072276LOC103691054uncharacterized LOC10369105418072435880747156Rat
9145766LOC103691200uncharacterized LOC1036912001154849970154869633Rat
9080077Eddm13epididymal protein 1316763090567656404Rat
9081781LOC103691055proteasome activator complex subunit 3 pseudogene16653349566534237Rat
9149734Or52r7olfactory receptor family 52 subfamily R member 71157284942157285649Rat
9082300LOC103689966MARCKS-related protein-like18491969884921260Rat
9106200LOC103691274uncharacterized LOC1036912741201553660201556013Rat
9191646LOC103691162uncharacterized LOC1036911621126477043126482167Rat
9160854LOC103691092cytochrome P450 2B9-like18179177681810482Rat
9115869Znf48zinc finger protein 481181854481181858987Rat
9198344LOC103691146uncharacterized LOC1036911461114303744114386780Rat
9163837Zfp51zinc finger protein 5116120315961235545Rat
9166062LOC103690972protein LSM12 homolog pseudogene14815397948154524Rat
9168471LOC103690969uncharacterized LOC10369096914738140247429212Rat
9168486Rpl13a-ps3ribosomal protein L13A, pseudogene 319103627891036843Rat
9122392LOC103691233uncharacterized LOC1036912331180060750180065930Rat
9202400Ndufb4l5NADH:ubiquinone oxidoreductase subunit B4 like 519414821794148671Rat
9170070LOC103691133prostate-specific antigen-like19468179094685589Rat
9069429LOC103691043uncharacterized LOC10369104317666272776667219Rat
9074148LOC103689958olfactory receptor 49-like16591190765913255Rat
90746049130023H24RikRIKEN cDNA 9130023H24 gene like1182809465182820548Rat
9210095Or2bd2olfactory receptor family 2 subfamily BD member 216741750467418469Rat
9215275LOC103691049uncharacterized LOC10369104917895617878957297Rat
9349711LOC103691192twinkle protein, mitochondrial pseudogene1140480642140482788Rat
9350513LOC103691033zinc finger protein 805-like16685068066864596Rat
9220759Rpl30-ps2ribosomal protein L30, pseudogene 214248714542487730Rat
9225009Ube2n-ps4ubiquitin-conjugating enzyme E2N, pseudogene 414274362642748575Rat
9270734Zbtb2lzinc finger and BTB domain containing 2 like14085412740859896Rat
9271178LOC103691261sperm flagellar protein 1-like1194769043194776455Rat
9227837LOC103691225putative uncharacterized protein1156196466156197649Rat
9273863LOC103691188uncharacterized LOC1036911881143422289143529944Rat
9229744LOC10369119360S acidic ribosomal protein P1-like1140289186140294946Rat
9318609Envl-ps16MLV-related proviral Env polyprotein-like, pseudogene 1616849416868496174Rat
9366670LOC103691224ribosome biogenesis protein NSA2 homolog pseudogene1156758473156773537Rat
9278179Krtap5-1keratin associated protein 5-11197278886197279893Rat
9322177Fam24al1family with sequence similarity 24, member A like 11129641309129655041Rat
9383371Snrnp48-ps1small nuclear ribonucleoprotein U11/U12 subunit 48, pseudogene 11135339418135340186Rat
9323695Apoa2l1apolipoprotein A-II like 11200803787200804741Rat
9241707Zbed5l-ps1zinc finger BED-type containing 5 like, pseudogene 11165234060165240783Rat
9283938Rhog-ps3ras homolog family member G, pseudogene 31111125687111208473Rat
9242866LOC103691239uncharacterized LOC1036912391182934054182937398Rat
9248289LOC10369104560S ribosomal protein L32 pseudogene17762928777629680Rat
9249251LOC103691177histone H2A.Z pseudogene1127473174127484619Rat
9360878LOC103691073uncharacterized LOC10369107318216198182173209Rat
9254028Krtap5-2-ps1keratin associated protein 5-2, pseudogene 11197288058197296467Rat
9370590LOC103691243uncharacterized LOC1036912431184081122184090817Rat
9255928Smok2al2sperm motility kinase 2A like 215310734853123984Rat
9257174LOC103690942solute carrier family 2, facilitated glucose transporter member 3 pseudogene12379865323799648Rat
9257184Mrpl42-ps1mitochondrial ribosomal protein L42, pseudogene 11195068326195071518Rat
9381183Eid2bEP300 interacting inhibitor of differentiation 2B18354553083547338Rat
9344246LOC10369095160S ribosomal protein L34 pseudogene13500559135008025Rat
9264595LOC103691076uncharacterized LOC10369107618518319585194334Rat
9306135LOC103694999uncharacterized LOC10369499915413935054228159Rat
9306139Znf805l-ps1zinc finger protein 805 like, pseudogene 116682832566843533Rat
9421087Smim47small integral membrane protein 4719474463594746122Rat
9424195LOC103691074uncharacterized LOC10369107418294734882950417Rat
9467587LOC103695038uncharacterized LOC1036950381179567858179588897Rat
9468236LOC103691168uncharacterized LOC1036911681132680421132684321Rat
9393062Rps27a-ps26ribosomal protein S27a, pseudogene 261144896527144897046Rat
9431454LOC103691053uncharacterized LOC10369105317987972379894281Rat
9396007LOC103691178chromobox protein homolog 3 pseudogene1134672915134675115Rat
9439981LOC103691254ubiquitin-conjugating enzyme E2 L3 pseudogene1189951742189954254Rat
9404051Cyp2b14cytochrome P450, family 2, subfamily b, polypeptide 1418206716082079597Rat
9444072LOC103691202glyceraldehyde-3-phosphate dehydrogenase pseudogene1161819802161820840Rat
9406093Zscan4l-ps1zinc finger and SCAN domain containing 4 like, pseudogene 117219335372197254Rat
9407641Wdr87WD repeat domain 8718482628284845693Rat
9413649LOC103690986uncharacterized LOC10369098615355118053557766Rat
9416532LOC103695040eukaryotic translation initiation factor 1 pseudogene1182013409182018191Rat
9418836LOC103691003uncharacterized LOC10369100316577949465821284Rat
9421086Elobl4elongin B like 417651675076517202Rat
9685081Mir762microRNA 7621182323863182323937Rat
11359443LOC108349515uncharacterized LOC10834951516926747069279017Rat
10059728Cahmcolon adenocarcinoma hypermethylated15038580350386959Rat
10043390Rps27a-ps30ribosomal protein S27a, pseudogene 3019137172391372135Rat
11363847Zfp568zinc finger protein 56818520664385257759Rat
11363866LOC108349642uncharacterized LOC1083496421181314109181322318Rat
11364129LOC10834973040S ribosomal protein S20 pseudogene13275477832761865Rat
11359049LOC108348195vomeronasal type-2 receptor 116-like16355697863572218Rat
11455515LOC108348755uncharacterized LOC10834875513351530533523055Rat
11366915LOC10834972540S ribosomal protein S9 pseudogene1200908176200917389Rat
11367619Trnai-uau1transfer RNA isoleucine (anticodon UAU) 118366546483665557Rat
11358346LOC108349017uncharacterized LOC10834901716111347661191340Rat
11358405LOC108349566uncharacterized LOC10834956619070689690740913Rat
11446120LOC108349507uncharacterized LOC10834950712907865029084116Rat
11446129LOC108349660uncharacterized LOC1083496601190980953191004779Rat
11442878LOC108348434cytochrome c, somatic pseudogene17319309473193582Rat
11443130LOC108348724uncharacterized LOC10834872415579636755802412Rat
11454674LOC108349784ATP synthase subunit g, mitochondrial pseudogene1188001281188001656Rat
11455008LOC108349678uncharacterized LOC1083496781200007802200018418Rat
11462077LOC108349447uncharacterized LOC1083494471134385420134400570Rat
11462101Rps23-ps12ribosomal protein S23, pseudogene 1218689675686902505Rat
11462351LOC108349685uncharacterized LOC1083496851203300652203314858Rat
11462765Trnap-ugg1transfer RNA proline (anticodon UGG) 11153114486153114557Rat
11463533LOC108349586uncharacterized LOC1083495861119287967119293388Rat
11464132LOC10834944240S ribosomal protein S15a pseudogene13364139933642354Rat
11465027Leg1-ps1liver enriched gene 1, pseudogene 112857121028583888Rat
11465891LOC108349461uncharacterized LOC1083494611103443363103460555Rat
11465906LOC108349837high mobility group protein B1 pseudogene16367611063676937Rat
11466449LOC10834962060S ribosomal protein L31 pseudogene1168146986168147396Rat
11468141Rpl21l5ribosomal protein L21 like 51148529229148529711Rat
11468718Rpl21-ps25ribosomal protein L21, pseudogene 251124344834124345343Rat
11470190Trnap-agg2transfer RNA proline (anticodon AGG) 21201060155201060231Rat
11471669LOC108348727uncharacterized LOC1083487271106824340106838875Rat
11472459LOC108349688uncharacterized LOC1083496881204367406204373058Rat
11358633Trnat-agu1transfer RNA threonine (anticodon AGU) 118788302487883097Rat
11435664LOC10834943640S ribosomal protein S2 pseudogene18814039688141307Rat
11444414Hmgb1l1high mobility group box 1 like 117981517679816529Rat
11436011Zfp470zinc finger protein 47019106390591111883Rat
11436026Gpx4-ps1glutathione peroxidase 4, pseudogene 11156569245156570007Rat
11436035Rpl27a-ps3ribosomal protein L27a, pseudogene 31133096265133099871Rat
11436392Chd1l2chromodomain helicase DNA binding protein 1 like 215664327856664148Rat
11445112Rpl23a-ps5ribosomal protein L23a, pseudogene 517653642876537155Rat
11446352LOC108349560uncharacterized LOC10834956018643130286436167Rat
11366552Gapdhl11glyceraldehyde-3-phosphate dehydrogenase like 1119094057290941452Rat
11438175LOC108348999uncharacterized LOC10834899917978909879799671Rat
11357821LOC108349455uncharacterized LOC10834945519248072492591739Rat
11360787Klk5l-ps3kallikrein related-peptidase 5 like, pseudogene 319439464594397275Rat
11369651LOC10834984160S ribosomal protein L7a pseudogene16844561568446323Rat
11369943LOC108349556uncharacterized LOC10834955618041484680416174Rat
11361878Fpr2-ps3formyl peptide receptor 2, pseudogene 315490085354901858Rat
11364130LOC108349861high mobility group protein B1 pseudogene1188005315188006052Rat
11451513LOC108349392uncharacterized LOC10834939213328716733302936Rat
11368566LOC108349099uncharacterized LOC10834909914858077048591834Rat
11371780LOC108348215zinc finger protein 420-like16142701361448873Rat
11429793LOC108349511uncharacterized LOC10834951113496182534967714Rat
11440416Trnar-ccu1transfer RNA arginine (anticodon CCU) 116126644761266519Rat
11452860Igsf22immunoglobulin superfamily member 2219760193897618144Rat
11461101LOC10834928960S ribosomal protein L7a pseudogene1146399656146400987Rat
11432987LOC108349234uncharacterized LOC1083492341121251718121271532Rat
11433159LOC108349524uncharacterized LOC10834952415157156851583996Rat
11383913LOC108349630uncharacterized LOC1083496301175811711175851645Rat
11383936Rpl23-ps3ribosomal protein L23,pseudogene 31154394804154395254Rat
11384002LOC108349194uncharacterized LOC1083491941151368864151379738Rat
11384146Trnal-aag1transfer RNA leucine (anticodon AAG) 11175465857175465938Rat
11394751LOC108348449uncharacterized LOC10834844917362739573628936Rat
11394768LOC108349732uncharacterized LOC10834973213735354037360813Rat
11415131LOC108349643uncharacterized LOC1083496431181508682181514176Rat
11417296LOC10834845860S ribosomal protein L36 pseudogene1158665098158665484Rat
11417311LOC10834983640S ribosomal protein S2 pseudogene15809496758095887Rat
11415566Trnae-cuc1transfer RNA glutamic acid (anticodon CUC) 112684641326846484Rat
11418059LOC108349679uncharacterized LOC1083496791200210221200234295Rat
11422907Hs3st4heparan sulfate-glucosamine 3-sulfotransferase 41178539078178944850Rat
11422984LOC10834976860S ribosomal protein L29-like1108838092108838388Rat
11423353LOC108349518uncharacterized LOC10834951814447439944522719Rat
11423574LOC108349105uncharacterized LOC10834910515982655759829169Rat
11423621LOC108349612uncharacterized LOC1083496121164828353164859432Rat
11425087LOC108349434uncharacterized LOC10834943416916050069162688Rat
11425556Trnas-gcu2transfer RNA serine (anticodon GCU) 21202342699202342780Rat
11426694LOC108349652uncharacterized LOC1083496521183588849183601186Rat
11407041LOC10834887540S ribosomal protein S27-like1203220081203220626Rat
11397546LOC108349597uncharacterized LOC1083495971130040995130043791Rat
11374957LOC108349779keratin-associated protein 10-6-like1165574345165575331Rat
11375087LOC108349508uncharacterized LOC10834950813217249432206222Rat
11408030LOC10834862860S ribosomal protein L7a pseudogene16610073666101543Rat
11408073Trnap-agg1transfer RNA proline (anticodon AGG) 11153114734153114805Rat
11386709LOC108349540uncharacterized LOC10834954016674244966775540Rat
11398775LOC10834850860S ribosomal protein L7a pseudogene12765349227655379Rat
11409293LOC108348964uncharacterized LOC1083489641106125962106135332Rat
11399620LOC108349549uncharacterized LOC10834954918615001286151717Rat
11378084LOC108349673uncharacterized LOC1083496731197950020197994765Rat
11378088LOC108349838vomeronasal type-1 receptor 1-like17267561572676568Rat
11388338LOC108349570uncharacterized LOC10834957019491568094923655Rat
11400164Klk5l2kallikrein related-peptidase 5 like 219465235394669527Rat
11400668Actb-ps4actin, beta, pseudogene 415125917351263331Rat
11411641LOC108349814high mobility group protein B1-like1130158350130158821Rat
11390492Trnal-uag1transfer RNA leucine (anticodon UAG) 11175386163175386244Rat
11401413Rpl35a-ps6ribosomal protein L35A, pseudogene 61201440397201440848Rat
11379739LOC108349564uncharacterized LOC10834956418938342289388116Rat
11380105Rpl32-ps5ribosomal protein L32, pseudogene 51178932751178934454Rat
11390820LOC108349563uncharacterized LOC10834956318866079188701550Rat
11391312LOC108349862serine/arginine-rich splicing factor 3 pseudogene1195375344195375899Rat
11381349LOC108349450uncharacterized LOC10834945019091046590926453Rat
11382285Ceacam15CEA cell adhesion molecule 1517736837677373343Rat
11393200LOC108349062uncharacterized LOC10834906217871240878722549Rat
11404862LOC108349512uncharacterized LOC10834951218396437183981022Rat
11382437LOC108349532high mobility group protein B1 pseudogene1163050054163050871Rat
11393548LOC10834888060S ribosomal protein L34 pseudogene1106354560106354913Rat
11394442Vom1r113vomeronasal 1 receptor 11317245083772457833Rat
11518972LOC108348481high mobility group protein B1 pseudogene15383319453833888Rat
11519974Trnae-uuc1transfer RNA glutamic acid (anticodon UUC) 11109313144109313215Rat
11501622Rpl35al7ribosomal protein L35A like 71134302904134303425Rat
11520738LOC10834951760S ribosomal protein L7a pseudogene14029604740296903Rat
11477525LOC108349802glyceraldehyde-3-phosphate dehydrogenase pseudogene14977352149774521Rat
11478122LOC108349649glyceraldehyde-3-phosphate dehydrogenase pseudogene1185016384185017383Rat
11502957LOC108349467uncharacterized LOC10834946718731898287324451Rat
11502966Trnas-gcu1transfer RNA serine (anticodon GCU) 11165571303165571384Rat
11478799LOC108349640uncharacterized LOC1083496401180783169180807007Rat
11503785Trnar-ucg1transfer RNA arginine (anticodon UCG) 11133399712133399784Rat
11504246Trnan-guu1transfer RNA asparagine (anticodon GUU) 11200749189200749261Rat
11479453Mtcl3MTCL family member 312862903628701416Rat
11480240LOC108349644uncharacterized LOC1083496441181649574181655535Rat
11504974LOC108349103uncharacterized LOC10834910319008786390105749Rat
11481264Rps29-ps1ribosomal protein S29, pseudogene 11156638258156638584Rat
11481275LOC108349528uncharacterized LOC10834952815874922458758082Rat
11496573Gpr32G protein-coupled receptor 3219475686394757895Rat
11508576LOC108349639uncharacterized LOC1083496391180764861180777765Rat
11496872LOC10834907140S ribosomal protein S27-like12533649425337281Rat
11497536LOC10834967660S ribosomal protein L7a pseudogene1199684456199685258Rat
11497852LOC108348748small EDRK-rich factor 2 pseudogene1196162790196162970Rat
11498733LOC10834947060S ribosomal protein L24 pseudogene15319464753195128Rat
11499584Kmt5a-ps1lysine methyltransferase 5A, pseudogene 11164470159164472142Rat
11499736LOC10834852260S ribosomal protein L27 pseudogene1187299584187299998Rat
11513757Envl-ps17MLV-related proviral Env polyprotein-like, pseudogene 171143803658143805876Rat
11482889LOC10834978340S ribosomal protein S19 pseudogene1183046566183051192Rat
11514383LOC108349559uncharacterized LOC10834955918564530185648643Rat
11514392LOC10834984340S ribosomal protein S28 pseudogene18362115283621481Rat
11515099Rbis-ps2ribosomal biogenesis factor, pseudogene 21146515667146515964Rat
11485321Gng5-ps3G protein subunit gamma 5, pseudogene 317729202977292513Rat
11517459LOC10834984960S ribosomal protein L7a pseudogene1129755848129757145Rat
11489695Tmsb10l5thymosin beta 10 like 51121497670121498138Rat
11490079LOC10834983560S ribosomal protein L35a pseudogene15656131056561783Rat
11491806Krtap5-5l1keratin associated protein 5-5 like 11197240382197241310Rat
11492064LOC108349007uncharacterized LOC1083490071159756929159773172Rat
14398600Mir344b-3microRNA mir-344b-31114632635114632705Rat
14398575Mir344b-2microRNA mir-344b-21114616603114616673Rat
41320830LOC120097381uncharacterized LOC1200973811203094040203099412Rat
41321796LOC120100238small nucleolar RNA SNORD1151110292739110292816Rat
41322133LOC120100253small nucleolar RNA SNORD1151110267359110267436Rat
41322136Snord15bsmall nucleolar RNA, C/D box 15B1153779081153779225Rat
41322145LOC120100486U2 spliceosomal RNA1205629154205629354Rat
41353902Trnaa-agc75transfer RNA alanine (anticodon AGC) 751187277128187277208Rat
41354060LOC120100333small nucleolar RNA SNORD1161110995192110995284Rat
41378349Saal2serum amyloid A-like 219725763797259953Rat
41380058LOC120099946uncharacterized LOC1200999461188404479188404948Rat
41085628LOC120100308small nucleolar RNA SNORD1161110997780110997872Rat
41085858Bard1-ps1BRCA1 associated RING domain 1, pseudogene 115649803756512415Rat
41086944Tex54testis expressed 541205636636205637137Rat
41110788LOC120099872uncharacterized LOC1200998721136914913136919922Rat
41136694LOC120099941uncharacterized LOC1200999411184226008184228759Rat
41138586Gabarap-ps1GABA type A receptor-associated protein, pseudogene 11206379981206381094Rat
41167968Rnu6-75RNA, U6 small nuclear 7515371795553718059Rat
41202669LOC120100280small nucleolar RNA SNORD1151110301514110301588Rat
41203168Vom1r34l1vomeronasal 1 receptor 34 like 116843535068436306Rat
41203530LOC120097351uncharacterized LOC1200973511163187266163190378Rat
41235294Trnaa-agc77transfer RNA alanine (anticodon AGC) 7712458968624589766Rat
41276304LOC120100453small nucleolar RNA SNORA1717479720174797324Rat
41282558LOC120099771uncharacterized LOC12009977117766692177668985Rat
41322568LOC120100492small nucleolar RNA U31117570637117570845Rat
41322932LOC120100155U6 spliceosomal RNA19106146191061567Rat
41323105LOC120100254small nucleolar RNA SNORD1151110269195110269271Rat
41355712LOC120099123uncharacterized LOC12009912314791840647923178Rat
41356364LOC120100313small nucleolar RNA SNORD1161110479954110480046Rat
41356485Rab1a-ps4RAB1A, member RAS oncogene family, pseudogene 413812763038128295Rat
41380449LOC120099923uncharacterized LOC1200999231176077141176106686Rat
41380461Lilrb4-ps1leukocyte immunoglobulin like receptor B4, pseudogene 116983514569835898Rat
41380632LOC120100443U2 spliceosomal RNA1140724802140724998Rat
41087395LOC120099100uncharacterized LOC12009910013518412235188477Rat
41087412Snora20small nucleolar RNA, H/ACA box 2014783054047830669Rat
41087592LOC120099823uncharacterized LOC1200998231108581448108596320Rat
41088730Trnaa-agc79transfer RNA alanine (anticodon AGC) 791126350554126350634Rat
41113145LOC120100111U4 spliceosomal RNA1205944227205944312Rat
41113286LOC120100277small nucleolar RNA SNORD1151110290902110290979Rat
41113608LOC120100250small nucleolar RNA SNORD1151110257081110257158Rat
41139857Gapdh-ps58Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5817117889271183244Rat
41277634Rpl7-ps13ribosomal protein L7, pseudogene 131204895815204898744Rat
41277812Lypla1-ps4lysophospholipase 1, pseudogene 415888803558888726Rat
41283372LOC120099764uncharacterized LOC12009976417297766372984952Rat
41283769LOC120099917uncharacterized LOC1200999171172905921172914944Rat
41284145Pole3-ps1DNA polymerase epsilon 3, accessory subunit, pseudogene 11107341034107356298Rat
41324388LOC120100247small nucleolar RNA SNORD1151110251568110251645Rat
41324480LOC120099827uncharacterized LOC1200998271113551559113562494Rat
41357392LOC120100282small nucleolar RNA SNORD1151110299683110299760Rat
41357835Rnu1-140RNA, U1 small nuclear 1401182658147182658307Rat
41357901Snord35bsmall nucleolar RNA, C/D box 35B19560651095606596Rat
41382752LOC120099829uncharacterized LOC1200998291114066134114087090Rat
41383691Snu13-ps3small nuclear ribonucleoprotein 13, pseudogene 318306080883061157Rat
41140944Dnph1-ps12'-deoxynucleoside 5'-phosphate N-hydrolase 1, pseudogene 11206604937206609330Rat
41141466LOC120100117U4 spliceosomal RNA1159079697159079847Rat
41141871LOC120099870uncharacterized LOC1200998701133872984133879902Rat
41169523LOC120099789uncharacterized LOC12009978918616126386163626Rat
41169781LOC120093143uncharacterized LOC12009314315314364253171314Rat
41206076Rnu6-959RNA, U6 small nuclear 95914182242541822528Rat
41206132LOC120099942uncharacterized LOC1200999421186614202186617524Rat
41252116Rnu2-57RNA, U2 small nuclear 5718561811085618290Rat
41279059LOC120100281small nucleolar RNA SNORD1151110296410110296487Rat
41279797Cul4b-ps1cullin 4B, pseudogene 11133574646133575249Rat
41285163Aldh3b2l1aldehyde dehydrogenase 3 family, member B2 like 11201228414201250204Rat
41285702Olr281-ps1olfactory receptor 281, pseudogene 11162691385162692348Rat
41358238Rnu6-95RNA, U6 small nuclear 9516228550162285607Rat
41358263LOC120100106uncharacterized LOC12010010615383994353906439Rat
41358401LOC120099889uncharacterized LOC1200998891153441507153470272Rat
41090434Rabggtb-ps2Rab geranylgeranyltransferase subunit beta, pseudogene 213374848833751375Rat
41091203Or51a25bl1olfactory receptor family 51 subfamily A member 25B like 11157160337157161936Rat
41091493LOC120100435small nucleolar RNA SNORA1713311115333111279Rat
41115833LOC120097732uncharacterized LOC12009773219151091991513005Rat
41115869LOC120100190U6 spliceosomal RNA1196288031196288126Rat
41142333Odc1-ps8ornithine decarboxylase 1, pseudogene 81109953728109955186Rat
41142467LOC120099884uncharacterized LOC1200998841147175164147180920Rat
41171220LOC120099916uncharacterized LOC1200999161172832432172841087Rat
41171707LOC120100354small nucleolar RNA SNORA36 family1183310598183310728Rat
41171888LOC120100410small nucleolar RNA SNORA481179035249179035391Rat
41171990Rnu6-1168RNA, U6 small nuclear 11681164181113164181219Rat
41206771LOC120100249small nucleolar RNA SNORD1151110255243110255320Rat
41207204LOC120100221U7 small nuclear RNA1159294824159294888Rat
41207249LOC120099846uncharacterized LOC1200998461122107156122110562Rat
41207608Isg20l1interferon stimulated exonuclease gene 20 like 119369267493701377Rat
41252286Trnap-agg19transfer RNA proline (anticodon AGG) 1917145050871450588Rat
41252911Trnas-aga17transfer RNA serine (anticodon AGA) 1719601179096011864Rat
41253898LOC120100276small nucleolar RNA SNORD1151110178175110178252Rat
41254060LOC120100375small nucleolar RNA SNORA2/SNORA34 family1157930780157930915Rat
41286380LOC120099968uncharacterized LOC1200999681200250061200268329Rat
41326158Mospd1-ps1motile sperm domain containing 1, pseudogene 116979987569802192Rat
41326170LOC1201003285S ribosomal RNA1182252145182252263Rat
41327125LOC120099822uncharacterized LOC1200998221108030936108068757Rat
41359684Rnu6-894RNA, U6 small nuclear 89415467191154672008Rat
41387258LOC120100130U6 spliceosomal RNA15775597957756085Rat
41387290LOC120099954uncharacterized LOC1200999541194005130194006623Rat
41091792LOC120096895uncharacterized LOC12009689518096165580980582Rat
41092135Eif1-ps5eukaryotic translation initiation factor 1, pseudogene 512894424028944805Rat
41092469LOC120100446small nucleolar RNA SNORA1712874163928741754Rat
41118317LOC120100220U7 small nuclear RNA1141121136141121197Rat
41173557Obox6loocyte specific homeobox 6 like16847746868483714Rat
41259303LOC120100218U7 small nuclear RNA18331662183316684Rat
41260372Krtap5-2keratin associated protein 5-21197266811197267905Rat
41327994LOC120097700uncharacterized LOC12009770012778739427789150Rat
41328408Rps27-ps7ribosomal protein S27, pseudogene 71186877655186877923Rat
41389181Rpl7a-ps35ribosomal protein L7a, pseudogene 351144480892144481649Rat
41093297LOC120100213U7 small nuclear RNA1106488765106488826Rat
41094097Usp17lhubiquitin specific peptidase 17 like H1159158689159162463Rat
41118710LOC120100420U2 spliceosomal RNA1145145485145145580Rat
41118856LOC120100471small nucleolar RNA SNORD8819473460494734693Rat
41119470LOC120100326small nucleolar RNA SNORD1161110487777110487869Rat
41147698LOC120099907NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2-like1166888513166888812Rat
41175336Brix1-ps1biogenesis of ribosomes BRX1, pseudogene 11129680951129683336Rat
41210617Fkbp2l1FKBP prolyl isomerase 2 like 11204167724204170352Rat
41260575Chchd2l2-ps6coiled-coil-helix-coiled-coil-helix domain containing protein 2-like 2, pseudogene 615823687958237403Rat
41329310Dnajb6-ps5DnaJ heat shock protein family (Hsp40) member B6, pseudogene 51103619537103621184Rat
41330022LOC120099856uncharacterized LOC1200998561127413163127418868Rat
41364047LOC120099841uncharacterized LOC1200998411119204501119209290Rat
41389408LOC120098457kallikrein-2-like19451814894532064Rat
41389607Ipmk-ps1inositol polyphosphate multikinase, pseudogene 11127578732127592426Rat
41390298LOC120097342uncharacterized LOC1200973421146186005146268804Rat
41095055LOC120097701uncharacterized LOC12009770113015796330160240Rat
41120638LOC120100362small nucleolar RNA SNORA2413371671333716842Rat
41120816LOC120099910cytochrome c, somatic-like1167660539167660823Rat
41148090LOC120100271small nucleolar RNA SNORD1151110303346110303423Rat
41148576LOC120100153U6 spliceosomal RNA18301264383012749Rat
41149238LOC120100417small nucleolar RNA SNORA171173643130173643260Rat
41149849LOC120098013uncharacterized LOC1200980131184024534184029616Rat
41176080LOC120100323small nucleolar RNA SNORD1161111002979111003070Rat
41176426Rpl28-ps12ribosomal protein L28, pseudogene 1217766506477665567Rat
41176576LOC120100395small nucleolar RNA U2-1914221196842212047Rat
41176983LOC120100210U7 small nuclear RNA1106488917106488976Rat
41187490Mycbp-ps1Myc binding protein, pseudogene 113403274734033058Rat
41187783LOC120099963uncharacterized LOC1200999631198355931198361600Rat
41188559LOC120100227small nucleolar RNA SNORD291205621001205621064Rat
41211402LOC120100312small nucleolar RNA SNORD1161110982423110982515Rat
41211843Trnag-acc6transfer RNA glycine (anticodon ACC) 617870434578704425Rat
41212243LOC120099837uncharacterized LOC1200998371117663708117665914Rat
41330851Snora3Asmall nucleolar RNA, H/ACA box 3A1163540664163540793Rat
41331186Ncl-ps4nucleolin, pseudogene 41192178482192179369Rat
41341971LOC120100412small nucleolar RNA SNORA171136970981136971112Rat
41364416LOC120093090sperm motility kinase 3A-like15338320753387835Rat
41364498Snord88bsmall nucleolar RNA, C/D box 88B19473493794735027Rat
41365103Casp3-ps3caspase 3, pseudogene 316840682568407654Rat
41391087LOC120097812uncharacterized LOC1200978121136871425136877196Rat
41391896LOC120093081uncharacterized LOC12009308115320502353206573Rat
41121065Rpl24-ps5ribosomal protein L24, pseudogene 515309710953097586Rat
41121395LOC120100461small nucleolar RNA SNORA4018364391983644044Rat
41121717LOC120099894uncharacterized LOC1200998941154894181154898468Rat
41122044LOC120100336small nucleolar RNA SNORD1161111034987111035076Rat
41150368LOC120093064scavenger receptor cysteine-rich domain-containing protein SCART1-like1195080285195136263Rat
41178707LOC120099844uncharacterized LOC1200998441121313138121320010Rat
41178995LOC120100199U6 spliceosomal RNA1174355676174355782Rat
41189502LOC120099875uncharacterized LOC1200998751139870107139920602Rat
41212614LOC120097724vomeronasal type-1 receptor 2-like17378586173786983Rat
41213547Vom1r2-ps2vomeronasal 1 receptor 2, pseudogene 216040100760402080Rat
41263335LOC120099981uncharacterized LOC1200999811204216880204220704Rat
41342237Trnap-agg24transfer RNA proline (anticodon AGG) 2413455371434553795Rat
41342901LOC120100321small nucleolar RNA SNORD1161110985002110985094Rat
41343058Gapdh-ps53Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5319962205599623687Rat
41343059LOC120100426small nucleolar RNA SNORA171189941598189941726Rat
41343305LOC120098270transmembrane protein 64-like17691260176931575Rat
41366349Trnap-agg25transfer RNA proline (anticodon AGG) 251185164152185164232Rat
41366411LOC120100318small nucleolar RNA SNORD1161110990216110990308Rat
41367209LOC120097959uncharacterized LOC1200979591169464515169471269Rat
41393107LOC120099111uncharacterized LOC12009911114427801944357752Rat
41393201LOC120097268uncharacterized LOC1200972681110123926110128015Rat
41098464LOC120100402small nucleolar RNA SNORA481118424802118424943Rat
41098606LOC120100182U6 spliceosomal RNA1181153246181153352Rat
41123320LOC120100240small nucleolar RNA SNORD1151110208959110209036Rat
41123377LOC120100087uncharacterized LOC12010008713961516839639974Rat
41154129LOC120100415small nucleolar RNA SNORA171171168503171168634Rat
41154963Rpf1-ps1ribosome production factor 1, pseudogene 119479819794800311Rat
41179128LOC120099866uncharacterized LOC1200998661133470652133492131Rat
41179471LOC120099931uncharacterized LOC1200999311180777618180793202Rat
41179479LOC120099864uncharacterized LOC1200998641132956992132959786Rat
41179831LOC120100444small nucleolar RNA SNORA171108932965108933098Rat
41179892LOC120093155uncharacterized LOC12009315513527185235375055Rat
41191607Rnu6-546RNA, U6 small nuclear 54614704589247045997Rat
41192130Nid2-ps5nidogen 2, pseudogene 513613231736147184Rat
41192158Vmn2r116l-ps18vomeronasal 2, receptor 116 like, pseudogene 1816292671362950254Rat
41214457LOC120100258small nucleolar RNA SNORD1151110285396110285473Rat
41265200LOC120097050uncharacterized LOC12009705018578996885800659Rat
41265789LOC120100403small nucleolar RNA SNORA481202311159202311295Rat
41266353Snord64small nucleolar RNA, C/D box 641111094909111094975Rat
41343633LOC120100475U2 spliceosomal RNA14310999143110055Rat
41343720LOC120097791uncharacterized LOC1200977911127962107127984875Rat
41343776LOC120097358uncharacterized LOC1200973581180007548180011104Rat
41344265Rpl7a-ps36ribosomal protein L7a, pseudogene 361155597343155598176Rat
41367722LOC120099939uncharacterized LOC1200999391182637160182642709Rat
41368180Atp5mj-ps1ATP synthase membrane subunit j, pseudogene 11168472019168472630Rat
41368305LOC120099938uncharacterized LOC1200999381182611965182616488Rat
41368644LOC120099772uncharacterized LOC12009977217745003177453815Rat
41099787LOC120099801uncharacterized LOC12009980119405836294073333Rat
41100855Mospd3-ps1motile sperm domain containing 3, pseudogene 11186237011186249134Rat
41101381LOC120099779uncharacterized LOC12009977918257744282589999Rat
41180804LOC120099767signal recognition particle subunit SRP72-like17598236675984490Rat
41181416LOC120098145homeobox protein ceh-37-like16819961668204251Rat
41192708LOC120100172U6 spliceosomal RNA1151271287151271389Rat
41193534Znf8zinc finger protein 817349852673511929Rat
41216593LOC120100422small nucleolar RNA SNORA171178691996178692130Rat
41267992Aldh3b2-ps1aldehyde dehydrogenase 3 family, member B2, pseudogene 11201226907201244192Rat
41288670Smokyl-ps1sperm motility kinase Y like, pseudogene 115497810954992728Rat
41395739Nsa2-ps7NSA2 ribosome biogenesis factor, pseudogene 71100469200100469968Rat
41396804LOC120100331small nucleolar RNA SNORD1161110462563110462655Rat
41396935LOC120100366small nucleolar RNA SNORA201154286312154286441Rat
41397269LOC120100315small nucleolar RNA SNORD1161110492982110493074Rat
41102250LOC120099768sulfotransferase 2A1-like17605855676077447Rat
41102376LOC120100090uncharacterized LOC12010009013849901038527803Rat
41126118Sbk1-ps1SH3 domain binding kinase 1, pseudogene 117205484372057618Rat
41126597Rnu2-62RNA, U2 small nuclear 621181189588181189777Rat
41158037LOC120097717vomeronasal type-2 receptor 116-like16337154263387113Rat
41158252LOC120099117uncharacterized LOC12009911714693538246941677Rat
41158753LOC120100275small nucleolar RNA SNORD1151110193908110193985Rat
41182833Nid2-ps6nidogen 2, pseudogene 613954880339562954Rat
41182998H3f3a-ps4H3.3 histone A, pseudogene 415151296751532693Rat
41194153Rnu6-81RNA, U6 small nuclear 811197577435197577542Rat
41194366LOC120100356U2 spliceosomal RNA1140302978140303142Rat
41194726LOC120099792uncharacterized LOC12009979218717541287176845Rat
41217149LOC120099762uncharacterized LOC12009976217300417773012469Rat
41218166LOC120100310small nucleolar RNA SNORD1161110972130110972222Rat
41218420LOC120100216U7 small nuclear RNA1146167994146168057Rat
41268507LOC120100283small nucleolar RNA SNORD1151110182787110182865Rat
41269156LOC120099261uncharacterized LOC12009926116496368364987550Rat
41269839Rpl6-ps17ribosomal protein L6, pseudogene 171107702837107711388Rat
41270053LOC120099102rho GTPase-activating protein 20-like13584919135873247Rat
41290328LOC120098456uncharacterized LOC12009845619412461594127467Rat
41291278LOC120099903uncharacterized LOC1200999031161073386161079124Rat
41345916LOC120100259small nucleolar RNA SNORD1151110225775110225852Rat
41346008LOC120100487small nucleolar RNA U1091183371628183371752Rat
41346041Rnu6-968RNA, U6 small nuclear 96819089044290890548Rat
41347527Rnu6-1195RNA, U6 small nuclear 11951106391996106392102Rat
41347657LOC120099849uncharacterized LOC1200998491122862073122867551Rat
41370837LOC120097360uncharacterized LOC1200973601196090054196095217Rat
41371028Vom1r4-ps3vomeronasal 1 receptor 4, pseudogene 317280459172813839Rat
41397435Trnas-aga27transfer RNA serine (anticodon AGA) 2718304842883048502Rat
41397456LOC120100123U6 spliceosomal RNA17532856675328672Rat
41054014LOC120099891uncharacterized LOC1200998911153570312153573747Rat
41070194Ppp2cb-ps1protein phosphatase 2 catalytic subunit beta, pseudogene 115840464858411052Rat
41070218LOC120099817uncharacterized LOC1200998171102476477102497194Rat
41103001LOC120100175U6 spliceosomal RNA19051132190511424Rat
41103194Snora30small nucleolar RNA, H/ACA box 301182139388182139521Rat
41127338LOC120100339small nucleolar RNA Z195/SNORD33/SNORD32 family19561122295611304Rat
41127557Rpl7a-ps4ribosomal protein L7a, pseudogene 41204898799204904044Rat
41127918LOC120097709uncharacterized LOC12009770914370756243712250Rat
41159195LOC120100485small nucleolar RNA U131175228635175228731Rat
41185069LOC120100292small nucleolar RNA SNORD1151110197442110197520Rat
41196423Trnav-aac16transfer RNA valine (anticodon AAC) 161198797943198798023Rat
41219482Mrto4-ps2mRNA turnover 4, ribosome maturation factor, pseudogene 214651482446518112Rat
41219816LOC120099853uncharacterized LOC1200998531127336589127338218Rat
41270156LOC120100399small nucleolar RNA SNORA481184576350184576490Rat
41270287LOC120099122uncharacterized LOC12009912214772752647730867Rat
41270294LOC120099937uncharacterized LOC1200999371182104306182122935Rat
41292788LOC120100099uncharacterized LOC12010009914894820948950577Rat
41292810Snord88csmall nucleolar RNA, C/D box 88C19473215594732245Rat
41348607Rpl14-ps3ribosomal protein L14, pseudogene 318256339182564154Rat
41373488Snord30small nucleolar RNA, C/D box 301205621234205621302Rat
41399003LOC120100122U6 spliceosomal RNA16879109768791203Rat
41399150LOC120099977uncharacterized LOC1200999771202204999202206841Rat
41399316LOC120099949uncharacterized LOC1200999491191146405191161742Rat
41399942Rps10-ps18ribosomal protein S10, pseudogene 181200084281200084735Rat
41071816LOC120099969uncharacterized LOC1200999691200344504200353691Rat
41072504LOC120100452small nucleolar RNA SNORA171153237414153237538Rat
41104542LOC120100266small nucleolar RNA SNORD1151110223936110224013Rat
41128770LOC120099919uncharacterized LOC1200999191174417870174439858Rat
41129480LOC120097803uncharacterized LOC1200978031132925214132928678Rat
41129599Snord97small nucleolar RNA, C/D box 971165186791165186978Rat
41161183Snora29small nucleolar RNA, H/ACA box 2914783383547833971Rat
41161444LOC120099888uncharacterized LOC1200998881153504068153546167Rat
41186103LOC120100232small nucleolar RNA SNORD311205621476205621542Rat
41186776LOC120100418small nucleolar RNA SNORA171186086712186086840Rat
41197070LOC120100419small nucleolar RNA SNORA171147233100147233231Rat
41220342LOC120093107vomeronasal type-1 receptor 1-like16857401068576391Rat
41228858LOC120100184U6 spliceosomal RNA1149795907149796000Rat
41229824Rpl9-ps10ribosomal protein L9, pseudogene 1017637467876389638Rat
41229892Snord28bsmall nucleolar RNA, C/D box 28B1205620424205620501Rat
41271539LOC120099912uncharacterized LOC1200999121170546748170550493Rat
41271806Trnaa-agc61transfer RNA alanine (anticodon AGC) 611100836137100836210Rat
41292995LOC120096889uncharacterized LOC12009688918029278080294985Rat
41349421Krtap5-5l2keratin associated protein 5-5 like 21197306627197307614Rat
41401400LOC120099834uncharacterized LOC1200998341115051743115085815Rat
41401628Ywhah-ps1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta, pseudogene 11147982102148014119Rat
41073030LOC120100252small nucleolar RNA SNORD1151110260759110260836Rat
41081006LOC120099242uncharacterized LOC12009924216252809762548416Rat
41081049LOC120100325small nucleolar RNA SNORD1161110485165110485257Rat
41081613Snora54small nucleolar RNA, H/ACA box 541198727462198727588Rat
41105862LOC120100463small nucleolar RNA SNORA4016705588267056015Rat
41130624Rnu6-105RNA, U6 small nuclear 10518341819183418290Rat
41130772LOC120100269small nucleolar RNA SNORD1151110214472110214549Rat
41130940LOC120099109uncharacterized LOC12009910914352558343527559Rat
41198576LOC120097768uncharacterized LOC1200977681109198620109204581Rat
41230170LOC120097347uncharacterized LOC1200973471155852256155853969Rat
41230706Pnma8cPNMA family member 8C17766906277671517Rat
41230808LOC120099812uncharacterized LOC12009981219738377897386285Rat
41231025Ftl1-ps12ferritin light chain 1, pseudogene 1217708689677095834Rat
41272412Usp17lubiquitin specific peptidase 17 like1158993774158995929Rat
41272992LOC120097339uncharacterized LOC1200973391120764055120770141Rat
41273648Trnaa-agc66transfer RNA alanine (anticodon AGC) 6618001474580014819Rat
41294442Snord35asmall nucleolar RNA, C/D box 35A19561018595610264Rat
41294589LOC120100468small nucleolar RNA SNORA761135499682135499825Rat
41294864Trnap-cgg4transfer RNA proline (anticodon CGG) 317751777877517852Rat
41351837LOC120099892uncharacterized LOC1200998921154739519154741308Rat
41375603Ptma-ps5prothymosin alpha, pseudogene 518541440185414670Rat
41375961Lypla1-ps3lysophospholipase 1, pseudogene 315884931258850163Rat
41082835LOC120100140U6 spliceosomal RNA15874508658745192Rat
41082912Rpl17-ps11ribosomal protein L17, pseudogene 1116589225565892870Rat
41107959LOC120100450small nucleolar RNA SNORA1718786102287861136Rat
41108358LOC120100291small nucleolar RNA SNORD1151110322055110322131Rat
41131410LOC120100171U6 spliceosomal RNA19359441593594521Rat
41164166LOC120100400small nucleolar RNA SNORA481129979431129979573Rat
41199722LOC120093055small Cajal body-specific RNA 315264827452648388Rat
41199887LOC120099980uncharacterized LOC1200999801202446708202448022Rat
41200237LOC120100330small nucleolar RNA SNORD1161110495552110495645Rat
41200627LOC120099128uncharacterized LOC12009912815601060056014665Rat
41232042Vom1r4lvomeronasal type-1 receptor 4-like16470596564706906Rat
41274044LOC120100449small nucleolar RNA SNORA1712761898427619106Rat
41275464LOC120097162uncharacterized LOC12009716219584503395849118Rat
41296074Or52i2l-ps1olfactory receptor family 52 subfamily I member 2 like, pseudogene 11157112092157113068Rat
41296176LOC120097775uncharacterized LOC1200977751115747262115755253Rat
41296445LOC120100337small nucleolar RNA SNORD1161111037433111037527Rat
41296733LOC120100341small nucleolar RNA SNORA701121176393121176525Rat
41352397Hmgb1-ps32high-mobility group box 1, pseudogene 3219797329497974178Rat
41352398LOC120097708uncharacterized LOC12009770814311178143117463Rat
41376744LOC120100178U1 spliceosomal RNA14058664340586804Rat
41376786LOC120100416small nucleolar RNA SNORA171166729024166729154Rat
41084452Rpl9-ps3ribosomal protein L9, pseudogene 317645960676460290Rat
41084506LOC120099825uncharacterized LOC1200998251111424659111494106Rat
41084950LOC120100317small nucleolar RNA SNORD1161110469365110469457Rat
41109328Rab1a-ps2RAB1A, member RAS oncogene family, pseudogene 213680037436801331Rat
41110617LOC120100270small nucleolar RNA SNORD1151110210797110210874Rat
41133992LOC120099898glyceraldehyde-3-phosphate dehydrogenase-like1156884450156934043Rat
41136282LOC120100464small nucleolar RNA SNORA401119956733119956858Rat
41166428LOC120100376small nucleolar RNA SNORA2/SNORA34 family1104515030104515165Rat
41166468LOC120099902uncharacterized LOC1200999021160415733160433407Rat
41166596LOC120100265small nucleolar RNA SNORD1151110308960110309037Rat
41200941LOC120100407small nucleolar RNA SNORA481134251885134252021Rat
41201048Rnu6-651RNA, U6 small nuclear 6511170936910170937016Rat
41201839LOC120098986uncharacterized LOC12009898612990898529924691Rat
41201883Hbb-b2hemoglobin, beta adult minor chain1158243696158245076Rat
41202226LOC120100150U6 spliceosomal RNA1106789754106789860Rat
41202383LOC120100098uncharacterized LOC12010009815028556950361263Rat
41233400Gpx4-ps4glutathione peroxidase 4, pseudogene 416225573562257483Rat
41233713LOC120099880uncharacterized LOC1200998801143975541143984048Rat
41234278LOC120100290small nucleolar RNA SNORD1151110184594110184670Rat
40944949Snord26small nucleolar RNA, C/D box 261205619818205619892Rat
40945041Trnaa-agc69transfer RNA alanine (anticodon AGC) 6919497229894972372Rat
40971092LOC120100305small nucleolar RNA SNORD1161110974703110974795Rat
40972134Trnap-cggtransfer RNA proline (anticodon CGG)17751777877517852Rat
40972134Trnap-cggtransfer RNA proline (anticodon CGG)19247162192471695Rat
40996607LOC120099120acetyl-CoA acetyltransferase, cytosolic-like14771719647723781Rat
40996824LOC120100273small nucleolar RNA SNORD1151110315578110315662Rat
40997215Srsf3-ps8serine and arginine rich splicing factor 3, pseudogene 814539120245391657Rat
40946073LOC120099930uncharacterized LOC1200999301177624419177630543Rat
40947517LOC120100409U2 spliceosomal RNA1203171581203171718Rat
40973162LOC120100241small nucleolar RNA SNORD1151110240543110240620Rat
40973358LOC120100244small nucleolar RNA SNORD1151110247891110247968Rat
41012033LOC120099944uncharacterized LOC1200999441187432306187435276Rat
40948223Nid2-ps13nidogen 2, pseudogene 1313841522738440562Rat
40973506LOC120100346small nucleolar RNA SNORA571205782250205782397Rat
41015843LOC120100242small nucleolar RNA SNORD1151110244217110244294Rat
41015854LOC120099951uncharacterized LOC1200999511192977453192980548Rat
40950017LOC120100224U7 small nuclear RNA1203666337203666394Rat
40950485Snx4-ps1sorting nexin 4, pseudogene 11118719465118723782Rat
40951011LOC120100219U7 small nuclear RNA1159294900159294947Rat
40974486LOC120099934uncharacterized LOC1200999341181728557181731580Rat
40974504Rps29-ps9ribosomal protein S29, pseudogene 91119451277119451561Rat
40975001LOC120099854uncharacterized LOC1200998541127347845127351622Rat
40975144LOC120097344uncharacterized LOC1200973441145457745145462979Rat
40975851LOC120097361uncharacterized LOC1200973611196153056196157337Rat
41340986Bcl10-ps1BCL10, immune signaling adaptor, pseudogene 116381728763819002Rat
41341028Rpl26l1-ps1ribosomal protein L26-like 1, pseudogene 11134875225134875637Rat
41341459LOC120099959uncharacterized LOC1200999591198077644198123085Rat
40952154LOC120097710uncharacterized LOC12009771014459645644608059Rat
40952192LOC120099808uncharacterized LOC12009980819712204697126401Rat
40952347Odc1-ps7ornithine decarboxylase 1, pseudogene 716997820170005577Rat
40952513Snord15asmall nucleolar RNA, C/D box 15A1153782788153782935Rat
40976055Rnu6-26RNA, U6 small nuclear 261167476849167476955Rat
40976304LOC120100448small nucleolar RNA SNORA171123620368123620504Rat
40976307LOC120097714uncharacterized LOC12009771415574275555746829Rat
40976798Trnas-aga33transfer RNA serine (anticodon AGA) 3318702847987028559Rat
40977331Mrgprb4-ps1MAS-related GPR, member B4, pseudogene 119797848197980262Rat
40977505Pym1-ps10PYM homolog 1, exon junction complex associated factor, pseudogene 1018037411580376604Rat
41012795Snord88asmall nucleolar RNA, C/D box 88A19473429994734388Rat
41012988LOC120100329small nucleolar RNA SNORD1161110979851110979943Rat
41013486Rpl36-ps8ribosomal protein L36, pseudogene1117148209117148529Rat
40926109LOC120097340uncharacterized LOC1200973401120775852120778917Rat
40953130LOC12009778560S ribosomal protein L27-like1124728576124728938Rat
40953491LOC120100293small nucleolar RNA SNORD1151110200168110200253Rat
40953947LOC120099899MLV-related proviral Env polyprotein-like1158445311158447321Rat
40955162LOC120098992uncharacterized LOC12009899213117776731197773Rat
40978348G3bp1-ps1G3BP stress granule assembly factor 1, pseudogene 11158768853158770150Rat
40978443LOC120100095uncharacterized LOC12010009513961491439670599Rat
40978721LOC120099868uncharacterized LOC1200998681133652575133654456Rat
41014533LOC120100128U6 spliceosomal RNA1165942462165942568Rat
41014644LOC120100364small nucleolar RNA SNORA241173170301173170415Rat
41015411LOC120100324small nucleolar RNA SNORD1161110482541110482633Rat
40927059LOC120100340small nucleolar RNA SNORD3419561043295610498Rat
40927122LOC120099908uncharacterized LOC1200999081166913881166916228Rat
40927136Rpl36-ps12ribosomal protein L36, pseudogene1175156882175167650Rat
40927834LOC120100306small nucleolar RNA SNORD1161110977274110977366Rat
40928345LOC120099124uncharacterized LOC12009912414839474648414438Rat
40955462Trnap-agg33transfer RNA proline (anticodon AGG) 3314672881946728900Rat
40956054LOC120100387U2 spliceosomal RNA1113515184113515344Rat
40979199LOC120100272small nucleolar RNA SNORD1151110307020110307096Rat
40979258LOC120097159uncharacterized LOC12009715919570437495707794Rat
40979906LOC120100145U6 spliceosomal RNA1189412198189412304Rat
40980061Rnu6-826RNA, U6 small nuclear 82618546832585468431Rat
40980777LOC120098104vomeronasal type-1 receptor 2-like16029435760295292Rat
40999106LOC120100332small nucleolar RNA SNORD1161111005695111005787Rat
40999933LOC120100494U4 spliceosomal RNA1121936095121936219Rat
40929172LOC120099842uncharacterized LOC1200998421119297968119315737Rat
40957095Rpl7a-ps34ribosomal protein L7a, pseudogene 341117339434117347725Rat
40982279Pnpla8-ps1patatin-like phospholipase domain containing 8, pseudogene 11138732722138759449Rat
41001342LOC120100413small nucleolar RNA SNORA171142114137142114268Rat
41002066LOC120099839uncharacterized LOC1200998391118747408118781774Rat
40958364LOC120100454U2 spliceosomal RNA1133230750133230898Rat
40982908Rpl7a-ps8ribosomal protein L7a, pseudogene 81205942455205943253Rat
40982950LOC120100285small nucleolar RNA SNORD1151110238704110238780Rat
40983107Rnu6-1205RNA, U6 small nuclear 12051196216573196216678Rat
40983394LOC120100261small nucleolar RNA SNORD1151110271033110271110Rat
40983475LOC120100257small nucleolar RNA SNORD1151110287232110287309Rat
40983518LOC120100263small nucleolar RNA SNORD1151110236867110236944Rat
41003782LOC120099862uncharacterized LOC1200998621132785368132793311Rat
40932419LOC120100137U6 spliceosomal RNA18080331980803425Rat
40933306LOC120099116uncharacterized LOC12009911614662698446634286Rat
40933693Trnap-gggtransfer RNA proline (anticodon GGG)19606763996067719Rat
40933799Rnu6-672RNA, U6 small nuclear 67216238452062384626Rat
40984706Snrpc-ps10small nuclear ribonucleoprotein polypeptide C, pseudogene 101137642550137643027Rat
40985057LOC120100215U7 small nuclear RNA13494816234948226Rat
40985241Vmn2r116l-ps15vomeronasal 2, receptor 116 like, pseudogene 151139595637139617784Rat
41004471LOC120097182uncharacterized LOC12009718219602475096033425Rat
41004698Ncl-ps3nucleolin, pseudogene 317540379475405022Rat
41004822LOC120097382uncharacterized LOC1200973821203129229203140014Rat
40935377Rpl24-ps8ribosomal protein L24, pseudogene 815302745853029294Rat
40935431LOC120099815uncharacterized LOC1200998151101354768101380898Rat
40961693LOC120099215uncharacterized LOC12009921516126311361265093Rat
40961947LOC120100367U2 spliceosomal RNA1164020562164020659Rat
40962139LOC120100397small nucleolar RNA SNORA481175549477175549618Rat
40986524LOC120097346uncharacterized LOC1200973461155432265155458440Rat
40962765Rnu6-783RNA, U6 small nuclear 78313480425834804364Rat
40988177LOC12009995760S ribosomal protein L36-like1194805628194806244Rat
41008579LOC120097338uncharacterized LOC1200973381118247652118262726Rat
40938955LOC120100316small nucleolar RNA SNORD1161111000373111000465Rat
40938986Rnu6-1001RNA, U6 small nuclear 100112519679325196899Rat
40939292LOC120100115U4 spliceosomal RNA19955785499557970Rat
40963993Trnaa-agc40transfer RNA alanine (anticodon AGC) 4015752508757525161Rat
40964065LOC120099806uncharacterized LOC12009980619689199996904056Rat
40964929LOC120100151U6 spliceosomal RNA1103004250103004356Rat
40964934LOC120100455small nucleolar RNA SNORA1712526492725265029Rat
40990384Rnu6-658RNA, U6 small nuclear 65819361098493611083Rat
40990662LOC120100377small nucleolar RNA SNORA211175531005175531140Rat
41010141Rnu6-395RNA, U6 small nuclear 39515380653353806636Rat
41010327LOC120099115uncharacterized LOC12009911514605725346062998Rat
40939961Trnag-acc5transfer RNA glycine (anticodon ACC) 517593415375934225Rat
40940142LOC120099878uncharacterized LOC1200998781143707970143731710Rat
40941034LOC120100233small nucleolar RNA SNORD221205621734205621859Rat
40941038Rnu4-5RNA, U4 small nuclear 512544589825446060Rat
40965566Zfp994lzinc finger protein 994 like16178904461791216Rat
40966335LOC120100251small nucleolar RNA SNORD1151110258920110258997Rat
40966768LOC120099905uncharacterized LOC1200999051165614823165635270Rat
40941743LOC120100286small nucleolar RNA SNORD1151110311820110311899Rat
40942253LOC120099791uncharacterized LOC12009979118696272486966447Rat
40942925Snora3Bsmall nucleolar RNA, H/ACA box 3B1163541736163541866Rat
40942998Trnastop-ucatransfer RNA opal suppressor (anticodon UCA)17895260178952687Rat
40942999LOC120100423small nucleolar RNA SNORA171169083085169083212Rat
40943119LOC120100274small nucleolar RNA SNORD1151110242382110242458Rat
40967854LOC120100474small nucleolar RNA SNORD8814129686941296962Rat
40967984LOC120099940uncharacterized LOC1200999401182890478182896780Rat
40994046LOC120099799uncharacterized LOC12009979919387125693874563Rat
40994558LOC120096885thymosin beta-4-like17966660579666715Rat
40943754LOC120100307small nucleolar RNA SNORD1161110987576110987668Rat
40943837LOC120100279small nucleolar RNA SNORD1151110305181110305258Rat
40943897LOC120100268small nucleolar RNA SNORD1151110212636110212713Rat
40970916LOC120100439small nucleolar RNA SNORA171157186339157186469Rat
40995085Trnav-aac35transfer RNA valine (anticodon AAC) 351169956121169956193Rat
40996352Rab1a-ps3RAB1A, member RAS oncogene family, pseudogene 313750936237511163Rat
41046890LOC120100116U4 spliceosomal RNA1160433810160433960Rat
41047128LOC120099826uncharacterized LOC1200998261113454803113493548Rat
41074683LOC120099813uncharacterized LOC12009981319769140697706639Rat
41074861LOC120099952uncharacterized LOC1200999521192968015192975350Rat
41242622LOC120100203U6 spliceosomal RNA16910862069108678Rat
41243157LOC120100349small nucleolar RNA SNORA6715731786157318000Rat
41312538Atp5mpl-ps1ATP synthase membrane subunit 6.8PL, pseudogene 11133428752133429328Rat
41024969LOC120099847uncharacterized LOC1200998471122285441122312506Rat
41048269LOC120099818uncharacterized LOC1200998181103031956103034632Rat
41244685Obox2l2oocyte specific homeobox 2 like 216821681268219145Rat
41313338LOC120100411small nucleolar RNA SNORA1718757426087574391Rat
41025307LOC120097343uncharacterized LOC1200973431145498645145531228Rat
41025316Snord14asmall nucleolar RNA, C/D box 14A1170574389170574475Rat
41026019Gapdh-ps79Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 7916636604666366954Rat
41049276Trnap-agg45transfer RNA proline (anticodon AGG) 4519541589095415964Rat
41049731Snord27small nucleolar RNA, C/D box 271205620094205620167Rat
41049822Rnu6-946RNA, U6 small nuclear 9461135620777135620883Rat
41077517LOC120099851uncharacterized LOC1200998511124972989125042272Rat
41077533LOC120100327small nucleolar RNA SNORD1161110490401110490493Rat
41245374LOC120099909uncharacterized LOC1200999091167221216167259345Rat
41316835LOC120100481small nucleolar RNA U131163428009163428118Rat
41027146Ass1-ps1argininosuccinate synthase 1, pseudogene 117658619176590160Rat
41027479LOC120098290pregnancy-specific glycoprotein 22-like17802717378037254Rat
41029299LOC120099956uncharacterized LOC1200999561194753901194762856Rat
41050934LOC120098989uncharacterized LOC12009898912998124829993418Rat
41050960LOC120099861uncharacterized LOC1200998611132181245132187438Rat
41052366Snord23small nucleolar RNA, C/D box 2317662999876630106Rat
41079295LOC12009996460S ribosomal protein L21-like1199147655199158744Rat
41079516LOC120100288small nucleolar RNA SNORD1151110189568110189645Rat
41080214LOC120099897uncharacterized LOC1200998971155953421155981611Rat
41246900LOC120100121U6 spliceosomal RNA17593843675938542Rat
41246986LOC120097713uncharacterized LOC12009771315110963951142691Rat
41247311LOC120100287small nucleolar RNA SNORD1151110313740110313816Rat
41247581LOC120099863uncharacterized LOC1200998631132800647132808007Rat
41247671Rnu6-859RNA, U6 small nuclear 85914369158143691678Rat
41247706Rpl23a-ps4ribosomal protein L23a, pseudogene 415221546152222521Rat
41248172Klk5l-ps2kallikrein related-peptidase 5 like, pseudogene 219460846594612477Rat
41319484LOC120099921uncharacterized LOC1200999211175343435175352194Rat
41332180Trnav-cac7transfer RNA valine (anticodon CAC) 712512645025126530Rat
41332266LOC120097396uncharacterized LOC1200973961203418395203420636Rat
41029545LOC120099819uncharacterized LOC1200998191105731072105743435Rat
41029618LOC120097363uncharacterized LOC1200973631196704589196707241Rat
41029790Snora23small nucleolar RNA, H/ACA box 231164091024164091206Rat
41030208LOC120099776uncharacterized LOC12009977617852228578530274Rat
41030580Aldh3b3l-ps1aldehyde dehydrogenase 3 family, member B3-like, pseudogene 11201200291201218456Rat
41030689LOC120100112U4 spliceosomal RNA12774229627742439Rat
41052996LOC120100431U2 spliceosomal RNA18546031485460452Rat
41053334Rab1a-ps1RAB1A, member RAS oncogene family, pseudogene 113664225336643958Rat
41053370LOC120099979uncharacterized LOC1200999791202424804202438149Rat
41135452Trnap-agg46transfer RNA proline (anticodon AGG) 4615533563255335712Rat
41248427LOC120099831uncharacterized LOC1200998311114615464114620387Rat
41248459Rab12-ps1RAB12, member RAS oncogene family, pseudogene 117971533979717214Rat
41255207LOC120100490U2 spliceosomal RNA16433587664335977Rat
41255323Trnap-agg47transfer RNA proline (anticodon AGG) 471118957548118957629Rat
41255497Vmn2r116l-ps14vomeronasal 2, receptor 116 like, pseudogene 1417129757171332969Rat
41255502LOC120100360small nucleolar RNA SNORA41154965714154965854Rat
41332531LOC120100477small nucleolar RNA SNORA1118675870286758828Rat
41332604Trnas-aga46transfer RNA serine (anticodon AGA) 461163867257163867330Rat
41332605Snord33small nucleolar RNA, C/D box 3319561069995610783Rat
41053469LOC120097702uncharacterized LOC12009770213260885332613035Rat
41054606Snord107small nucleolar RNA, C/D box 1071111099306111099377Rat
41054609Rps21-ps8ribosomal protein S21, pseudogene 817201995872022913Rat
41054610LOC120097407uncharacterized LOC1200974071203705115203706406Rat
41143699LOC120099855uncharacterized LOC1200998551127368228127374172Rat
41143867LOC120099848uncharacterized LOC1200998481122441489122510976Rat
41144525LOC120099778small nuclear ribonucleoprotein G-like18258468782585068Rat
41338033LOC120097365uncharacterized LOC1200973651197546933197550986Rat
41338037LOC120100255small nucleolar RNA SNORD1151110294577110294654Rat
41338298LOC120100260small nucleolar RNA SNORD1151110227613110227690Rat
41338961LOC120099266uncharacterized LOC12009926616535654865359431Rat
41152311LOC120099112uncharacterized LOC12009911214501622045033505Rat
41257043Actg1-ps11actin, gamma 1, pseudogene 111128530958128550705Rat
41258428LOC120096980uncharacterized LOC12009698018553610285547123Rat
41335386LOC120100237small nucleolar RNA SNORD1151110289065110289142Rat
41336186LOC120100222U7 small nuclear RNA1141120935141120995Rat
41056946Trnag-acc2transfer RNA glycine (anticodon ACC) 217532427475324346Rat
41057227LOC120097359uncharacterized LOC1200973591180145598180148961Rat
41057629LOC120098995uncharacterized LOC12009899513139434731396128Rat
41153489LOC120100164U6 spliceosomal RNA1105964547105964651Rat
41220638LOC120100379small nucleolar RNA SNORA2112936727429367411Rat
41258524Vmn2r116l-ps13vomeronasal 2, receptor 116 like, pseudogene 1316342835163441975Rat
41258807LOC120100091uncharacterized LOC12010009113901301039029344Rat
41267784LOC120100194U6 spliceosomal RNA1175567629175567731Rat
41297741LOC120100104sperm motility kinase Y-like15408241354992728Rat
41297868LOC120100373small nucleolar RNA SNORA441173218181173218293Rat
41297869LOC120100284small nucleolar RNA SNORD1151110186394110186471Rat
41298058LOC120100124U6 spliceosomal RNA1181409122181409228Rat
41317864LOC120100248small nucleolar RNA SNORD1151110253404110253481Rat
41057890Vmn2r116l-ps22vomeronasal 2, receptor 116 like, pseudogene 2216223243162234493Rat
41222147LOC120096893uncharacterized LOC12009689318129633481301538Rat
41222380Rnu6-993RNA, U6 small nuclear 9931200728408200728511Rat
41298225LOC120093062mas-related G-protein coupled receptor member B8-like19805785298058838Rat
41299698Trnag-acc7transfer RNA glycine (anticodon ACC) 71152191930152192004Rat
41033562LOC120100264small nucleolar RNA SNORD1151110180033110180111Rat
41034538Trnap-agg55transfer RNA proline (anticodon AGG) 551120030751120030832Rat
41059698Usp17laubiquitin specific peptidase 17-like A1159165961159169738Rat
41060371Trnaa-agc48transfer RNA alanine (anticodon AGC) 481160879981160880061Rat
41060898LOC120099814uncharacterized LOC1200998141101052794101087616Rat
41223864LOC120099927uncharacterized LOC1200999271177281328177289987Rat
41224548Hnrnpa1-ps23heterogeneous nuclear ribonucleoprotein A1, pseudogene 2312838267628386857Rat
41224851LOC120100335small nucleolar RNA SNORD1161110992583110992674Rat
41299842LOC120099113uncharacterized LOC12009911314531237845317435Rat
41300746Vom1r2-ps1vomeronasal 1 receptor 2, pseudogene 117375036473751592Rat
41300812LOC120100311U2 spliceosomal RNA18336327283363384Rat
41301263Ptp4a1-ps2protein tyrosine phosphatase 4A1, pseudogene 21143359417143360017Rat
41336906LOC120100462small nucleolar RNA SNORA4014800320648003337Rat
41337281LOC120100320small nucleolar RNA SNORD1161111014871111014964Rat
41035119E2f5-ps1E2F transcription factor 5, pseudogene 116607514466076828Rat
41035175LOC120097960uncharacterized LOC1200979601171287279171301330Rat
41061314LOC120100421small nucleolar RNA SNORA171109086517109086648Rat
41062554LOC120100372small nucleolar RNA SNORA441135195011135195135Rat
41225682Tuba1b-ps6tubulin, alpha 1B, pseudogene 615848237258484437Rat
41226396Rpl24-ps7ribosomal protein L24, pseudogene 715328934853289825Rat
41226711LOC120099840uncharacterized LOC1200998401118932104118936851Rat
41302139LOC120099915uncharacterized LOC1200999151172632858172636221Rat
41334291Set-ps4Set nuclear proto-oncogene, pseudogene 41154329801154343007Rat
41334313LOC120100334U2 spliceosomal RNA15130247251302596Rat
41335333LOC120099893uncharacterized LOC1200998931154865137154884266Rat
41037329LOC120099103uncharacterized LOC12009910313609044736107414Rat
41037345LOC120100425small nucleolar RNA SNORA171147306143147306271Rat
41063986LOC120099104uncharacterized LOC12009910413603618236044823Rat
41064447LOC120099099uncharacterized LOC12009909913498934035015200Rat
41235310LOC120100314small nucleolar RNA SNORD1161110477332110477424Rat
41303130LOC120100105sperm motility kinase 3A-like15327403853282717Rat
41303197LOC120100243small nucleolar RNA SNORD1151110246052110246129Rat
41303933Snora52small nucleolar RNA, H/ACA box 521196547488196547621Rat
41303997LOC120099860uncharacterized LOC1200998601131469335131484623Rat
41016316LOC120100236small nucleolar RNA SNORD1151110283559110283636Rat
41016349LOC120097707uncharacterized LOC12009770714215732742158793Rat
41016838LOC120100358small nucleolar RNA SNORA518532302285323143Rat
41017423LOC120099945uncharacterized LOC1200999451187480900187493664Rat
41039060Envl-ps2MLV-related proviral Env polyprotein-like, pseudogene 216727516467280464Rat
41039507LOC120100209U7 small nuclear RNA19086153790861598Rat
41064894LOC120100295small nucleolar RNA SNORD1161110498125110498217Rat
41066016LOC120100103uncharacterized LOC12010010315235338152363220Rat
41066460LOC120100392small nucleolar RNA SNORA511195788436195788564Rat
41236265LOC120100246small nucleolar RNA SNORD1151110249730110249807Rat
41236487Dnajb6-ps3DnaJ heat shock protein family (Hsp40) member B6, pseudogene 31102565949102567063Rat
41237199LOC120100343small nucleolar RNA SNORA701146918150146918259Rat
41304089LOC120100239small nucleolar RNA SNORD1151110272865110272942Rat
41041174LOC120099773uncharacterized LOC12009977317839293978408647Rat
41041613Rnu6-856RNA, U6 small nuclear 85619119747691197582Rat
41041741LOC120100361small nucleolar RNA SNORA151136662596136662746Rat
41042088LOC120099033uncharacterized LOC12009903313324656133288412Rat
41067342LOC120097354uncharacterized LOC1200973541164542501164557133Rat
41237530LOC120100125U6 spliceosomal RNA1124419603124419709Rat
41238308LOC120099967uncharacterized LOC1200999671200189261200203943Rat
41305885Gapdh-ps59Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 591175984378175985956Rat
41306400LOC120099774uncharacterized LOC12009977417840858578414690Rat
41307068LOC120100394small nucleolar RNA U2-3014221219042212259Rat
41019099LOC120100465U2 spliceosomal RNA1137371689137371783Rat
41019110LOC120096890uncharacterized LOC12009689018029713180301947Rat
41042460LOC120099118uncharacterized LOC12009911814718362847198482Rat
41042766Shisal3shisa like 31134296708134298626Rat
41042878LOC120100262small nucleolar RNA SNORD1151110190139110190216Rat
41067967Rnu6-891RNA, U6 small nuclear 8911138601694138601800Rat
41068534LOC120099869uncharacterized LOC1200998691133590983133598028Rat
41069108LOC120097222uncharacterized LOC12009722219982886399830975Rat
41069559Rnu6-317RNA, U6 small nuclear 3171196649599196649705Rat
41239287LOC120099830uncharacterized LOC1200998301114155536114162109Rat
41307516LOC120100432small nucleolar RNA SNORA1714844963848449772Rat
41021046LOC120099790uncharacterized LOC12009979018694152386954785Rat
41045503Rnu6-799RNA, U6 small nuclear 7991177586062177586168Rat
41241885LOC120100156U1 spliceosomal RNA1128006617128006780Rat
41309215LOC120100386small nucleolar RNA SNORA321201660247201660328Rat
41309315LOC120100235small nucleolar RNA SNORD1151110274700110274777Rat
41022847LOC120099833uncharacterized LOC1200998331115011988115017347Rat
41023737LOC120100319small nucleolar RNA SNORD1161110467179110467271Rat
150344952Zfp790zinc finger protein 420-like18503892385053325Rat
155630625LOC127212837Sec61 pseudogene19275253692752936Rat
329845492LOC130062809uncharacterized LOC13006280919390078493913081Rat
1596174Fth1-ps5ferritin heavy chain 1, pseudogene 53136914889136915757Rat

Nucleotide Sequences
RefSeq Transcripts NM_012848 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC078892 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC081845 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC089817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC097341 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC111078 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC127507 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ209506 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210859 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211155 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211657 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212180 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213698 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ216698 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ217105 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ217377 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218113 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218205 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218247 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220020 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220121 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220129 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220190 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220207 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220208 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220236 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220242 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220290 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220318 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220323 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220336 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220343 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220429 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220440 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220457 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220465 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220473 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220530 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220538 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220603 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220612 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220616 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220635 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220649 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220653 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220656 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220657 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220664 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220737 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220761 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220768 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220780 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220794 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220815 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220847 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220848 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220860 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220894 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220937 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220949 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220955 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220974 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220980 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221008 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221025 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221042 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221055 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221270 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221273 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221283 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221285 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221305 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221322 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221323 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221449 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221530 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221594 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221708 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221724 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221786 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221796 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221857 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221922 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222029 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222053 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222126 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222138 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222301 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222409 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222432 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222473 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222548 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223030 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223051 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223119 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223288 (Get FASTA)