C76941 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: C76941

Symbol: C76941
Previously known as:
RGD ID: 5502263
Expected Size: 205 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21812,037,856 - 12,038,058 (-)MAPPERmRatBN7.2
mRatBN7.21598,037,637 - 98,039,268 (+)MAPPERmRatBN7.2
Rnor_6.015106,289,890 - 106,291,520NCBIRnor6.0
Rnor_6.01815,440,144 - 15,440,345NCBIRnor6.0
Rnor_5.01815,218,833 - 15,219,034UniSTSRnor5.0
Rnor_5.015109,685,789 - 109,687,419UniSTSRnor5.0
RGSC_v3.41812,501,764 - 12,501,965UniSTSRGSC3.4
RGSC_v3.415106,018,567 - 106,020,197UniSTSRGSC3.4
Celera1596,846,041 - 96,847,671UniSTS
Celera1812,045,749 - 12,045,950UniSTS
Cytogenetic Map15q24UniSTS
Is Marker For: Genes:   Ipo5   Ipo5-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CATGTTTAATGGCCTCATGC
Reverse Primer TGTGTGAATGTGGAGGAGGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
6502448Ipo5-ps1importin 5, pseudogene 1181203772312039781Rat
1308715Ipo5importin 5159799075598041074Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552968Pigfal19Plasma insulin-like growth factor 1 level QTL 1911.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)18125758124Rat
9590248Scort10Serum corticosterone level QTL 1019.710.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)18125758124Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor surface area measurement (CMO:0002078)18224947722066430Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)18224947722066430Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
11565454Kidm59Kidney mass QTL 590.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)18679125112205285Rat
12904714Cm131Cardiac mass QTL 1310.002heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)18679125112205285Rat
12904715Cm132Cardiac mass QTL 1320.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)18679125112205285Rat
12904716Am21Aortic mass QTL 210.005aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)18679125112205285Rat
2301409Cm70Cardiac mass QTL 700.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)18679125112205285Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
12904690Cm129Cardiac mass QTL 1290.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)181194427326548295Rat
12904689Cm128Cardiac mass QTL 1280.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)181194427326548295Rat
12904693Am20Aortic mass QTL 200.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)181194427326548295Rat
12904695Kidm73Kidney mass QTL 730.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)181194427326548295Rat
12904691Cm130Cardiac mass QTL 1300.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)181194427326548295Rat
12904680Bw189Body weight QTL 1890.019body mass (VT:0001259)body weight (CMO:0000012)181194427326548295Rat
2301410Bp317Blood pressure QTL 3170.004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194427326548295Rat
1331781Scl28Serum cholesterol level QTL 283.995blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)181194429924797117Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
1300118Bp190Blood pressure QTL 1902.94arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)158226252098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1575788062101769107Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)157369051899794247Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1576306099101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1300120Kidm7Kidney mass QTL 73.55kidney mass (VT:0002707)left kidney wet weight to body weight ratio (CMO:0001954)158226252098288169Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1575788062101769107Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100909691 UniSTS
  306182 UniSTS
UniSTS 160895 UniSTS