NCAM2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: NCAM2

Symbol: NCAM2
Previously known as:
RGD ID: 5501705
Expected Size: 726 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21120,586,819 - 20,587,545 (+)MAPPERmRatBN7.2
Rnor_6.01120,703,613 - 20,704,338NCBIRnor6.0
Rnor_5.01124,351,591 - 24,352,316UniSTSRnor5.0
RGSC_v3.41120,909,972 - 20,910,697UniSTSRGSC3.4
Celera1120,501,313 - 20,502,038UniSTS
Cytogenetic Map11q11UniSTS
Is Marker For: Genes:   Ncam2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGACCAAAACTATTCCATTGACC
Reverse Primer AAGCTGAGGGCAGAAATCAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1303131Ncam2neural cell adhesion molecule 2112010497420592168Rat

Nucleotide Sequences
RefSeq Transcripts NM_203409 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AY495695 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634341Bw121Body weight QTL 1213.56abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)11121836709Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
1641927Alcrsp10Alcohol response QTL 10alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)11843667453436674Rat
2290451Scl58Serum cholesterol level QTL 583.48blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)111283104625121472Rat
724517Uae18Urinary albumin excretion QTL 183.7urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)111647204744285911Rat
1600394Edcs1Endometrial carcinoma susceptibility QTL12.90.04uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)111897620824697116Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 288280 UniSTS
UniSTS 266420 UniSTS