MARC_9759-9760:996688576:1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: MARC_9759-9760:996688576:1

Symbol: MARC_9759-9760:996688576:1
Previously known as:
RGD ID: 5500951
Expected Size: 309 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21754,904,138 - 54,904,449 (+)MAPPERmRatBN7.2
mRatBN7.25138,350,339 - 138,350,648 (+)MAPPERmRatBN7.2
Rnor_6.05144,083,176 - 144,083,484NCBIRnor6.0
Rnor_6.01759,804,014 - 59,804,324NCBIRnor6.0
Rnor_5.01761,593,283 - 61,593,593UniSTSRnor5.0
Rnor_5.05147,852,636 - 147,852,944UniSTSRnor5.0
RGSC_v3.45145,426,545 - 145,426,853UniSTSRGSC3.4
RGSC_v3.41763,457,903 - 63,458,213UniSTSRGSC3.4
Celera1756,244,169 - 56,244,479UniSTS
Celera5136,860,756 - 136,861,064UniSTS
Cytogenetic Map5q36UniSTS
Cytogenetic Map17q12.1UniSTS
Cytogenetic Map18q12.1UniSTS
Is Marker For: Genes:   Rps14   Oscp1   Rps14-ps4   Rps14-ps7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGGGGTGACATCCTCAATC
Reverse Primer CACATCTTTGCGTCCTTCAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1589711Rps14-ps4ribosomal protein S14, pseudogene 4175490401954904610Rat
1306596Oscp1organic solute carrier partner 15138334552138365220Rat
6490698Rps14-ps7ribosomal protein S14, pseudogene 75138350191138350766Rat

Nucleotide Sequences
RefSeq Transcripts NM_022672 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003750030.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003754101.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC058472 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV103768 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210177 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210178 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210421 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ210469 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211405 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211449 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211623 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212082 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212093 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212392 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214636 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ217229 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ217605 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ217863 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218082 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ218760 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ219972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220057 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220332 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220676 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220975 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221057 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221066 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221079 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221125 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221205 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221312 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221325 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221335 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221375 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221450 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221581 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221634 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221754 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221769 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221835 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221893 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221920 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222066 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222119 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222124 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222159 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222163 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222324 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222370 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222552 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222574 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222575 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222601 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222685 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222697 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222714 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222747 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222803 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222840 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222893 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222917 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222979 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222986 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223007 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223012 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223069 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223131 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223204 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223283 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223454 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223460 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223519 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223527 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ223570 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ224051 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ224105 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ224302 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ224493 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ224808 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225464 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228360 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228480 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228486 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228559 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228608 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228692 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229006 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229014 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229055 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229061 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229229 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229387 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231306 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH619048.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X15040 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171533061355836425Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat
7394837Memor18Memory QTL 18exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)171864018263640182Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172308056759555013Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318457246843Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172459934069599340Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172702794956836890Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172702794960463643Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173136839162109574Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173583708569599340Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
631497Bp98Blood pressure QTL 983.66arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)174135465160463643Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)174207316069599340Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)174207316069599340Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
1354629Scl31Serum cholesterol level QTL 314.1blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)175089090860781592Rat
1354654Spl7Serum phospholipid level QTL 75.5blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)175089090860781592Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
2317053Aia25Adjuvant induced arthritis QTL 252.69joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)175090919660781426Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175349882882479847Rat
61466Niddm12Non-insulin dependent diabetes mellitus QTL 123.20.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)175402992960463637Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100911847 UniSTS
  29284 UniSTS
  362595 UniSTS
  364750 UniSTS
UniSTS 269989 UniSTS