GDB:434012 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: GDB:434012

Symbol: GDB:434012
Previously known as:
RGD ID: 5500394
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21617,690,829 - 17,690,976 (+)MAPPERmRatBN7.2
mRatBN7.21062,628,003 - 62,628,052 (-)MAPPERmRatBN7.2
mRatBN7.21062,628,049 - 62,628,128 (-)MAPPERmRatBN7.2
Rnor_6.01065,106,752 - 65,106,879NCBIRnor6.0
Rnor_6.01619,392,225 - 19,392,371NCBIRnor6.0
Rnor_5.01619,250,556 - 19,250,702UniSTSRnor5.0
Rnor_5.01066,519,401 - 66,519,528UniSTSRnor5.0
RGSC_v3.41618,115,329 - 18,115,475UniSTSRGSC3.4
Celera1617,905,466 - 17,905,612UniSTS
Cytogenetic Map16p14UniSTS
Is Marker For: Genes:   Tpm4   LOC100360724  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCCAAAGTGCTGTGATTAC
Reverse Primer GGAGGCTGAGGCAGGAGAAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3899Tpm4tropomyosin 4161768441517698456Rat
6502209Bola2-ps5bolA family member 2, pseudogene 5106262745862632944Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
631517Scl9Serum cholesterol level QTL 93.3blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)161572643321034895Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103539245763642539Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)104114263386142633Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103063205375632053Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1057576521102576521Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
70164Bw21Body weight QTL 214.360.00005body mass (VT:0001259)body weight (CMO:0000012)105379749498952626Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104133325886333258Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104444169989441699Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104502965095600334Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102845313673453136Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103539226764155584Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102929950464155584Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102694462871944628Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14232313287323132Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104232313287323132Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101960648364606483Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
1354608Cm33Cardiac mass QTL 332.8heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)105480929299809292Rat
1558643Cm44Cardiac mass QTL 444.80.0000368heart mass (VT:0007028)heart wet weight (CMO:0000069)106134527699703528Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103397392178973921Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
1331839Eae18bExperimental allergic encephalomyelitis QTL 18b5.80.03nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)106124830367785171Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103122402675632053Rat
6893336Cm75Cardiac mass QTL 750.10.87heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)106134527699703528Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)104287676679813922Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101960648364606483Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)104944455181709989Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101816784163167841Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104444169989441699Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
2306970Anxrr22Anxiety related response QTL 225.95fear/anxiety-related behavior trait (VT:1000241)number of periods of voluntary immobility (CMO:0001045)106134527698211570Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)105177294096772940Rat
2306787Ean3Experimental allergic neuritis QTL 33.1nervous system integrity trait (VT:0010566)body weight loss (CMO:0001399)105379738566979128Rat
2312672Insul15Insulin level QTL 150.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1057134272102134272Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)103756507982565079Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)103756507982565079Rat
631517Scl9Serum cholesterol level QTL 93.3blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)161572643321034895Rat
70363Bp71Blood pressure QTL 710.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)106134527681714865Rat
61402Niddm3Non-insulin dependent diabetes mellitus QTL 34.58blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)106134541382564856Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
70364Bp72Blood pressure QTL 72arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105112110096121100Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)105177461295600334Rat
631535Cm51Cardiac mass QTL 513heart mass (VT:0007028)calculated heart weight (CMO:0000073)105178628291669536Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104194452678307017Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)104944455181709989Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)104944455181709989Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104444169989441699Rat
631526Bp76Blood pressure QTL 760.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)106134541366743655Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104736947092369470Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312662Slep8Serum leptin concentration QTL 80.05blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1057134272102134272Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102652195798952741Rat
2312668Scl65Serum cholesterol level QTL 650.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1057134272102134272Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360724 UniSTS
  24852 UniSTS
UniSTS 157204 UniSTS