MARC_1767-1768:991931306:1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: MARC_1767-1768:991931306:1

Symbol: MARC_1767-1768:991931306:1
Previously known as:
RGD ID: 5499603
Expected Size: 237 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2189,563,263 - 89,563,500 (+)MAPPERmRatBN7.2
mRatBN7.21163,541,042 - 163,542,183 (+)MAPPERmRatBN7.2
Rnor_6.01174,134,088 - 174,135,228NCBIRnor6.0
Rnor_6.0193,242,254 - 93,242,490NCBIRnor6.0
Rnor_5.0194,354,654 - 94,354,890UniSTSRnor5.0
Rnor_5.01181,122,758 - 181,123,898UniSTSRnor5.0
RGSC_v3.41167,116,679 - 167,117,819UniSTSRGSC3.4
RGSC_v3.4189,339,683 - 89,339,919UniSTSRGSC3.4
Celera183,904,694 - 83,904,930UniSTS
Celera1161,442,693 - 161,443,833UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map1q33UniSTS
Is Marker For: Genes:   Rpl27a   Rpl27al3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCTGCCCAACTGTCAACCT
Reverse Primer CTACCAGGACACAGGCCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3083Mfge8milk fat globule EGF and factor V/VIII domain containing1133064665133080069Rat
71032Folr1folate receptor alpha1156219460156238436Rat
68948Bcat2branched chain amino acid transaminase 219604040796060008Rat
61811FcgrtFc gamma receptor and transporter19557443695584171Rat
61813Ftl1ferritin light chain 119593638795938234Rat
3627Clec11aC-type lectin domain containing 11A19480045694809002Rat
3859Thrspthyroid hormone responsive1151723415151727740Rat
619881Neu3neuraminidase 31154137732154148879Rat
62027Rps17ribosomal protein S171135295920135298506Rat
62035Cd37CD37 molecule19571917195724662Rat
2955Kcnc1potassium voltage-gated channel subfamily C member 119690295396944744Rat
71092Csrp3cysteine and glycine rich protein 319852806798546647Rat
71097Timm10btranslocase of inner mitochondrial membrane 10B1159980525159983371Rat
61804Map6microtubule-associated protein 61153568020153634415Rat
70074Trim3tripartite motif-containing 31159950921159973600Rat
2294Ccne1cyclin E119078194790791188Rat
62088P2ry2purinergic receptor P2Y21155352050155367423Rat
2156Arrb1arrestin, beta 11153837964153912111Rat
619888Rps3ribosomal protein S31153778363153783663Rat
61884Clns1achloride nucleotide-sensitive channel 1A1152019369152039670Rat
61859Gabra5gamma-aminobutyric acid type A receptor subunit alpha 51108268728108381670Rat
619895Dlg2discs large MAGUK scaffold protein 21144451653146503949Rat
69247Kcnj11potassium inwardly-rectifying channel, subfamily J, member 1119659104896594574Rat
2783Hbbhemoglobin subunit beta1158250421158251832Rat
70963Folh1folate hydrolase 11140428101140501563Rat
3207Nras-ps1neuroblastoma RAS viral (v-ras) oncogene homolog , pseudogene 11157404959157406216Rat
3214Ntrk3neurotrophic receptor tyrosine kinase 31132116472132503849Rat
3250Pak1p21 (RAC1) activated kinase 11152111172152226390Rat
3448Ptpn5protein tyrosine phosphatase, non-receptor type 519762063897681186Rat
3909Tsg101tumor susceptibility 10119741268997442589Rat
70943Mrpl17mitochondrial ribosomal protein L171160162181160163870Rat
2869Igf1rinsulin-like growth factor 1 receptor1121549831121838548Rat
69322Gucy2dguanylate cyclase 2D1152739775152774474Rat
2639Fut2fucosyltransferase 219611954996139567Rat
69305Nr2f2nuclear receptor subfamily 2, group F, member 21124008282124022521Rat
619744Pgap2post-GPI attachment to proteins 21156591540156618116Rat
3918TubTUB bipartite transcription factor1163008198163030958Rat
620042Il18bpinterleukin 18 binding protein1156372923156374963Rat
620054Ppfia3PTPRF interacting protein alpha 319581711095845950Rat
620057PolgDNA polymerase gamma, catalytic subunit1133382764133399578Rat
620063Ilkintegrin-linked kinase1160088839160095140Rat
69302Serpinh1serpin family H member 11153643500153650853Rat
3006Lhbluteinizing hormone subunit beta19589826995901973Rat
3786Abcc8ATP binding cassette subfamily C member 819659856896679563Rat
61906Nr1h2nuclear receptor subfamily 1, group H, member 219504196795047358Rat
619938Nup62nucleoporin 6219529899595314902Rat
62020Prmt1protein arginine methyltransferase 119545885395468176Rat
3888Klk1c2kallikrein 1-related peptidase C219449233294496480Rat
2969Klk1kallikrein 119464264494646760Rat
2651Gabrb3gamma-aminobutyric acid type A receptor subunit beta 31108467047108702522Rat
68396Inppl1inositol polyphosphate phosphatase-like 11156183043156197500Rat
62040Hpxhemopexin1159932819159940327Rat
3212Ntf4neurotrophin 419589356095896391Rat
3231Ompolfactory marker protein1152440278152440828Rat
69366Ldhclactate dehydrogenase C19738598497403382Rat
3895Tph1tryptophan hydroxylase 119715737597178415Rat
69360Sec11aSEC11 homolog A, signal peptidase complex subunit1134881448134909427Rat
628858Olr59olfactory receptor 591157193051157227707Rat
621026Rps11ribosomal protein S1119560569095607798Rat
620306Hbg1hemoglobin subunit gamma 11158271871158273426Rat
3175Klk1b3kallikrein 1-related peptidase B319470910594713308Rat
621169Syt9synaptotagmin 91161275882161456384Rat
619842Pex11aperoxisomal biogenesis factor 11 alpha1133680091133687172Rat
628819Trpc2transient receptor potential cation channel subfamily C member 21156460009156473039Rat
620030Nucb1nucleobindin 119596832595999183Rat
631429Myod1myogenic differentiation 119688486496887574Rat
632282Mrgprx3MAS related GPR family member X319772037797746953Rat
68358Acanaggrecan1132981582133044416Rat
61940Napsanapsin A aspartic peptidase19506472695077101Rat
621310Rhogras homolog family member G1156618713156630710Rat
68340Or6a2olfactory receptor family 6 subfamily A member 21160827258160828241Rat
621358Kcnc3potassium voltage-gated channel subfamily C member 319508096095095165Rat
2746Grm5glutamate metabotropic receptor 51141310069141884980Rat
628830Myo7amyosin VIIA1152342611152414171Rat
628897Selenosselenoprotein S1119659779119669546Rat
2740Grin2dglutamate ionotropic receptor NMDA type subunit 2D19630687196346994Rat
621223Slc28a1solute carrier family 28 member 11135079375135122791Rat
628834Art5ADP-ribosyltransferase 51156473362156483324Rat
621367Gab2GRB2-associated binding protein 21151429844151625708Rat
620705Homer2homer scaffold protein 21135558977135659780Rat
620398Cyth2cytohesin 219628318296291094Rat
620244Trpm4transient receptor potential cation channel, subfamily M, member 419578180595812095Rat
628755Cavin3caveolae associated protein 31159826549159828138Rat
628697Rpl13aribosomal protein L13A19560937495612557Rat
620101Slc17a7solute carrier family 17 member 719564970995661591Rat
2445Ctsccathepsin C1142028386142059841Rat
632284Mrgprx1MAS related GPR family member X119780609997807070Rat
621523Nkg7natural killer cell granule protein 719384474893845975Rat
620175Fgf21fibroblast growth factor 2119608336096084911Rat
61932Fahfumarylacetoacetate hydrolase1138548830138571599Rat
727784Tskstestis-specific serine kinase substrate19541431295441670Rat
628752Rab38RAB38, member RAS oncogene family1142182566142262923Rat
620133Cib1calcium and integrin binding 11134178331134183895Rat
620578Sh3gl3SH3 domain containing GRB2 like 3, endophilin A31136124500136255669Rat
621614Plekhb1pleckstrin homology domain containing B11154998798155013094Rat
3274Furinfurin (paired basic amino acid cleaving enzyme)1134348142134361182Rat
3419Klk6kallikrein related-peptidase 619427886394286136Rat
620531Slc17a6solute carrier family 17 member 61101212489101252543Rat
619716Sv2bsynaptic vesicle glycoprotein 2b1128978471129152479Rat
2348Chrna7cholinergic receptor nicotinic alpha 7 subunit1116711559116837269Rat
620998Nell1neural EGFL like 1199709305100573872Rat
2991Anpepalanyl aminopeptidase, membrane1133767332133810137Rat
2996Ldhalactate dehydrogenase A19737182397381247Rat
628872Kcnj14potassium inwardly-rectifying channel, subfamily J, member 1419629315996300810Rat
621094Emp3epithelial membrane protein 319638865196391946Rat
621482Lim2lens intrinsic membrane protein 219383759793843769Rat
621011Shank1SH3 and multiple ankyrin repeat domains 119480787994857356Rat
620269P2ry6pyrimidinergic receptor P2Y61155295110155330610Rat
727893Akap13A-kinase anchoring protein 131129313183129619647Rat
621054Picalmphosphatidylinositol binding clathrin assembly protein1144056415144138045Rat
1303192Klk1c12kallikrein 1-related peptidase C1219437810394382140Rat
621384Kcne3potassium voltage-gated channel subfamily E regulatory subunit 31154523903154530865Rat
621391Slco2b1solute carrier organic anion transporter family, member 2b11153959288154007294Rat
1303214Emc10ER membrane protein complex subunit 1019498026094988847Rat
1303220Klk1c6kallikrein 1-related peptidase C619446762694475842Rat
621526Ppp1r15aprotein phosphatase 1, regulatory subunit 15A19600005396003128Rat
621166Lmo1LIM domain only 11163132338163168521Rat
619844Cnga4cyclic nucleotide gated channel subunit alpha 41159752357159756369Rat
620329Dgat2diacylglycerol O-acyltransferase 21153454078153484432Rat
1304920Ubqln3ubiquilin 31158604629158607318Rat
1304812Fchsd2FCH and double SH3 domains 21155444471155685350Rat
2192BaxBCL2 associated X, apoptosis regulator19594000195945407Rat
1303242Klk10kallikrein related-peptidase 1019423453694239369Rat
1305167Fsd2fibronectin type III and SPRY domain containing 21135484002135522517Rat
621296Tpp1tripeptidyl peptidase 11160097984160104108Rat
620084Capn5calpain 51152416252152472923Rat
1304831Il4i1interleukin 4 induced 119529945795324564Rat
1303204Arfip2ADP-ribosylation factor interacting protein 21159974255159980398Rat
620845Apba2amyloid beta precursor protein binding family A member 21118053270118286858Rat
620730Lin7blin-7 homolog B, crumbs cell polarity complex component19584688895849628Rat
619778Nav2neuron navigator 219895762999322339Rat
69269SnurfSNRPN upstream open reading frame1111101327111123634Rat
727872Synmsynemin1121333712121363652Rat
3351Plin1perilipin 11133664294133676854Rat
619737Rab6aRAB6A, member RAS oncogene family1154957870155008922Rat
620600Nox4NADPH oxidase 41140900886141078844Rat
708406Vom2r40vomeronasal 2 receptor, 401139409429139457552Rat
620227Slco3a1solute carrier organic anion transporter family, member 3a11128106232128388043Rat
2491DbpD-box binding PAR bZIP transcription factor19617579696180745Rat
735133Plekha4pleckstrin homology domain containing A419600582496028826Rat
735078Lamtor1late endosomal/lysosomal adaptor, MAPK and MTOR activator 11156272116156277687Rat
727805Klk1c9kallikrein 1-related peptidase C919459735994601245Rat
2638Fut1fucosyltransferase 119608693496090352Rat
620965Pde2aphosphodiesterase 2A1155823590155915434Rat
1304591Art1ADP-ribosyltransferase 11156478096156487172Rat
621306Snrpnsmall nuclear ribonucleoprotein polypeptide N1111101327111123400Rat
621824Slc6a5solute carrier family 6 member 519964538999697016Rat
1306831Stim1stromal interaction molecule 11156656246156818777Rat
1306821Myh14myosin heavy chain 1419509626695158861Rat
2122Apbb1amyloid beta precursor protein binding family B member 11159896889159920505Rat
621463Wnt11Wnt family member 111153134503153154294Rat
621735Gabrg3gamma-aminobutyric acid type A receptor subunit gamma 31107627450108247483Rat
620268Abcc6ATP binding cassette subfamily C member 619644722496501464Rat
71033Nup98nucleoporin 98 and 96 precursor1156494423156591415Rat
3933Ucp3uncoupling protein 31154815777154828764Rat
621182Rpl18ribosomal protein L1819618881196191452Rat
620142Chrna10cholinergic receptor nicotinic alpha 10 subunit1156487279156494277Rat
1304579Trim5tripartite motif-containing 51158720407158737393Rat
1303329Ush1cUSH1 protein network component harmonin19669530396743671Rat
1303331Pnkppolynucleotide kinase 3'-phosphatase19534146595346921Rat
1303312Etfbelectron transfer flavoprotein subunit beta19385190893866072Rat
1304658Tenm4teneurin transmembrane protein 41149895097151263315Rat
735125Pde8aphosphodiesterase 8A1135166143135288986Rat
628763Aqp11aquaporin 111152046515152056675Rat
621323Phox2apaired-like homeobox 2a1156178754156183118Rat
621839Pold1DNA polymerase delta 1, catalytic subunit19502546295041559Rat
1305013Tmem143transmembrane protein 14319637193496387991Rat
735032Klk1c3kallikrein 1-related peptidase C319467163694675417Rat
1305145Nars2asparaginyl-tRNA synthetase 2, mitochondrial1151300446151412086Rat
1305154Asb7ankyrin repeat and SOCS box-containing 71120222835120267411Rat
1307511Ndufc2NADH:ubiquinone oxidoreductase subunit C21151711965151718188Rat
1305084Zfp473zinc finger protein 47319522268395243328Rat
1305211Lipt2lipoyl(octanoyl) transferase 21154504563154506890Rat
71017Fzd4frizzled class receptor 41143279934143288799Rat
1305115Hbe1hemoglobin subunit epsilon 11158282931158458855Rat
1306764Kdelr1KDEL endoplasmic reticulum protein retention receptor 119634725896358145Rat
1306766Ccdc81coiled-coil domain containing 811143739472143791026Rat
708405Scaf1SR-related CTD-associated factor 119548544895499389Rat
727864Hrchistidine rich calcium binding protein19581326295816987Rat
621843St8sia2ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 21127762573127838017Rat
1308541TicrrTOPBP1-interacting checkpoint and replication regulator1133597618133639513Rat
1306361Ube3aubiquitin protein ligase E3A1110070260110161675Rat
1306610Otogotogelin19674633696815416Rat
1306051Nipa2NIPA magnesium transporter 21106799979106824206Rat
1306407Isg20interferon stimulated exonuclease gene 201132829303132837027Rat
620644Vps33bVPS33B, late endosome and lysosome associated1134223967134247232Rat
3521Art2bADP-ribosyltransferase 2b1155956601155974252Rat
1305468Alg8ALG8, alpha-1,3-glucosyltransferase1151684344151704310Rat
620413Prmt3protein arginine methyltransferase 319949271299581774Rat
1305713C1h15orf40similar to human chromosome 15 open reading frame 401135725869135732028Rat
1306420Klk7kallikrein-related peptidase 719426717094271361Rat
1306429Wdr73WD repeat domain 731134860329134868475Rat
1306430Kctd14potassium channel tetramerization domain containing 141151761688151766693Rat
1305137Med25mediator complex subunit 2519535996195375827Rat
1309941Htatip2HIV-1 Tat interactive protein 219947341199488632Rat
1307978Tm6sf1transmembrane 6 superfamily member 11135799844135828515Rat
1306548Stard10StAR-related lipid transfer domain containing 101155722637155748007Rat
1305051Aenapoptosis enhancing nuclease1132815094132824522Rat
1305749Tmem86atransmembrane protein 86A19759591097600260Rat
1307441Siglec10sialic acid binding Ig-like lectin 1019381730193826376Rat
1307361Bcl2l12Bcl2 like 1219547227295480991Rat
628902Atf5activating transcription factor 519529560295299755Rat
738043Mrgprb4MAS-related GPR, member B419785270497853675Rat
738048Mrgprx2MAS related GPR family member X219811619298135534Rat
738051Mrgprb13MAS-related GPR, member B1319804101398041999Rat
738052Mrgprb5MAS-related G protein-coupled receptor, member B519795919397960254Rat
738053Mrgprx2lMAS-related G protein-coupled receptor, member X2-like19818544198186385Rat
2290Cckbrcholecystokinin B receptor1159771733159781738Rat
735150P4ha3prolyl 4-hydroxylase subunit alpha 31154628723154663779Rat
1307387Nlrp10NLR family, pyrin domain containing 101162922806162930363Rat
1310608Fuzfuzzy planar cell polarity protein19537954295384532Rat
1308515Folr2folate receptor beta1156200044156218380Rat
1307366C2cd3C2 domain containing 3 centriole elongation regulator1154715151154812955Rat
1307371Saa4serum amyloid A419724758097251882Rat
1305335Ccdc89coiled-coil domain containing 891144386252144387514Rat
1310022RamacRNA guanine-7 methyltransferase activating subunit1135708529135714417Rat
1308000Lrrk1leucine-rich repeat kinase 11119844360119972885Rat
1305907Taf10TATA-box binding protein associated factor 101160095108160096401Rat
1307737Syngr4synaptogyrin 419635867996371840Rat
1307202Ubqlnlubiquilin-like1158615177158617426Rat
1305384Cpt1ccarnitine palmitoyltransferase 1c19544281495457347Rat
1309507Rab30RAB30, member RAS oncogene family1146803719146898369Rat
1307576Mrpl48mitochondrial ribosomal protein L481154896663154939285Rat
1305344Iglon5IgLON family member 519388090693898929Rat
1307209Lrrc28leucine rich repeat containing 281121116833121245805Rat
1305254Cemipcell migration inducing hyaluronidase 11137906921138062430Rat
1305155Adamtsl3ADAMTS-like 31136288793136596986Rat
1305998Klk8kallikrein related-peptidase 819425180394258646Rat
1304689Tubgcp5tubulin gamma complex component 51106636526106672175Rat
1306112Eif3feukaryotic translation initiation factor 3, subunit F1162934220162943204Rat
1307757Sphk2sphingosine kinase 219618087296188592Rat
1307120Snrnp70small nuclear ribonucleoprotein U1 subunit 7019585603895876434Rat
1307121Lrrc4bleucine rich repeat containing 4B19492203494956309Rat
3246Pcsk6proprotein convertase subtilisin/kexin type 61119428978119627626Rat
1306305Tjp1tight junction protein 11118849838119094492Rat
1305036Ints4integrator complex subunit 41151790062151853827Rat
1305381ReltRELT, TNF receptor1155206976155224609Rat
1333909Or10a4olfactory receptor family 10 subfamily A member 41160957099160958046Rat
1332767Or51i2olfactory receptor family 51 subfamily I member 21158513673158514611Rat
1332768Or14a257olfactory receptor family 14 subfamily A member 2571140276678140277619Rat
1332769Or5p76olfactory receptor family 5 subfamily P member 761162617193162618137Rat
1332773Or51f2olfactory receptor family 51 subfamily F member 21157292342157293292Rat
1332776Or52l1olfactory receptor family 52 subfamily L member 11159582521159583471Rat
1332780Or52e4olfactory receptor family 52 subfamily E member 41159454581159455519Rat
1333934Or52j3olfactory receptor family 52 subfamily J member 31157605177157606115Rat
1333949Or2ag17b-ps1olfactory receptor family 2 subfamily AG member 17B, pseudogene 11160491806160492754Rat
1333371Or51b6olfactory receptor family 51 subfamily B member 61158347649158348596Rat
1308637Ccdc90bcoiled-coil domain containing 90B1146632756146646314Rat
1333636Or2ag18olfactory receptor family 2 subfamily AG member 181160512174160513124Rat
1333639Or5p60colfactory receptor family 5 subfamily P member 60C1162080213162081184Rat
1333647Or14a258olfactory receptor family 14 subfamily A member 2581139960934139961884Rat
1333421Or5p5bolfactory receptor family 5 subfamily P member 5B1161735695161736633Rat
1333424Or52s19olfactory receptor family 52 subfamily S member 191157742232157743176Rat
1333293Or52k1olfactory receptor family 52 subfamily K member 11157037381157038325Rat
1311983Rgmarepulsive guidance molecule BMP co-receptor a1127128934127172918Rat
1333500Or2d2olfactory receptor family 2 subfamily D member 21160979415160980362Rat
1333505Or55b3olfactory receptor family 55 subfamily B member 31156859322156860519Rat
1308098Hapln3hyaluronan and proteoglycan link protein 31133046465133064665Rat
1310526Ndnnecdin, MAGE family member1115849168115850767Rat
1308421Cyb5r2cytochrome b5 reductase 21161655862161664359Rat
1333218Or51f23colfactory receptor family 51 subfamily F member 23C1157231467157232417Rat
1308950Ap3b2adaptor related protein complex 3 subunit beta 21135412580135445191Rat
1332789Or56a5olfactory receptor family 56 subfamily A member 51159500672159501610Rat
1332928Or5p72olfactory receptor family 5 subfamily P member 721162293541162294485Rat
1332929Or14a260olfactory receptor family 14 subfamily A member 2601139918531139919472Rat
1332931Or51k1olfactory receptor family 51 subfamily K member 11158486849158487799Rat
1310399Ttll13tubulin tyrosine ligase like 131134197801134213083Rat
1310401Siglechsialic acid binding Ig-like lectin H1106593721106604191Rat
1332840Or5p61-ps1olfactory receptor family 5 subfamily P member 61, pseudogene 11162179357162180300Rat
1332841Or52e7olfactory receptor family 52 subfamily E member 71159422789159423742Rat
1332846Or2ag2olfactory receptor family 2 subfamily AG member 21160695621160696571Rat
1333336Or5p50olfactory receptor family 5 subfamily P member 501161742688161743632Rat
1333387Or14a257colfactory receptor family 14 subfamily A member 257C1140365515140366522Rat
1332659Or52ae8bolfactory receptor family 52 subfamily AE member 8B1158097260158098213Rat
1332664Or14c43olfactory receptor family 14 subfamily C member 431140171652140172647Rat
1309649Rlbp1retinaldehyde binding protein 11133308920133322296Rat
1333377Or51a25bolfactory receptor family 51 subfamily A member 25B1157170104157171066Rat
1333379Or51a42olfactory receptor family 51 subfamily A member 421158542552158543496Rat
1333958Or5p52olfactory receptor family 5 subfamily P member 521161782220161785357Rat
1333514Or51r1olfactory receptor family 51 subfamily R member 11156998692156999642Rat
1333522Or6b9olfactory receptor family 6 subfamily B member 91160795402160831530Rat
1309316Fam83efamily with sequence similarity 83, member E19619158196201182Rat
1333201Or52n4olfactory receptor family 52 subfamily N member 41158919013158919978Rat
1333202Or52b6-ps1olfactory receptor family 52 subfamily B member 6, pseudogene 11158675191158676157Rat
1333207Or52e3olfactory receptor family 52 subfamily E member 31157626717157627652Rat
1333441Or5p66olfactory receptor family 5 subfamily P member 661162235096162236037Rat
1359365Rcn3reticulocalbin 319556450395573762Rat
1333901Or5p78colfactory receptor family 5 subfamily P member 78C1162420650162421594Rat
1333130Or52x1b-ps1olfactory receptor family 52 subfamily X member 1B, pseudogene 11159554499159555417Rat
1333141Or52a5olfactory receptor family 52 subfamily A member 51158182988158183935Rat
1333180Or14e1-ps1olfactory receptor family 14 subfamily E member 1, pseudogene 11140262826140263202Rat
1333161Or51s1olfactory receptor family 51 subfamily S member 11157315393157316319Rat
1333090Or5p56b-ps1olfactory receptor family 5 subfamily P member 56B, pseudogene 11161871812161872744Rat
1333316Or52z12olfactory receptor family 52 subfamily Z member 121157933667157934632Rat
1334002Or10a2olfactory receptor family 10 subfamily A member 21160948001160948954Rat
1332630Or51l4olfactory receptor family 51 subfamily L member 41158146732158147691Rat
1334160Or2d2bolfactory receptor family 2 subfamily D member 2B1160964638160965585Rat
1334165Or5p53olfactory receptor family 5 subfamily P member 531161813580161814512Rat
1334168Or5p68olfactory receptor family 5 subfamily P member 681162283866162284822Rat
1334171Or10a3colfactory receptor family 10 subfamily A member 3C1162870107162871051Rat
1309771Rpl27aribosomal protein L27A1163539732163542771Rat
1309782Eedembryonic ectoderm development1143867875143895008Rat
1333263Or52e18olfactory receptor family 52 subfamily E member 181159307874159308812Rat
1309878Dchs1dachsous cadherin-related 11160104931160138958Rat
1333167Or52n4colfactory receptor family 52 subfamily N member 4C1158972002158972967Rat
1333174Or5p1olfactory receptor family 5 subfamily P member 11162267801162268733Rat
1333176Or52s1bolfactory receptor family 52 subfamily S member 1B1157587391157589170Rat
1332638Or52n2eolfactory receptor family 52 subfamily N member 2E1159256560159257516Rat
1332641Or51g2olfactory receptor family 51 subfamily G member 21157421637157422575Rat
1332645Or5p56olfactory receptor family 5 subfamily P member 561161842163161843095Rat
1332675Or5p76bolfactory receptor family 5 subfamily P member 76B1162591358162592302Rat
1333584Or13g1olfactory receptor family 13 subfamily G member 11139864790139865713Rat
1333589Or52z15-ps1olfactory receptor family 52 subfamily Z member 15, pseudogene 11158058298158059264Rat
1332950Or5p78olfactory receptor family 5 subfamily P member 781162473821162474765Rat
1311666Tlnrd1talin rod domain containing 11137864340137866359Rat
1311904Chsy1chondroitin sulfate synthase 11119689626119750711Rat
1334236Or52d1b-ps1olfactory receptor family 52 subfamily D member 1B, pseudogene 11158565007158565881Rat
1334238Or52z14olfactory receptor family 52 subfamily Z member 141157970990157971952Rat
1334239Or14a261-ps1olfactory receptor family 14 subfamily A member 261, pseudogene 11140385246140385832Rat
1334240Or14c43b-ps1olfactory receptor family 14 subfamily C member 43B, pseudogene 11140139131140140070Rat
1333770Or52e15bolfactory receptor family 52 subfamily E member 15B1159391482159392420Rat
1333771Or52h9olfactory receptor family 52 subfamily H member 91158826164158827105Rat
1309736Zdhhc13zinc finger DHHC-type palmitoyltransferase 1319848731998525906Rat
1333953Or51a10olfactory receptor family 51 subfamily A member 101158520743158521687Rat
1333955Or52e8bolfactory receptor family 52 subfamily E member 8B1159412927159413880Rat
1333956Or52ab2olfactory receptor family 52 subfamily AB member 21157681873157682820Rat
1332687Or56a3bolfactory receptor family 56 subfamily A member 3B1159476168159477115Rat
1332781Or5p6olfactory receptor family 5 subfamily P member 61161900087161901031Rat
1333155Or51f23-ps1olfactory receptor family 51 subfamily F member 23, pseudogene 11157243704157244405Rat
1333156Or10a49olfactory receptor family 10 subfamily A member 491162843548162844492Rat
1333157Or52e15colfactory receptor family 52 subfamily E member 15C1159401875159402816Rat
1333158Or52s1olfactory receptor family 52 subfamily S member 11157619852157620835Rat
1333752Or10a3olfactory receptor family 10 subfamily A member 31162856896162857876Rat
1333753Or51a5b-ps1olfactory receptor family 51 subfamily A member 5B, pseudogene 11157461693157462619Rat
1333757Or56b2olfactory receptor family 56 subfamily B member 21158943205158944164Rat
1333763Or14c39olfactory receptor family 14 subfamily C member 391140414652140415590Rat
1333691Or2ag2bolfactory receptor family 2 subfamily AG member 2B1160565659160566609Rat
1310421Cpeb1cytoplasmic polyadenylation element binding protein 11135300048135407688Rat
1311253Spcs2signal peptidase complex subunit 21154163724154183152Rat
1334008Or5p4olfactory receptor family 5 subfamily P member 41161949772161950710Rat
1334009Or52m2olfactory receptor family 52 subfamily M member 21157048003157048962Rat
1334173Or13n4olfactory receptor family 13 subfamily N member 41160570018160570944Rat
1334174Or52n2d-ps1olfactory receptor family 52 subfamily N member 2D, pseudogene 11159219730159220348Rat
1334175Or51a24-ps1olfactory receptor family 51 subfamily A member 24, pseudogene 11158552371158553319Rat
1334048Or56b6bolfactory receptor family 56 subfamily B member 6B1159657311159658276Rat
1334054Or14a257bolfactory receptor family 14 subfamily A member 257B1140313700140314707Rat
1332618Or52e7b-ps1olfactory receptor family 52 subfamily E member 7B, pseudogene 11159437067159438014Rat
1333997Or51af1olfactory receptor family 51 subfamily AF member 11157864549157865508Rat
1333998Or6aa1olfactory receptor family 6 subfamily A member A11139968839139969795Rat
1334024Or52e55-ps1olfactory receptor family 52 subfamily E member 55, pseudogene 11159396920159397344Rat
1334028Or2d3olfactory receptor family 2 subfamily D member 31160701351160702274Rat
1310712EmsyEMSY transcriptional repressor, BRCA2 interacting1152881485152960420Rat
1310717Olfm5olfactomedin 51158620451158628289Rat
1303228Klk4kallikrein-related peptidase 419434419594349425Rat
1310995Klk15kallikrein-related peptidase 1519469942294706626Rat
1333707Or51ac3olfactory receptor family 51 subfamily AC member 31157921167157922120Rat
1333708Or51f23b-ps1olfactory receptor family 51 subfamily F member 23B, pseudogene 11157204792157205735Rat
1311142Garin5agolgi associated RAB2 interactor 5A19498895994995971Rat
1310332Cyfip1cytoplasmic FMR1 interacting protein 11106710924106799393Rat
1333621Or2d36olfactory receptor family 2 subfamily D member 361161028174161029118Rat
1311884Iqgap1IQ motif containing GTPase activating protein 11134679581134769776Rat
1310344Mesdmesoderm development LRP chaperone1137866707137879999Rat
1333320Or52d3olfactory receptor family 52 subfamily D member 31158849336158850289Rat
1333325Olr36olfactory receptor 361154052762154053742Rat
1310926B3gnt6UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 61152484572152496226Rat
1309087Lrrc32leucine rich repeat containing 321152785709152802997Rat
1308371Tmem126btransmembrane protein 126B1144437142144451508Rat
1333117Or51af1b-ps1olfactory receptor family 51 subfamily AF member 1B, pseudogene 11157804670157805625Rat
1332591Or14e2-ps1olfactory receptor family 14 subfamily E member 2, pseudogene 11140358793140359187Rat
1332595Or51m1-ps1olfactory receptor family 51 subfamily M member 1, pseudogene 11158367523158368480Rat
1332598Or10a5olfactory receptor family 10 subfamily A member 51160863556160864509Rat
1332599Or52n2bolfactory receptor family 52 subfamily N member 2B1159248753159249718Rat
628662Aldh1a3aldehyde dehydrogenase 1 family, member A31119982272120017416Rat
1310815Klhl25kelch-like family member 251129724894129750142Rat
1310789Ankrd42ankyrin repeat domain 421146648080146691086Rat
1333223Or52s6olfactory receptor family 52 subfamily S member 61157756757157757701Rat
1333227Or56b6olfactory receptor family 56 subfamily B member 61159619288159620253Rat
1333228Or51f4olfactory receptor family 51 subfamily F member 41157257231157258175Rat
1333229Or52b1olfactory receptor family 52 subfamily B member 11159684419159685363Rat
1312049Akt1s1AKT1 substrate 119533318695339678Rat
1309036C1h19orf81simlar to human chromosome 19 open reading frame 8119485730194871323Rat
1359360Mef2amyocyte enhancer factor 2a1120847874120982488Rat
1333874Or52ae10olfactory receptor family 52 subfamily AE member 101157824326157825276Rat
1332833Or51e1olfactory receptor family 51 subfamily E member 11157142232157151114Rat
1332813Or5p69bolfactory receptor family 5 subfamily P member 69B1162396498162397442Rat
1311751Mesp1mesoderm posterior bHLH transcription factor 11133738357133739875Rat
1311754Prc1protein regulator of cytokinesis 11134250086134271765Rat
1333278Or8af1-ps1olfactory receptor family 8 subfamily AF member 1, pseudogene 11162273789162274537Rat
1333281Or6aa1bolfactory receptor family 6 subfamily A member A1B1140016536140017495Rat
1333605Or5p81olfactory receptor family 5 subfamily P member 811162544353162545297Rat
1332760Or52e5olfactory receptor family 52 subfamily E member 51159429383159430324Rat
1333390Or52e5bolfactory receptor family 52 subfamily E member 5B1159461887159462828Rat
1333394Or51b17olfactory receptor family 51 subfamily B member 171158327466158328389Rat
1311634Anapc15anaphase promoting complex subunit 151156238640156266005Rat
1333356Or55b4olfactory receptor family 55 subfamily B member 41156866390156867379Rat
1310409Ttc23tetratricopeptide repeat domain 231121245996121329500Rat
1549774Irf3interferon regulatory factor 319547996695484926Rat
1333416Or51v14olfactory receptor family 51 subfamily V member 141157980431157981372Rat
1309632Kcna7potassium voltage-gated channel subfamily A member 719588607395891565Rat
1305677Tmem126atransmembrane protein 126A1144424481144430730Rat
1306509Ruvbl2RuvB-like AAA ATPase 219590201495915247Rat
1310896Trim6tripartite motif containing 61158683746158696936Rat
1332882Or2ag1olfactory receptor family 2 subfamily AG member 11160683723160684673Rat
1332887Olr193olfactory receptor 1931159514613159515554Rat
1332889Or51f1folfactory receptor family 51 subfamily F member 1F1157479786157484201Rat
1309901Rccd1RCC1 domain containing 11134271870134281556Rat
1306521Efl1elongation factor like GTPase 11136638527136763518Rat
1309890Arhgef17Rho guanine nucleotide exchange factor 171155230607155290163Rat
1309793Det1DET1 partner of COP1 E3 ubiquitin ligase1132749736132765963Rat
1308606Klk14kallikrein related-peptidase 1419412313194137239Rat
1305444Prrg2proline rich and Gla domain 219553427695543364Rat
1309966Mceemethylmalonyl CoA epimerase1117964576117987779Rat
1308280Klk9kallikrein related-peptidase 919424633994250631Rat
1305240Nomo1Nodal modulator 119650546096556280Rat
1307633Mphosph10M-phase phosphoprotein 101117948134117964149Rat
1333961Or52ad1olfactory receptor family 52 subfamily AD member 11157733568157734512Rat
1333965Or51a6-ps1olfactory receptor family 51 subfamily A member 6, pseudogene 11157376150157377038Rat
1333966Or51a5-ps1olfactory receptor family 51 subfamily A member 5, pseudogene 11157495818157496386Rat
1333967Or14c44b-ps1olfactory receptor family 14 subfamily C member 44B, pseudogene 11139937745139938682Rat
1333972Or52d1olfactory receptor family 52 subfamily D member 11158578401158579372Rat
1333974Or52n3olfactory receptor family 52 subfamily N member 31159196782159197732Rat
1333977Or5p79olfactory receptor family 5 subfamily P member 791162479829162480773Rat
1307872Sema4bsemaphorin 4B1134136646134177777Rat
1305795Trim21tripartite motif-containing 211156964896156987504Rat
1308225Gtf2h1general transcription factor IIH subunit 119732141797349455Rat
1308896Dbx1developing brain homeobox 119934863899354173Rat
1308302Rrp8ribosomal RNA processing 81160081092160088709Rat
1311308Tars3threonyl-tRNA synthetase 31119213189119265492Rat
1306235Vstm2bV-set and transmembrane domain containing 2B19259207092620491Rat
1309992Nosipnitric oxide synthase interacting protein19554332995559101Rat
1333560Or52z13olfactory receptor family 52 subfamily Z member 131157958861157959808Rat
1308975Klk12kallikrein related-peptidase 1219422277894227637Rat
1309206Nsmce3NSE3 homolog, SMC5-SMC6 complex component1118401302118402629Rat
1308690Klk11kallikrein related-peptidase 1119422874194233281Rat
1305955Pop4POP4 homolog, ribonuclease P/MRP subunit19096002690968360Rat
1305958Mtmr10myotubularin related protein 101117859355117910839Rat
1305959Mesp2mesoderm posterior bHLH transcription factor 21133756601133759207Rat
1310962Btbd1BTB domain containing 11135734549135773067Rat
1310111Aspdhaspartate dehydrogenase domain containing19495632794960722Rat
1307989Herc2HECT and RLD domain containing E3 ubiquitin protein ligase 21106904789107110997Rat
1307842Prcpprolylcarboxypeptidase1146931487146983891Rat
1308141Odad1outer dynein arm docking complex subunit 119639213296420926Rat
1333983Or52d13olfactory receptor family 52 subfamily D member 131157778486157782381Rat
727859RhcgRh family, C glycoprotein1133531704133555902Rat
1307305Josd2Josephin domain containing 219496086794964751Rat
1306254Ap2a1adaptor related protein complex 2 subunit alpha 119538430695414170Rat
1308929Fam168afamily with sequence similarity 168, member A1155057352155203439Rat
1308740Ctu1cytosolic thiouridylase subunit 119411543194121224Rat
1306491Zfp710zinc finger protein 7101133966256134036593Rat
1308091E2f8E2F transcription factor 819856571798584265Rat
1309860Alpk3alpha-kinase 31135014455135062294Rat
1310649Grwd1glutamate-rich WD repeat containing 119630126096306962Rat
1308705Zfp592zinc finger protein 5921134951286135002443Rat
1306977Ptov1PTOV1, extended AT-hook containing adaptor protein19534706595354514Rat
1306790Mex3bmex-3 RNA binding family member B1136855130136859365Rat
1305432Siglec5sialic acid binding Ig-like lectin 519376819093776696Rat
1309326Fv1Friend virus susceptibility 119473083994736791Rat
1309042Bnc1basonuclin zinc finger protein 11135917676135943333Rat
1309679Thap12THAP domain containing 121153003605153019386Rat
1309683Ppme1protein phosphatase methylesterase 11154668099154715079Rat
1309686Tbc1d17TBC1 domain family, member 1719532477095333156Rat
1310238Man2a2mannosidase, alpha, class 2A, member 21134304714134327611Rat
1307857Rnf121ring finger protein 1211156377368156439936Rat
1309337Klk13kallikrein related-peptidase 1319416538194177002Rat
1310310Kif7kinesin family member 71133639487133658539Rat
1306179Chrdl2chordin-like 21154343201154370651Rat
1310358Uri1URI1, prefoldin-like chaperone19064639290704811Rat
1308792Lins1lines homolog 11120267586120295013Rat
1308270Acp4acid phosphatase 419473637694751871Rat
1308777Numa1nuclear mitotic apparatus protein 11156297907156372855Rat
1308783Adamts17ADAM metallopeptidase with thrombospondin type 1 motif, 171120445800120768204Rat
1305401Nipa1NIPA magnesium transporter 11106834000106875148Rat
1308210Abhd17cabhydrolase domain containing 17C, depalmitoylase1138084632138125595Rat
1307647Sytl2synaptotagmin-like 21144272870144379310Rat
1307664Peg12paternally expressed 121115962511115965114Rat
1305291Rasip1Ras interacting protein 119609713596109564Rat
1333443Or2d4olfactory receptor family 2 subfamily D member 41160777353160778285Rat
1333444Or52h2olfactory receptor family 52 subfamily H member 21158659293158660225Rat
1332678Olr216-psolfactory receptor pseudogene 2161160669331160670304Rat
1309564Zfp819zinc finger protein 81919402734794048767Rat
1311389Abhd2abhydrolase domain containing 2, acylglycerol lipase1133217403133298564Rat
1311400Atg16l2autophagy related 16-like 21155687386155703419Rat
1332815Or52r1colfactory receptor family 52 subfamily R member 1C1157475119157476063Rat
1332817Or14c48-ps1olfactory receptor family 14 subfamily C member 48, pseudogene 11140107028140108065Rat
1332871Or52n4eolfactory receptor family 52 subfamily N member 4E1159042896159043864Rat
1310544Plekhf1pleckstrin homology and FYVE domain containing 119090830490915862Rat
1310551Tulp2TUB like protein 219596249695999775Rat
1308063Tmc3transmembrane channel-like 31137552347137597477Rat
1332712Or5m12-ps1olfactory receptor family 5 subfamily M member 12, pseudogene 11123124617123125228Rat
1333428Olr35olfactory receptor 351153994678154043281Rat
1333432Or51af1c-ps1olfactory receptor family 51 subfamily AF member 1C, pseudogene 11157832733157833688Rat
1333435Or52ae7olfactory receptor family 52 subfamily AE member 71157853355157854305Rat
1332852Or51v17-ps1olfactory receptor family 51 subfamily V member 17, pseudogene 11158033824158034857Rat
1311763Arrdc4arrestin domain containing 41122369355122383351Rat
1333835Or52x1olfactory receptor family 52 subfamily X member 11159601106159602059Rat
1333841Or52n4dolfactory receptor family 52 subfamily N member 4D1159108148159109107Rat
1308882Sult2b1sulfotransferase family 2B member 119620015596261295Rat
1308736Hmgn5bhigh mobility group nucleosome binding domain 5B1117222188117224158Rat
1308274Gvinp1GTPase, very large interferon inducible 11160195394160203003Rat
1308810BlmBLM RecQ like helicase1134409832134496073Rat
1305357Unc45aunc-45 myosin chaperone A1134281930134296661Rat
1305359Klk1c8kallikrein 1-related peptidase C819454777494552287Rat
1309948Tmem135transmembrane protein 1351143006343143279824Rat
1309896Prr12proline rich 1219551001595534002Rat
1309666Crtc3CREB regulated transcription coactivator 31134552830134655929Rat
1332718Olr220olfactory receptor 2201160730837160731760Rat
1306150Atp10aATPase phospholipid transporting 10A (putative)1109556760109730440Rat
1305502Xrra1X-ray radiation resistance associated 11154183330154247883Rat
1310056Chd2chromodomain helicase DNA binding protein 21127188146127317041Rat
1333240Or51a25olfactory receptor family 51 subfamily A member 251157179120157180082Rat
1333255Or5p66bolfactory receptor family 5 subfamily P member 66B1162053881162054825Rat
1333257Olr134-psolfactory receptor pseudogene 1341158382033158382413Rat
1333576Or52ab4olfactory receptor family 52 subfamily AB member 41157725793157726740Rat
1310371Cfap161cilia and flagella associated protein 1611137743783137768685Rat
1310385Arap1ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 11155748622155814186Rat
1563363Zfp536zinc finger protein 53619000035990463423Rat
1564524Hbe2hemoglobin, epsilon 21158279285158280913Rat
1563905Rpl19-ps23ribosomal protein L19, pseudogene 2319516357095164284Rat
1559862Wdr93WD repeat domain 931133687254133737449Rat
1561403Klk1c10kallikrein 1-related peptidase C1019440299394407052Rat
1334421Or51a39olfactory receptor family 51 subfamily A member 391157152386157153348Rat
1334424Or52a20olfactory receptor family 52 subfamily A member 201158108489158109439Rat
1333715Or52h1olfactory receptor family 52 subfamily H member 11158644763158645713Rat
1563497Sergefsecretion regulating guanine nucleotide exchange factor19694966097152529Rat
1566271Rpl7-ps20ribosomal protein L7, pseudogene 201137123201137130636Rat
1564385FesFES proto-oncogene, tyrosine kinase1134337698134346934Rat
1560280Agbl1AGBL carboxypeptidase 11130043914130950739Rat
1561459Aamdcadipogenesis associated, Mth938 domain containing1151861990151893621Rat
1563721Otud7aOTU deubiquitinase 7A1117064428117388217Rat
1334348Or2ag16olfactory receptor family 2 subfamily AG member 161160417660160418607Rat
1563397Pcf11PCF11 cleavage and polyadenylation factor subunit1146694045146724030Rat
1563970Trim30dtripartite motif-containing 30D1158795288158813913Rat
1564982Vsig10lV-set and immunoglobulin domain containing 10 like19387148793880157Rat
1334354Or51q1dolfactory receptor family 51 subfamily Q member 1D1158426462158427427Rat
1561509Lrtomtleucine rich transmembrane and O-methyltransferase domain containing1156266655156268704Rat
1565899SpibSpi-B transcription factor19501893995024804Rat
1562433Ubqln5ubiquilin 51158592368158594244Rat
1565856Lrrc51leucine rich repeat containing 511156278617156297838Rat
1563539Ceacam18CEA cell adhesion molecule 1819407103994085649Rat
1562710Nmbneuromedin B1134869446134875507Rat
1311245Rsf1remodeling and spacing factor 11151892055152015089Rat
1311916Hps5HPS5, biogenesis of lysosomal organelles complex 2 subunit 219728162697320945Rat
1562967Mctp2multiple C2 and transmembrane domain containing 21125769932126002886Rat
1563167Gas2growth arrest-specific 21101452361101582619Rat
1334324Or51a45-ps1olfactory receptor family 51 subfamily A member 45, pseudogene 11157446294157447224Rat
1334362Or5p6bolfactory receptor family 5 subfamily P member 6B1161968555161969499Rat
1334364Or52e8olfactory receptor family 52 subfamily E member 81159360430159361380Rat
1564265Ano5anoctamin 51101086490101187547Rat
1565669Vom2r38vomeronasal 2 receptor, 3819335855093420097Rat
1564636Ovch2ovochymase 21161693619161713952Rat
1562400Or5p58olfactory receptor family 5 subfamily P member 581162007132162008103Rat
1562402Rpl27al3ribosomal protein L27A like 318956303489563540Rat
1565730Cdv3l1carnitine deficiency-associated gene expressed in ventricle 3 like 11161678311161681564Rat
1561783Stard5StAR-related lipid transfer domain containing 51137606151137616017Rat
1561034C1h11orf42similar to human chromosome 11 open reading frame 421159722255159725863Rat
1549719Smpd1sphingomyelin phosphodiesterase 11159892946159896789Rat
15618854930433I11RiklRIKEN cDNA 4930433I11 gene like19267146192678000Rat
1311021Arpinactin-related protein 2/3 complex inhibitor1133864288133873124Rat
1334153Or56b6colfactory receptor family 56 subfamily B member 6C1159635655159636605Rat
1334156Or5p80-ps1olfactory receptor family 5 subfamily P member 80, pseudogene 11162488901162490033Rat
1333806Or51a7bolfactory receptor family 51 subfamily A member 7B1157415212157416180Rat
1333809Or14c40olfactory receptor family 14 subfamily C member 401140234383140235375Rat
1332721Or52j3bolfactory receptor family 52 subfamily J member 3B1157572005157572943Rat
1559673Gdpd5glycerophosphodiester phosphodiesterase domain containing 51153679718153761452Rat
1334107Olr238-psolfactory receptor pseudogene 2381161751470161752093Rat
1561870Rpl27l2ribosomal protein L27 like 21153154498153154902Rat
1334304Or5p75-ps1olfactory receptor family 5 subfamily P member 75, pseudogene 11162438130162439074Rat
1334316Or52ae8olfactory receptor family 52 subfamily AE member 81158002968158003921Rat
1359311Tskutsukushi, small leucine rich proteoglycan1152660259152671682Rat
1359317Zfand6zinc finger AN1-type containing 61138581002138652052Rat
1309123Mrpl46mitochondrial ribosomal protein L461132698872132707639Rat
1309809Pih1d1PIH1 domain containing 119563959795645295Rat
1334255Or5p60dolfactory receptor family 5 subfamily P member 60D1162219346162220290Rat
1560730Mrgprb3lMAS-related GPR, member B3 like19837743398378401Rat
1333728Or5p69olfactory receptor family 5 subfamily P member 691162461108162462052Rat
2154Arnt2aryl hydrocarbon receptor nuclear translocator 21138236235138392868Rat
1334260Or51k2olfactory receptor family 51 subfamily K member 21158389143158390081Rat
1334262Or52ae7bolfactory receptor family 52 subfamily AE member 7B1157797762157798709Rat
1334267Or14a257dolfactory receptor family 14 subfamily A member 257D1140204646140205587Rat
1334270Or56a41-ps1olfactory receptor family 56 subfamily A member 41, pseudogene 11159481250159481948Rat
1333307Or6i2-ps1olfactory receptor family 6 subfamily I member 2, pseudogene 11160824097160824727Rat
1333452Or56b2bolfactory receptor family 56 subfamily B member 2B1158956989158957948Rat
1333459Or10a5c-ps1olfactory receptor family 10 subfamily A member 5C, pseudogene 11160897439160898390Rat
1333469Or52ad1b-ps1olfactory receptor family 52 subfamily AD member 1B, pseudogene 11157702587157703531Rat
1334037Or51ab3olfactory receptor family 51 subfamily AB member 31157901417157902370Rat
1334043Or2d3colfactory receptor family 2 subfamily D member 3C1160756927160757850Rat
1332741Or2ag17olfactory receptor family 2 subfamily AG member 171160531819160532769Rat
1332743Or5p60bolfactory receptor family 5 subfamily P member 60B1162153461162154426Rat
1311443RrasRAS related19550058295504362Rat
1334180Or10ab4olfactory receptor family 10 subfamily AB member 41161927803161928786Rat
1332984Or52ac1olfactory receptor family 52 subfamily AC member 11158871618158872517Rat
1332985Or56b2kolfactory receptor family 56 subfamily B member 2K1159075031159077896Rat
1333984Or51k1b-ps1olfactory receptor family 51 subfamily K member 1B, pseudogene 11158432453158433446Rat
1312027Pold3DNA polymerase delta 3, accessory subunit1154417893154456687Rat
1333791Or51ag1olfactory receptor family 51 subfamily AG member 11157878427157879374Rat
1333794Or52s20olfactory receptor family 52 subfamily S member 201157748451157749422Rat
1561338Slc6a16solute carrier family 6, member 1619572169095750191Rat
1549692Vrk3VRK serine/threonine kinase 319524334495270780Rat
1559691Dnmt3a-ps3DNA methyltransferase 3 alpha, pseudogene 31107153094107163738Rat
1333531Or52p2olfactory receptor family 52 subfamily P member 21157010581157011528Rat
1333532Or51l1olfactory receptor family 51 subfamily L member 11157516210157517157Rat
1333535Olr55-psolfactory receptor pseudogene 551157236148157236449Rat
1334127Or51i1olfactory receptor family 51 subfamily I member 11158502581158503525Rat
1334129Or52b3-ps1olfactory receptor family 52 subfamily B member 3, pseudogene 11156963553156964495Rat
1334015Or52e2olfactory receptor family 52 subfamily E member 21157561070157562023Rat
1334018Or2ag19bolfactory receptor family 2 subfamily AG member 19B1160458552160459502Rat
1334089Or52n20olfactory receptor family 52 subfamily N member 201158933757158934725Rat
1334090Or56b37-ps1olfactory receptor family 56 subfamily B member 37, pseudogene 11159068812159069569Rat
1334093Or52p1olfactory receptor family 52 subfamily P member 11158889800158890789Rat
628773Hdgfl3HDGF like 31135822600135876719Rat
1562118Prdx1-ps2peroxiredoxin 1, pseudogene 21151735733151737057Rat
1333043Olr100-psolfactory receptor pseudogene 1001157813825157814045Rat
1311070Me3malic enzyme 31143534024143735551Rat
1333075Or2d36bolfactory receptor family 2 subfamily D member 36B1160930225160931169Rat
1559529Kctd21potassium channel tetramerization domain containing 211151650074151669775Rat
1333881Or52n1olfactory receptor family 52 subfamily N member 11159128222159129187Rat
1333885Or2ag16bolfactory receptor family 2 subfamily AG member 16B1160476725160477672Rat
1334142Or8i6-ps1olfactory receptor family 8 subfamily I member 6, pseudogene 11161737746161738184Rat
1559901Mrps11mitochondrial ribosomal protein S111132707601132717253Rat
1559902Txn1l1thioredoxin 1 like 11152735541152735798Rat
1334081Or52b4olfactory receptor family 52 subfamily B member 41156939068156940009Rat
1333861Or51q1olfactory receptor family 51 subfamily Q member 11158456134158457081Rat
1333865Or52ab2bolfactory receptor family 52 subfamily AB member 2B1157689725157690675Rat
1333866Or2ag20olfactory receptor family 2 subfamily AG member 201160656583160657530Rat
1332980Or51b4bolfactory receptor family 51 subfamily B member 4B1158308648158309583Rat
1332982Or2at1olfactory receptor family 2 subfamily AT member 11154089219154090184Rat
1334397Or51a7olfactory receptor family 51 subfamily A member 71157395779157396717Rat
1334399Or6f1olfactory receptor family 6 subfamily F member 11139888779139889705Rat
1334402Or2ag21-psolfactory receptor family 2 subfamily AG member 21, pseudogene 11160599025160599427Rat
1334411Or56b1olfactory receptor family 56 subfamily B member 11158910597158911556Rat
1334060Or52e15olfactory receptor family 52 subfamily E member 151159349202159350140Rat
1332902Or13n4bolfactory receptor family 13 subfamily N member 4B1160609645160610571Rat
1332903Or52n2olfactory receptor family 52 subfamily N member 21159204524159205480Rat
1332905Or14n1olfactory receptor family 14 subfamily N member 11140064224140065216Rat
1332927Or5p78b-ps1olfactory receptor family 5 subfamily P member 78B, pseudogene 11162357696162358623Rat
1334292Or51g1olfactory receptor family 51 subfamily G member 11157438123157439064Rat
1333025Or10a48b-ps1olfactory receptor family 10 subfamily A member 48B, pseudogene 11162825264162826252Rat
1333026Or6b6olfactory receptor family 6 subfamily B member 61160812705160813649Rat
1333028Or52k2olfactory receptor family 52 subfamily K member 21157026845157027798Rat
1333057Or14c39bolfactory receptor family 14 subfamily C member 39B1140329678140330607Rat
1311596Mybpc2myosin binding protein C219499412195017584Rat
1333720Or51a41olfactory receptor family 51 subfamily A member 411157454391157455398Rat
1333546Or52ae9olfactory receptor family 52 subfamily AE member 91158130946158131893Rat
1333547Or52m1olfactory receptor family 52 subfamily M member 11157065217157066170Rat
1333554Or52n5-ps1olfactory receptor family 52 subfamily N member 5, pseudogene 11159288667159289619Rat
1311197Mkrn3makorin, ring finger protein, 31115926774115929288Rat
1333481Or51k7olfactory receptor family 51 subfamily K member 71158401733158402686Rat
1333486Or51l14olfactory receptor family 51 subfamily L member 141157767340157768296Rat
1559980Ccdc179coiled-coil domain containing 1791101600369101604288Rat
1333697Or52e51olfactory receptor family 52 subfamily E member 511157656899157657837Rat
1333699Olr258-psolfactory receptor pseudogene 2581162227180162228025Rat
1332939Or52h7olfactory receptor family 52 subfamily H member 71158835924158836898Rat
1334370Or5p59olfactory receptor family 5 subfamily P member 591162033893162034840Rat
1333037Or14c44-ps1olfactory receptor family 14 subfamily C member 44, pseudogene 11140004210140005185Rat
1334204Or55b10olfactory receptor family 55 subfamily B member 101156884142156885092Rat
1334327Or52z1olfactory receptor family 52 subfamily Z member 11158206284158207246Rat
1559839Ankrd49-ps3ankyrin repeat domain 49, pseudogene 31159492560159493383Rat
1334219Or5p5olfactory receptor family 5 subfamily P member 51161759509161760447Rat
1334373Or5ae1olfactory receptor family 5 subfamily AE member 11138860924138861871Rat
1564695Fam181bfamily with sequence similarity 181, member B1147166428147167925Rat
1334208Or5p84-ps1olfactory receptor family 5 subfamily P member 84, pseudogene 11161974994161975991Rat
1334212Or51v8olfactory receptor family 51 subfamily V member 81158080680158081624Rat
1333008Or52a5bolfactory receptor family 52 subfamily A member 5B1158160904158161854Rat
1334425Or51b6bolfactory receptor family 51 subfamily B member 6B1158072748158073701Rat
1334427Or14f1-ps1olfactory receptor family 14 subfamily F member 1, pseudogene 11140305863140306292Rat
1334387Or10a48olfactory receptor family 10 subfamily A member 48B1162793841162794776Rat
1333662Or52r1olfactory receptor family 52 subfamily R member 11157301200157302174Rat
1333664Or2ag19olfactory receptor family 2 subfamily AG member 191160633102160634052Rat
1333669Or2ag13olfactory receptor family 2 subfamily AG member 131160362110160363057Rat
1334432Or51f1golfactory receptor family 51 subfamily F member 1G1157502544157503494Rat
1559690DdiasDNA damage-induced apoptosis suppressor1146906150146930462Rat
1359545Prss23serine protease 231143402725143422182Rat
1311839Hddc3HD domain containing 31134299469134301757Rat
1332958Or52b2olfactory receptor family 52 subfamily B member 21159695507159696475Rat
1333816Or51b4olfactory receptor family 51 subfamily B member 41158317228158318151Rat
1333818Or52n1bolfactory receptor family 52 subfamily N member 1B1159015174159016139Rat
1333820Or51b6c-ps1olfactory receptor family 51 subfamily B member 6C, pseudogene 11158025825158026778Rat
1334301Or5p73olfactory receptor family 5 subfamily P member 731162325587162326531Rat
1334302Or51aa2olfactory receptor family 51 subfamily AA member 21157888966157889937Rat
1359585Fhip1bFHF complex subunit HOOK interacting protein 1B1159718679159748449Rat
1334277Or51q1eolfactory receptor family 51 subfamily Q member 1E1158482153158483100Rat
1334283Or52l1bolfactory receptor family 52 subfamily L member 1B1159543892159544842Rat
1334284Or5p83-ps1olfactory receptor family 5 subfamily P member 83, pseudogene 11162382685162383211Rat
1311854Olfml1olfactomedin-like 11161478129161502541Rat
1332894Or51ah3olfactory receptor family 51 subfamily AH member 31157917326157918267Rat
1334390Or51v8bolfactory receptor family 51 subfamily V member 8B1157987781157988725Rat
1334393Or52n2folfactory receptor family 52 subfamily N member 2F1159223286159224242Rat
1561859Pgpep1lpyroglutamyl-peptidase I-like1121835243121868368Rat
1359131Dnajb13DnaJ heat shock protein family (Hsp40) member B131154848586154863042Rat
1332953Or51f5olfactory receptor family 51 subfamily F member 51157224045157224989Rat
1332954Or52u1olfactory receptor family 52 subfamily U member 11158863988158864959Rat
1332971Or52e19olfactory receptor family 52 subfamily E member 191157668879157669817Rat
1359455Hikeshiheat shock protein nuclear import factor hikeshi1143825399143849361Rat
1585050Ybx1-ps11Y box binding protein 1, pseudogene 111102914612102916158Rat
1564929Tm2d3TM2 domain containing 31119267194119277094Rat
1564933Olr271-ps1olfactory receptor 271, pseudogene 11162580418162589573Rat
3932Ucp2uncoupling protein 21154839242154845612Rat
1565432Svipsmall VCP interacting protein1101587128101592818Rat
1585077Stip1-ps1stress-induced phosphoprotein 1, pseudogene 11101898734101900378Rat
1565454Izumo1izumo sperm-oocyte fusion 119609081796096893Rat
1583564tuba1c-ps2tubulin, alpha 1C, pseudogene 21152835411152837618Rat
1583954Hnrnpa1-ps16heterogeneous nuclear ribonucleoprotein A1, pseudogene 161106395841106397127Rat
1585799Gdpd4glycerophosphodiester phosphodiesterase domain containing 41152233516152342329Rat
1566132Trim30ctripartite motif-containing 30C1158766401158787915Rat
1583734Ngrnneugrin, neurite outgrowth associated1134213235134219348Rat
1583735Top1-ps1DNA topoisomerase 1, pseudogene 11127423431127432141Rat
1583288Rnf169ring finger protein 1691154250462154311867Rat
1583786Rpl26-ps7ribosomal protein L26, pseudogene 71127659594127660098Rat
1583787Mif-ps8macrophage migration inhibitory factor, pseudogene 81126777227126777631Rat
1583788Commd9-ps1COMM domain containing 9, pseudogene 11111426330111428933Rat
1583789Hsdl1-ps1hydroxysteroid dehydrogenase like 1, pseudogene 11108780156108781131Rat
1583792Rpl18a-ps4ribosomal protein L18A, pseudogene 41101322809101323617Rat
1583794Far1-ps1fatty acyl CoA reductase 1, pseudogene 119818881698190338Rat
1583796Fam32al1family with sequence similarity 32, member A like 119107958991083390Rat
1585883Fam169bfamily with sequence similarity 169, member B1121878670121968272Rat
1563506WhammWASP homolog associated with actin, golgi membranes and microtubules1135526363135557091Rat
1584548Zscan2zinc finger and SCAN domain containing 21134833701134848957Rat
1563523Dkkl1dickkopf like acrosomal protein 119569401095699259Rat
1587398Mrgprb3MAS-related GPR, member B319827080098286263Rat
1582907Rsl24d1-ps2ribosomal L24 domain containing 1, pseudogene 21160336026160337165Rat
1585067Trim25-ps1tripartite motif-containing 25, pseudogene 11102350230102400041Rat
1583872Il16interleukin 161137617702137718022Rat
1583226Pgm2l1phosphoglucomutase 2-like 11154571410154620901Rat
1587416UevldUEV and lactate/malate dehyrogenase domains19745418897486004Rat
1582830C1h2orf78similar to human chromosome 2 open reading frame 7819274378892752219Rat
1563073Siglec8sialic acid binding Ig-like lectin 819409273794103134Rat
1565984Usp35ubiquitin specific peptidase 351151626195151649926Rat
1583906Sarnp-ps1SAP domain containing ribonucleoprotein, pseudogene 11108457981108458724Rat
3805Syt3synaptotagmin 319488083594895518Rat
621328ClpbClpB family mitochondrial disaggregase1156028740156158183Rat
1566295Aldh16a1aldehyde dehydrogenase 16 family, member A119562672795639808Rat
1582815Agap1l1ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 like 119284049592856281Rat
1562228Coa4cytochrome c oxidase assembly factor 4 homolog1154882199154885445Rat
1562619Izumo2IZUMO family member 219519645995209131Rat
1561206Slc25a19l1solute carrier family 25 member 19 like 11111433195111435231Rat
1566413Cldnd2claudin domain containing 219384853393851693Rat
1561972Kash5KASH domain containing 519566891895691353Rat
1565584CrebzfCREB/ATF bZIP transcription factor1144416864144423540Rat
1583990Egln1-ps2egl-9 family hypoxia-inducible factor 1, pseudogene 21160266448160268021Rat
1565895Klhl35kelch-like family member 351153767138153773550Rat
1563481Or51t1olfactory receptor, family 51, subfamily T, member 11157370394157371434Rat
1566323Fan1FANCD2 and FANCI associated nuclease 11117915323117945044Rat
1562653Saxo2stabilizer of axonemal microtubules 21136596445136638444Rat
1565197Ntn5netrin 519615694896165997Rat
1560277Gdpgp1GDP-D-glucose phosphorylase 11134184119134193281Rat
1582848Etf1-ps2eukaryotic translation termination factor 1, pseudogene 219266128392668713Rat
1561456FancfFA complementation group F1101449120101451936Rat
1564356Cers3ceramide synthase 31120316930120422926Rat
1565099Klf13KLF transcription factor 131117505857117536626Rat
1562492Slc6a21solute carrier family 6 member 2119575425795765854Rat
1565383Ppfibp2PPFIA binding protein 21161504774161687339Rat
1561254Acer3alkaline ceramidase 31152504180152606596Rat
1562499Sec1secretory blood group 119614339096164249Rat
1593867Trim68tripartite motif containing 681157114044157127494Rat
1592985Entrep2endosomal transmembrane epsin interactor 21118288365118700514Rat
1589755Tyrtyrosinase1141115036141210207Rat
1593913Bcl2l1-ps1Bcl2-like 1, pseudogene 11157042301157044415Rat
1590594Cep20-ps1centrosomal protein 20, pseudogene 11147104492147105471Rat
1589754UvragUV radiation resistance associated1153185356153442200Rat
1587126Vom2r42vomeronasal 2 receptor, 421139549127139593601Rat
1589774Or51p1olfactory receptor family 51 subfamily P member 11157523148157524089Rat
1591436Or51h1l1olfactory receptor family 51 subfamily H member 1 like 11157358640157363279Rat
1588673Hsd17b14hydroxysteroid (17-beta) dehydrogenase 1419602922496039577Rat
1593877Or52i2olfactory receptor family 52 subfamily I member 21157105171157106151Rat
1591447Or51h5olfactory receptor family 51 subfamily H member 51157348962157350022Rat
1586888Ap3s2adaptor related protein complex 3 subunit sigma 21133818825133859269Rat
1592144Matr3-ps1matrin 3, pseudogene 11118609657118613368Rat
1588641Lmtk3lemur tyrosine kinase 319626105896280362Rat
1588652MamstrMEF2 activating motif and SAP domain containing transcriptional regulator19610971596116295Rat
1587090Vom2r43vomeronasal 2 receptor, 431139793253139815783Rat
1588954Cops7b-ps2COP9 signalosome subunit 7B, pseudogene 21162757275162758072Rat
1588958Gnai2-ps1G protein subunit alpha i2, pseudogene 11162752964162754015Rat
1590972Stk33serine/threonine kinase 331163276176163458580Rat
1592197Or10ab5olfactory receptor family 10 subfamily AB member 51162529010162529975Rat
1593885Or51h1olfactory receptor family 51 subfamily H member 11157090324157091271Rat
1593886Or51f1olfactory receptor family 51 subfamily F member 11157278651157279610Rat
1587464Spaca4sperm acrosome associated 419619551496196187Rat
1585208C1h19orf12similar to human chromosome 19 open reading frame 1219087357890887205Rat
1583615Magel2MAGE family member L21115880142115884684Rat
1588939Ric3RIC3 acetylcholine receptor chaperone1163030621163086583Rat
1559447Pth2parathyroid hormone 219566652595667174Rat
1587109Vom2r42l1vomeronasal 2 receptor, 42 like 11139696920139763181Rat
1585733LOC682259similar to Tetraspanin-7 (Tspan-7) (Transmembrane 4 superfamily member 2) (Cell surface glycoprotein A15) (T-cell acute lymphoblastic leukemia-associated antigen 1) (TALLA-1) (Membrane component, X chromosome, surface marker 1) (CD231 antigen)...1122232825122233599Rat
1584032Zfp939zinc finger protein 93919112835691142632Rat
1589798Gys1glycogen synthase 119591544395935292Rat
1590620Cwc15-ps1CWC15 spliceosome-associated protein, pseudogene 11119335619119336345Rat
1590913Slc25a5-ps3solute carrier family 25 member 5, pseudogene 31106191309106192280Rat
1590920Pkm-ps7pyruvate kinase M1/2, pseudogene 71152275198152278499Rat
1590921Dcaf8-ps1DDB1- and CUL4-associated factor 8, pseudogene 11146567388146579549Rat
1584044Caap1-ps1caspase activity and apoptosis inhibitor 1, pseudogene 119106999391077845Rat
1584052Dnhd1dynein heavy chain domain 11159990785160077990Rat
1584053C1h2orf78l1similar to human chromosome 2 open reading frame 78 like 119105646491063841Rat
1585163Uqcrb-ps1ubiquinol-cytochrome c reductase binding protein, pseudogene 119101732891017808Rat
1587443Saal1serum amyloid A-like 119719868597218131Rat
1589010Naa38-ps1N(alpha)-acetyltransferase 38, NatC auxiliary subunit, pseudogene 11134093191134093669Rat
1598060Mogat2monoacylglycerol O-acyltransferase 21153521813153545756Rat
1597345Zfp141zinc finger protein 14119313057493164293Rat
1596113Tmed5-ps1transmembrane p24 trafficking protein 5, pseudogene 11158424491158425578Rat
1593977Rpl21-ps17ribosomal protein L21, pseudogene 171148209812148210306Rat
1597422Hbb-bshemoglobin, beta adult s chain1158218356158219741Rat
1593461Klk5kallikrein related-peptidase 519429657494304768Rat
1592241Smapl-ps1small acidic protein like, pseudogene 11162387205162387742Rat
1593285Hspd1-ps7heat shock protein family D (Hsp60) member 1, pseudogene 71103645663103648170Rat
1593423Skp2-ps1S-phase kinase-associated protein 2, pseudogene 11162065613162066882Rat
1593397Klk15-ps3kallikrein-related peptidase 15, pseudogene 319449917794505830Rat
1591721Pank1-ps1pantothenate kinase 1, pseudogene 11146724869146733032Rat
1592569Rrm1ribonucleotide reductase catalytic subunit M11156823960156848262Rat
1594860Saa3serum amyloid A 319721870697222150Rat
1592737Or51d1olfactory receptor family 51 subfamily D member 11157134584157135641Rat
1596020Cd33CD33 molecule19393541893940452Rat
1596870Zc3h11a-ps2zinc finger CCCH-type containing 11A, pseudogene 21116013406116016461Rat
1588758Usp17l8ubiquitin specific peptidase 17 like family member 81159173249159182920Rat
1594161Ccdc83coiled-coil domain containing 831144167993144225622Rat
1594809Snx12-ps1sorting nexin 12, pseudogene 11158460071158460615Rat
1588686Dhdhdihydrodiol dehydrogenase19595436195965262Rat
1596282Vmn2r116l-ps12vomeronasal 2, receptor 116 like, pseudogene 1219345631293545002Rat
1588967Or5e1olfactory receptor family 5 subfamily E member 11162724328162725263Rat
1588614Ncr3lg1natural killer cell cytotoxicity receptor 3 ligand 119656566496581825Rat
1592887Lysmd4LysM domain containing 41120839180120845148Rat
1597332Vom2r37vomeronasal 2 receptor, 3719325799393318774Rat
1590363Or5ae2olfactory receptor family 5 subfamily AE member 21138804766138805713Rat
1590087Or5p80olfactory receptor family 5 subfamily P member 801162509473162510405Rat
1596774Tpbgltrophoblast glycoprotein-like1153923722153926548Rat
1593252Tead2TEA domain transcription factor 219570236695719186Rat
1592552Uqcrbl1ubiquinol-cytochrome c reductase binding protein like 11133425137133425500Rat
1598109Morf4l1-ps7mortality factor 4 like 1, pseudogene 71115975577115976718Rat
1591909Hbe1l-ps1hemoglobin subunit epsilon 1 like, pseudogene 11158266601158267985Rat
1591913Traf7-ps1TNF receptor associated factor 7, pseudogene 11115943129115945159Rat
1591914Ccdc137-ps1coiled-coil domain containing 137, pseudogene 11106199727106208762Rat
1591915Mrgprb2MAS-related GPR, member B219840114098403162Rat
1591916Mrpl32-ps1mitochondrial ribosomal protein L32, pseudogene 119079444290798694Rat
1596692Fam174bfamily with sequence similarity 174, member B1127515393127618591Rat
1595847Trim66tripartite motif-containing 661163468944163539633Rat
1598125Vom2r-ps67vomeronasal 2 receptor, pseudogene 671140594546140625318Rat
1595848Hbb-b1hemoglobin, beta adult major chain1158224175158231675Rat
1598291Rpl23a-ps7ribosomal protein L23a, pseudogene 71149862205149862727Rat
1598292Rnd2-ps1rho family GTPase 2, pseudogene 11143925214143926854Rat
1598293Pgk1-ps7phosphoglycerate kinase 1, pseudogene 71142700683142701985Rat
1598218Nlrp14NLR family, pyrin domain containing 141161069141161089158Rat
1598223Rpl3-ps4ribosomal protein L3, pseudogene 41147589211147590404Rat
1594988Or52w1olfactory receptor family 52 subfamily W member 11159715755159716744Rat
1598222Nrbf2-ps1nuclear receptor binding factor 2, pseudogene 11158017949158018810Rat
1598219Atmin-ps1ATM interactor, pseudogene 11160351454160353967Rat
1598220Gvin1GTPase, very large interferon inducible 11160279767160306701Rat
1598221Eef1a1-ps4eukaryotic translation elongation factor 1 alpha 1, pseudogene 41158819049158820377Rat
1597139Idh2isocitrate dehydrogenase (NADP(+)) 21134038644134057969Rat
1597140Trpm1transient receptor potential cation channel, subfamily M, member 11117718896117835434Rat
1598286Rbmxl2Rbmx like 21161116768161118249Rat
1598287Hspa8-ps29heat shock protein family A (Hsp70) member 8, pseudogene 291159266674159268569Rat
1598290Ldha-ps3lactate dehydrogenase A, pseudogene 31156017007156018106Rat
1596303C1h2orf78-ps1similar to human chromosome 2 open reading frame 78, pseudogene 119282371492824634Rat
1598667Klk5l1kallikrein related-peptidase 5 like 119456668894571882Rat
735155Car11carbonic anhydrase 1119616990096175191Rat
1624201Zfp715zinc finger protein 71519370600593748131Rat
16424154933405O20RiklRIKEN cDNA 4933405O20 gene like1100300241100301711Rat
1626013Vom2r-ps66vomeronasal 2 receptor, pseudogene 661140519846140520742Rat
1626035Vom2r-ps62vomeronasal 2 receptor, pseudogene 621116129167116157652Rat
2290038Hbbl1hemoglobin subunit beta like 11158236972158238348Rat
1626046Vom2r-ps63vomeronasal 2 receptor, pseudogene 631138892457138892798Rat
1641977Vom2r-ps64vomeronasal 2 receptor, pseudogene 641139409799139410704Rat
2316393Vom1r-ps67vomeronasal 1 receptor pseudogene 671131058349131059234Rat
2319730Or52a20l1olfactory receptor family 52 subfamily A member 20 like 11158123097158125018Rat
2319766Lias-ps2lipoic acid synthetase, pseudogene 21108802590108803356Rat
2319415Spty2d1SPT2 chromatin protein domain containing 119753149597549616Rat
2320113Klk1c4kallikrein 1-related peptidase C419443457494438678Rat
2318883Snrpepl2small nuclear ribonucleoprotein polypeptide E like 21133709656133710137Rat
2318957Cdc42se2-ps1CDC42 small effector 2, pseudogene 119128740091290387Rat
2320229Set-ps1Set nuclear proto-oncogene, pseudogene 119775323397797449Rat
2318412Oca2OCA2 melanosomal transmembrane protein1107116278107446093Rat
2321314Atxn1-ps1ataxin 1, pseudogene 11102516795102517889Rat
2322090Ran-ps2RAN, member RAS oncogene family, pseudogene 219864557498655680Rat
2323421Or5p81bolfactory receptor family 5 subfamily P member 81B1162646352162647296Rat
2320559LOC100361204mas-related G-protein coupled receptor member B8-like19804940998050395Rat
2322792Flt3lgFms related receptor tyrosine kinase 3 ligand19561505695620463Rat
2320676Clp1-ps1cleavage factor polyribonucleotide kinase subunit 1, pseudogene 11105449881105451267Rat
2322257Rps27-ps9ribosomal protein S27, pseudogene 91128028275128028907Rat
2320729Rchy1-ps1ring finger and CHY zinc finger domain containing 1, pseudogene 11137830459137831886Rat
2322933Srsf7-ps1serine and arginine rich splicing factor 7, pseudogene 11124210206124239378Rat
2322334Cdca4-ps2cell division cycle associated 4, pseudogene 21140183390140192383Rat
2320865Atxn1-ps2ataxin 1, pseudogene 21103672445103674674Rat
2323071Dcaf12-ps1DDB1 and CUL4 associated factor 12, pseudogene 11123731057123733750Rat
2322541Mrgprb13-ps1MAS-related GPR, member B13, pseudogene 119800209198004379Rat
2323231Scly-ps1selenocysteine lyase, pseudogene 11162839235162842235Rat
2321863FanciFA complementation group I1133327264133383661Rat
2321127LOC100360933cDNA sequence BC048679-like1135445623135449427Rat
2321930Grb2-ps1growth factor receptor bound protein 2, pseudogene 119301652893018833Rat
2321947Brcc3-ps2BRCA1/BRCA2-containing complex, subunit 3, pseudogene 21140762660140885589Rat
2320477Pdzd11-ps1PDZ domain containing 11, pseudogene 11148917133148917842Rat
2320478Hsp90ab1-ps1heat shock protein 90 alpha family class B member 1, pseudogene 11105948734105951090Rat
2320494Snrpa1small nuclear ribonucleoprotein polypeptide A'1119641402119654653Rat
2324470Tm9sf3-ps1transmembrane 9 superfamily member 3, pseudogene 11160899639160905468Rat
2324488Siglecl1SIGLEC family like 119391697193924742Rat
4888565Mir344a-2microRNA 344a-21115243128115243234Rat
2325357Mir708microRNA 7081150599876150599963Rat
2325383Mir139microRNA 1391155878828155878895Rat
2325398Mir8microRNA 81132806420132806514Rat
2325455Mir150microRNA 15019560502495605108Rat
2325463Mir9-3microRNA 9-31133440049133440138Rat
2325549Mir211microRNA 2111117777539117777644Rat
2325614Mir344-1microRNA 344-11115306861115306958Rat
2325623Mir326microRNA 3261153854029153854123Rat
2324099Rps19-ps10ribosomal protein S19, pseudogene 101142882999142883492Rat
4888550Mir344b-1microRNA 344b-11114623759114623856Rat
4888559Mir3597-3microRNA 3597-31133440038133440152Rat
6486569Mrgprb13-ps2MAS-related GPR, member B13, pseudogene 219803228298033552Rat
6488322LOC100912195protein BEX1-like1110047861110051812Rat
6488981LOC100912071uncharacterized LOC1009120711154515779154571371Rat
6489367Vmn2r116l-ps26vomeronasal 2, receptor 116 like, pseudogene 261138892454138912931Rat
6489382Eef1a1-ps10eukaryotic translation elongation factor 1 alpha 1, pseudogene 101161270336161272186Rat
6489457LOC100912031uncharacterized LOC1009120311146790018146803474Rat
6485855Znf431l3zinc finger protein 431 like 319301932093038483Rat
6491878Misfamitochondrial sheath formation associated19752264197528961Rat
6485222Vmn2r116l-ps1vomeronasal 2, receptor 116 like, pseudogene 11139671255139673942Rat
6485832Klk15-ps1kallikrein-related peptidase 15, pseudogene 119453388994545793Rat
6485896Zfp950l4zinc finger protein 950 like 419360728693628363Rat
6485887Hmgb1-ps20high-mobility group box 1, pseudogene 201157313524157314172Rat
6493379Dppa4-ps3developmental pluripotency-associated 4, pseudogene 31146603214146604124Rat
6487744Rps3a-ps1ribosomal protein S3a, pseudogene 11146750204146756584Rat
6486156Zfp936zinc finger protein 93619294305992949011Rat
6491275Rhoq-ps1ras homolog family member Q, pseudogene 11106623061106624411Rat
6491324Rack1-ps2receptor for activated C kinase 1, pseudogene 21160670664160674437Rat
6487804Ppid-ps5peptidylprolyl isomerase D, pseudogene 51153808461153838113Rat
6490164Snx18-ps1sorting nexin 18, pseudogene 11161003246161007281Rat
6498800Rps4x-ps10ribosomal protein S4, X-linked, pseudogene 101140897229140897968Rat
6498966Ybx1-ps5Y box binding protein 1, pseudogene 51102225708102227243Rat
6495781LOC10091088860S ribosomal protein L36-like1129764986129765341Rat
6496163Luzp2leucine zipper protein 21105597291105983605Rat
6499723Ldha-ps1lactate dehydrogenase A, pseudogene 11140009867140010890Rat
6499943Ldha-ps12lactate dehydrogenase A, pseudogene 121140025282140027726Rat
6496810Ecsit-ps1ECSIT signaling integrator, pseudogene 11104502481104503645Rat
6500127Usp17la2ubiquitin specific peptidase 17-like a21159151417159155192Rat
6500406Gfygolgi-associated, olfactory signaling regulator19566162195665300Rat
6500416Ftl1-ps1ferritin light chain 1, pseudogene 11100923579100924459Rat
6503647Rbm4b-ps1RNA binding motif protein 4B, pseudogene 11113739597113740013Rat
7489047Scarna15small Cajal body-specific RNA 151135484620135484683Rat
7489017Mir344gmicroRNA 344g1115343044115343122Rat
7240857Trim34tripartite motif-containing 341158707172158720214Rat
7489023Mir344imicroRNA 344i1115426210115426308Rat
7489033Mir3102microRNA 31021155243756155243892Rat
7518732LOC102552287uncharacterized LOC1025522871103583677103601779Rat
7541917Zfp658zinc finger protein 65819399246794005689Rat
7505973LOC102548815uncharacterized LOC10254881519198240192029109Rat
7508565LOC102548323uncharacterized LOC1025483231116995976117064301Rat
7530616Mir9-3hgMir9-3 host gene1133431075133469302Rat
7499284LOC102550036uncharacterized LOC1025500361144050618144056394Rat
7510373LOC102552825uncharacterized LOC1025528251137282138137284054Rat
7510716Zfp719zinc finger protein 71919400995794027342Rat
7511549LOC102555775uncharacterized LOC1025557751114637762114649714Rat
7512548LOC102552153uncharacterized LOC1025521531103510363103575329Rat
7537804LOC102553800uncharacterized LOC1025538001131429410131442617Rat
7612387LOC102549305uncharacterized LOC1025493051119375739119389971Rat
7612505LOC102552286formyl peptide receptor-related sequence 4-like19474795394749932Rat
7631858Fbxw11-ps1F-box and WD repeat domain containing 11, pseudogene 11116428735116431543Rat
7634635LOC102555470uncharacterized LOC1025554701114294070114303084Rat
7634877LOC102554078uncharacterized LOC1025540781126851551126852404Rat
7650527LOC102555617uncharacterized LOC1025556171114440731114448803Rat
7651195LOC102550061uncharacterized LOC10255006119382681793836987Rat
7636379LOC102552634uncharacterized LOC10255263419734491797365236Rat
76363861700028J19RiklRIKEN cDNA 1700028J19 gene like19471361394730846Rat
7638459LOC102548889uncharacterized LOC1025488891134114350134128483Rat
7625414LOC102549852ferritin light chain 1-like1143810386143811096Rat
7577468LOC102549616uncharacterized LOC1025496161119804731119844038Rat
7625624LOC102548601uncharacterized LOC1025486011117601030117605930Rat
7655999LOC102549042uncharacterized LOC10254904219205174392123537Rat
7641285LOC102554680uncharacterized LOC1025546801142018187142025944Rat
7628264LOC102556190uncharacterized LOC10255619019604107496047337Rat
7609569LOC102555928uncharacterized LOC1025559281135445291135469930Rat
7643677LOC102556513uncharacterized LOC1025565131135894458135909734Rat
7660362LOC102551177uncharacterized LOC1025511771110294734111035350Rat
7661531LOC102553329uncharacterized LOC1025533291124017749124165290Rat
7555854Znf431l12zinc finger protein 431 like 1219365524793675372Rat
7617624Trim30al-ps1tripartite motif-containing 30A like, pseudogene 11158740434158748386Rat
7591504LOC102551255tetraspanin-7-like1122231176122236101Rat
7572872Sf3a1-ps1splicing factor 3A subunit 1, pseudogene 11141432976141436428Rat
7573144Vmn2r116l-ps29vomeronasal 2, receptor 116 like, pseudogene 291139496211139515315Rat
7598618LOC102548014uncharacterized LOC10254801419110575891128497Rat
7544215Vmn2r116l-ps27vomeronasal 2, receptor 116 like, pseudogene 271140688438140712736Rat
7544339LOC102555866uncharacterized LOC1025558661114688298114932765Rat
7557291Ctxnd1cortexin domain containing 11138495689138547105Rat
7545650Potefam2POTE ankyrin domain family member 21116271482116447353Rat
7557829Klk15-ps2kallikrein-related peptidase 15, pseudogene 219458801894594577Rat
7580217Snrpb-ps1small nuclear ribonucleoprotein polypeptides B and B1, pseudogene 11115304693115305592Rat
7550309LOC102549783uncharacterized LOC1025497831143533778143534759Rat
7565709LOC102553801uncharacterized LOC1025538011134346919134348781Rat
7606674LOC102547177uncharacterized LOC1025471771156162119156171192Rat
7585495LOC102547456uncharacterized LOC1025474561154197713154236133Rat
7554390LOC102547214uncharacterized LOC1025472141119348252119351951Rat
7554600LOC102548818uncharacterized LOC1025488181134107741134110798Rat
7736376Rpl12-ps3ribosomal protein L12, pseudogene 31156208145156208657Rat
7692197LOC102547943uncharacterized LOC1025479431133414486133421488Rat
7692537Xndc1Xrcc1 N-terminal domain containing 11156440284156460609Rat
7751286LOC102553078ubiquitin-like protein FUBI-like1154141530154141967Rat
7676282LOC102553862uncharacterized LOC1025538621132019641132025235Rat
7676646Ube3al1ubiquitin protein ligase E3A like 11110158663110291293Rat
7704592Znf431l-ps8zinc finger protein 431 like, pseudogene 819288960692917697Rat
7683572Zfp619l1zinc finger protein 619 like 119117169791198293Rat
7683637LOC102553173uncharacterized LOC1025531731123943804123994246Rat
7690508Klk5l-ps1kallikrein related-peptidase 5 like, pseudogene 119447831494489098Rat
7683193LOC102549532uncharacterized LOC1025495321119755503119777201Rat
7730966LOC102552387uncharacterized LOC1025523871102647014102669486Rat
7731725LOC102552485uncharacterized LOC10255248519471984694730038Rat
7736966LOC10255718260S ribosomal protein L31-like19998035899982992Rat
7738972Rpl35-ps4ribosomal protein L35, pseudogene 41152027322152030883Rat
7740165LOC102551020uncharacterized LOC1025510201122088458122164766Rat
7667275Klk2lkallikrein related-peptidase 2 like19442608394428521Rat
7716912Prdx3-ps1peroxiredoxin 3, pseudogene 11106775624106776566Rat
7742101LOC102547609uncharacterized LOC1025476091132868748132874634Rat
7697895LOC102546835uncharacterized LOC1025468351115475057115720360Rat
7698364LOC102553828spermatogenesis-associated protein 13-like1126159731126164254Rat
7701959Zfp788zinc finger protein 78819317257593197706Rat
7721677LOC102546680uncharacterized LOC1025466801119181972119185546Rat
7747342LOC102546796uncharacterized LOC10254679619941626999427141Rat
7748347Epb41l5-ps1erythrocyte membrane protein band 4.1 like 5, pseudogene 119658515196588057Rat
7748684Eif5-ps5eukaryotic translation initiation factor 5, pseudogene 51141500532141507333Rat
7709422Gapdh-ps69Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 691129758471129759490Rat
7750416Mgat4a-ps1alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase A, pseudogene 11113857991113864613Rat
7709992Csde1-ps1cold shock domain containing E1, pseudogene 11101128263101131688Rat
7710512Zfp619zinc finger protein 61919114801691167764Rat
7728972LOC102548165uncharacterized LOC1025481651116963210116996324Rat
7711357LOC102550562uncharacterized LOC1025505621152076132152094061Rat
9136205LOC103691157uncharacterized LOC1036911571121055568121061214Rat
9101016C1h19orf84similar to human chromosome 19 open reading frame 8419383537893837316Rat
9145766LOC103691200uncharacterized LOC1036912001154849970154869633Rat
9149734Or52r7olfactory receptor family 52 subfamily R member 71157284942157285649Rat
9191646LOC103691162uncharacterized LOC1036911621126477043126482167Rat
9198344LOC103691146uncharacterized LOC1036911461114303744114386780Rat
9168486Rpl13a-ps3ribosomal protein L13A, pseudogene 319103627891036843Rat
9202400Ndufb4l5NADH:ubiquinone oxidoreductase subunit B4 like 519414821794148671Rat
9170070LOC103691133prostate-specific antigen-like19468179094685589Rat
9349711LOC103691192twinkle protein, mitochondrial pseudogene1140480642140482788Rat
9227837LOC103691225putative uncharacterized protein1156196466156197649Rat
9273863LOC103691188uncharacterized LOC1036911881143422289143529944Rat
9229744LOC10369119360S acidic ribosomal protein P1-like1140289186140294946Rat
9366670LOC103691224ribosome biogenesis protein NSA2 homolog pseudogene1156758473156773537Rat
9322177Fam24al1family with sequence similarity 24, member A like 11129641309129655041Rat
9383371Snrnp48-ps1small nuclear ribonucleoprotein U11/U12 subunit 48, pseudogene 11135339418135340186Rat
9283938Rhog-ps3ras homolog family member G, pseudogene 31111125687111208473Rat
9249251LOC103691177histone H2A.Z pseudogene1127473174127484619Rat
9421087Smim47small integral membrane protein 4719474463594746122Rat
9468236LOC103691168uncharacterized LOC1036911681132680421132684321Rat
9393062Rps27a-ps26ribosomal protein S27a, pseudogene 261144896527144897046Rat
9396007LOC103691178chromobox protein homolog 3 pseudogene1134672915134675115Rat
9444072LOC103691202glyceraldehyde-3-phosphate dehydrogenase pseudogene1161819802161820840Rat
10043390Rps27a-ps30ribosomal protein S27a, pseudogene 3019137172391372135Rat
11358405LOC108349566uncharacterized LOC10834956619070689690740913Rat
11462077LOC108349447uncharacterized LOC1083494471134385420134400570Rat
11462765Trnap-ugg1transfer RNA proline (anticodon UGG) 11153114486153114557Rat
11463533LOC108349586uncharacterized LOC1083495861119287967119293388Rat
11465891LOC108349461uncharacterized LOC1083494611103443363103460555Rat
11468141Rpl21l5ribosomal protein L21 like 51148529229148529711Rat
11468718Rpl21-ps25ribosomal protein L21, pseudogene 251124344834124345343Rat
11471669LOC108348727uncharacterized LOC1083487271106824340106838875Rat
11436011Zfp470zinc finger protein 47019106390591111883Rat
11436026Gpx4-ps1glutathione peroxidase 4, pseudogene 11156569245156570007Rat
11436035Rpl27a-ps3ribosomal protein L27a, pseudogene 31133096265133099871Rat
11366552Gapdhl11glyceraldehyde-3-phosphate dehydrogenase like 1119094057290941452Rat
11357821LOC108349455uncharacterized LOC10834945519248072492591739Rat
11360787Klk5l-ps3kallikrein related-peptidase 5 like, pseudogene 319439464594397275Rat
11452860Igsf22immunoglobulin superfamily member 2219760193897618144Rat
11461101LOC10834928960S ribosomal protein L7a pseudogene1146399656146400987Rat
11432987LOC108349234uncharacterized LOC1083492341121251718121271532Rat
11383936Rpl23-ps3ribosomal protein L23,pseudogene 31154394804154395254Rat
11384002LOC108349194uncharacterized LOC1083491941151368864151379738Rat
11417296LOC10834845860S ribosomal protein L36 pseudogene1158665098158665484Rat
11422984LOC10834976860S ribosomal protein L29-like1108838092108838388Rat
11397546LOC108349597uncharacterized LOC1083495971130040995130043791Rat
11408073Trnap-agg1transfer RNA proline (anticodon AGG) 11153114734153114805Rat
11409293LOC108348964uncharacterized LOC1083489641106125962106135332Rat
11388338LOC108349570uncharacterized LOC10834957019491568094923655Rat
11400164Klk5l2kallikrein related-peptidase 5 like 219465235394669527Rat
11411641LOC108349814high mobility group protein B1-like1130158350130158821Rat
11381349LOC108349450uncharacterized LOC10834945019091046590926453Rat
11382437LOC108349532high mobility group protein B1 pseudogene1163050054163050871Rat
11393548LOC10834888060S ribosomal protein L34 pseudogene1106354560106354913Rat
11519974Trnae-uuc1transfer RNA glutamic acid (anticodon UUC) 11109313144109313215Rat
11501622Rpl35al7ribosomal protein L35A like 71134302904134303425Rat
11503785Trnar-ucg1transfer RNA arginine (anticodon UCG) 11133399712133399784Rat
11504974LOC108349103uncharacterized LOC10834910319008786390105749Rat
11481264Rps29-ps1ribosomal protein S29, pseudogene 11156638258156638584Rat
11496573Gpr32G protein-coupled receptor 3219475686394757895Rat
11513757Envl-ps17MLV-related proviral Env polyprotein-like, pseudogene 171143803658143805876Rat
11515099Rbis-ps2ribosomal biogenesis factor, pseudogene 21146515667146515964Rat
11517459LOC10834984960S ribosomal protein L7a pseudogene1129755848129757145Rat
11489695Tmsb10l5thymosin beta 10 like 51121497670121498138Rat
11492064LOC108349007uncharacterized LOC1083490071159756929159773172Rat
14398600Mir344b-3microRNA mir-344b-31114632635114632705Rat
14398575Mir344b-2microRNA mir-344b-21114616603114616673Rat
41321796LOC120100238small nucleolar RNA SNORD1151110292739110292816Rat
41322133LOC120100253small nucleolar RNA SNORD1151110267359110267436Rat
41322136Snord15bsmall nucleolar RNA, C/D box 15B1153779081153779225Rat
41354060LOC120100333small nucleolar RNA SNORD1161110995192110995284Rat
41378349Saal2serum amyloid A-like 219725763797259953Rat
41085628LOC120100308small nucleolar RNA SNORD1161110997780110997872Rat
41110788LOC120099872uncharacterized LOC1200998721136914913136919922Rat
41202669LOC120100280small nucleolar RNA SNORD1151110301514110301588Rat
41203530LOC120097351uncharacterized LOC1200973511163187266163190378Rat
41322568LOC120100492small nucleolar RNA U31117570637117570845Rat
41322932LOC120100155U6 spliceosomal RNA19106146191061567Rat
41323105LOC120100254small nucleolar RNA SNORD1151110269195110269271Rat
41356364LOC120100313small nucleolar RNA SNORD1161110479954110480046Rat
41380632LOC120100443U2 spliceosomal RNA1140724802140724998Rat
41087592LOC120099823uncharacterized LOC1200998231108581448108596320Rat
41088730Trnaa-agc79transfer RNA alanine (anticodon AGC) 791126350554126350634Rat
41113286LOC120100277small nucleolar RNA SNORD1151110290902110290979Rat
41113608LOC120100250small nucleolar RNA SNORD1151110257081110257158Rat
41284145Pole3-ps1DNA polymerase epsilon 3, accessory subunit, pseudogene 11107341034107356298Rat
41324388LOC120100247small nucleolar RNA SNORD1151110251568110251645Rat
41324480LOC120099827uncharacterized LOC1200998271113551559113562494Rat
41357392LOC120100282small nucleolar RNA SNORD1151110299683110299760Rat
41357901Snord35bsmall nucleolar RNA, C/D box 35B19560651095606596Rat
41382752LOC120099829uncharacterized LOC1200998291114066134114087090Rat
41141466LOC120100117U4 spliceosomal RNA1159079697159079847Rat
41141871LOC120099870uncharacterized LOC1200998701133872984133879902Rat
41279059LOC120100281small nucleolar RNA SNORD1151110296410110296487Rat
41279797Cul4b-ps1cullin 4B, pseudogene 11133574646133575249Rat
41285702Olr281-ps1olfactory receptor 281, pseudogene 11162691385162692348Rat
41358401LOC120099889uncharacterized LOC1200998891153441507153470272Rat
41091203Or51a25bl1olfactory receptor family 51 subfamily A member 25B like 11157160337157161936Rat
41115833LOC120097732uncharacterized LOC12009773219151091991513005Rat
41142333Odc1-ps8ornithine decarboxylase 1, pseudogene 81109953728109955186Rat
41142467LOC120099884uncharacterized LOC1200998841147175164147180920Rat
41206771LOC120100249small nucleolar RNA SNORD1151110255243110255320Rat
41207204LOC120100221U7 small nuclear RNA1159294824159294888Rat
41207249LOC120099846uncharacterized LOC1200998461122107156122110562Rat
41207608Isg20l1interferon stimulated exonuclease gene 20 like 119369267493701377Rat
41252911Trnas-aga17transfer RNA serine (anticodon AGA) 1719601179096011864Rat
41253898LOC120100276small nucleolar RNA SNORD1151110178175110178252Rat
41254060LOC120100375small nucleolar RNA SNORA2/SNORA34 family1157930780157930915Rat
41327125LOC120099822uncharacterized LOC1200998221108030936108068757Rat
41118317LOC120100220U7 small nuclear RNA1141121136141121197Rat
41389181Rpl7a-ps35ribosomal protein L7a, pseudogene 351144480892144481649Rat
41093297LOC120100213U7 small nuclear RNA1106488765106488826Rat
41094097Usp17lhubiquitin specific peptidase 17 like H1159158689159162463Rat
41118710LOC120100420U2 spliceosomal RNA1145145485145145580Rat
41118856LOC120100471small nucleolar RNA SNORD8819473460494734693Rat
41119470LOC120100326small nucleolar RNA SNORD1161110487777110487869Rat
41175336Brix1-ps1biogenesis of ribosomes BRX1, pseudogene 11129680951129683336Rat
41329310Dnajb6-ps5DnaJ heat shock protein family (Hsp40) member B6, pseudogene 51103619537103621184Rat
41330022LOC120099856uncharacterized LOC1200998561127413163127418868Rat
41364047LOC120099841uncharacterized LOC1200998411119204501119209290Rat
41389408LOC120098457kallikrein-2-like19451814894532064Rat
41389607Ipmk-ps1inositol polyphosphate multikinase, pseudogene 11127578732127592426Rat
41390298LOC120097342uncharacterized LOC1200973421146186005146268804Rat
41148090LOC120100271small nucleolar RNA SNORD1151110303346110303423Rat
41176080LOC120100323small nucleolar RNA SNORD1161111002979111003070Rat
41176983LOC120100210U7 small nuclear RNA1106488917106488976Rat
41211402LOC120100312small nucleolar RNA SNORD1161110982423110982515Rat
41212243LOC120099837uncharacterized LOC1200998371117663708117665914Rat
41330851Snora3Asmall nucleolar RNA, H/ACA box 3A1163540664163540793Rat
41341971LOC120100412small nucleolar RNA SNORA171136970981136971112Rat
41364498Snord88bsmall nucleolar RNA, C/D box 88B19473493794735027Rat
41391087LOC120097812uncharacterized LOC1200978121136871425136877196Rat
41121717LOC120099894uncharacterized LOC1200998941154894181154898468Rat
41122044LOC120100336small nucleolar RNA SNORD1161111034987111035076Rat
41178707LOC120099844uncharacterized LOC1200998441121313138121320010Rat
41189502LOC120099875uncharacterized LOC1200998751139870107139920602Rat
41342901LOC120100321small nucleolar RNA SNORD1161110985002110985094Rat
41343058Gapdh-ps53Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5319962205599623687Rat
41366411LOC120100318small nucleolar RNA SNORD1161110990216110990308Rat
41393201LOC120097268uncharacterized LOC1200972681110123926110128015Rat
41098464LOC120100402small nucleolar RNA SNORA481118424802118424943Rat
41123320LOC120100240small nucleolar RNA SNORD1151110208959110209036Rat
41154963Rpf1-ps1ribosome production factor 1, pseudogene 119479819794800311Rat
41179128LOC120099866uncharacterized LOC1200998661133470652133492131Rat
41179479LOC120099864uncharacterized LOC1200998641132956992132959786Rat
41179831LOC120100444small nucleolar RNA SNORA171108932965108933098Rat
41214457LOC120100258small nucleolar RNA SNORD1151110285396110285473Rat
41266353Snord64small nucleolar RNA, C/D box 641111094909111094975Rat
41343720LOC120097791uncharacterized LOC1200977911127962107127984875Rat
41344265Rpl7a-ps36ribosomal protein L7a, pseudogene 361155597343155598176Rat
41099787LOC120099801uncharacterized LOC12009980119405836294073333Rat
41192708LOC120100172U6 spliceosomal RNA1151271287151271389Rat
41395739Nsa2-ps7NSA2 ribosome biogenesis factor, pseudogene 71100469200100469968Rat
41396804LOC120100331small nucleolar RNA SNORD1161110462563110462655Rat
41396935LOC120100366small nucleolar RNA SNORA201154286312154286441Rat
41397269LOC120100315small nucleolar RNA SNORD1161110492982110493074Rat
41158753LOC120100275small nucleolar RNA SNORD1151110193908110193985Rat
41194366LOC120100356U2 spliceosomal RNA1140302978140303142Rat
41218166LOC120100310small nucleolar RNA SNORD1161110972130110972222Rat
41218420LOC120100216U7 small nuclear RNA1146167994146168057Rat
41268507LOC120100283small nucleolar RNA SNORD1151110182787110182865Rat
41269839Rpl6-ps17ribosomal protein L6, pseudogene 171107702837107711388Rat
41290328LOC120098456uncharacterized LOC12009845619412461594127467Rat
41291278LOC120099903uncharacterized LOC1200999031161073386161079124Rat
41345916LOC120100259small nucleolar RNA SNORD1151110225775110225852Rat
41346041Rnu6-968RNA, U6 small nuclear 96819089044290890548Rat
41347527Rnu6-1195RNA, U6 small nuclear 11951106391996106392102Rat
41347657LOC120099849uncharacterized LOC1200998491122862073122867551Rat
41054014LOC120099891uncharacterized LOC1200998911153570312153573747Rat
41070218LOC120099817uncharacterized LOC1200998171102476477102497194Rat
41103001LOC120100175U6 spliceosomal RNA19051132190511424Rat
41127338LOC120100339small nucleolar RNA Z195/SNORD33/SNORD32 family19561122295611304Rat
41185069LOC120100292small nucleolar RNA SNORD1151110197442110197520Rat
41219816LOC120099853uncharacterized LOC1200998531127336589127338218Rat
41292810Snord88csmall nucleolar RNA, C/D box 88C19473215594732245Rat
41072504LOC120100452small nucleolar RNA SNORA171153237414153237538Rat
41104542LOC120100266small nucleolar RNA SNORD1151110223936110224013Rat
41129480LOC120097803uncharacterized LOC1200978031132925214132928678Rat
41161444LOC120099888uncharacterized LOC1200998881153504068153546167Rat
41197070LOC120100419small nucleolar RNA SNORA171147233100147233231Rat
41228858LOC120100184U6 spliceosomal RNA1149795907149796000Rat
41271806Trnaa-agc61transfer RNA alanine (anticodon AGC) 611100836137100836210Rat
41401400LOC120099834uncharacterized LOC1200998341115051743115085815Rat
41401628Ywhah-ps1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta, pseudogene 11147982102148014119Rat
41073030LOC120100252small nucleolar RNA SNORD1151110260759110260836Rat
41081049LOC120100325small nucleolar RNA SNORD1161110485165110485257Rat
41130772LOC120100269small nucleolar RNA SNORD1151110214472110214549Rat
41198576LOC120097768uncharacterized LOC1200977681109198620109204581Rat
41230170LOC120097347uncharacterized LOC1200973471155852256155853969Rat
41230808LOC120099812uncharacterized LOC12009981219738377897386285Rat
41272412Usp17lubiquitin specific peptidase 17 like1158993774158995929Rat
41272992LOC120097339uncharacterized LOC1200973391120764055120770141Rat
41294442Snord35asmall nucleolar RNA, C/D box 35A19561018595610264Rat
41294589LOC120100468small nucleolar RNA SNORA761135499682135499825Rat
41351837LOC120099892uncharacterized LOC1200998921154739519154741308Rat
41108358LOC120100291small nucleolar RNA SNORD1151110322055110322131Rat
41131410LOC120100171U6 spliceosomal RNA19359441593594521Rat
41164166LOC120100400small nucleolar RNA SNORA481129979431129979573Rat
41200237LOC120100330small nucleolar RNA SNORD1161110495552110495645Rat
41275464LOC120097162uncharacterized LOC12009716219584503395849118Rat
41296074Or52i2l-ps1olfactory receptor family 52 subfamily I member 2 like, pseudogene 11157112092157113068Rat
41296176LOC120097775uncharacterized LOC1200977751115747262115755253Rat
41296445LOC120100337small nucleolar RNA SNORD1161111037433111037527Rat
41296733LOC120100341small nucleolar RNA SNORA701121176393121176525Rat
41352397Hmgb1-ps32high-mobility group box 1, pseudogene 3219797329497974178Rat
41084506LOC120099825uncharacterized LOC1200998251111424659111494106Rat
41084950LOC120100317small nucleolar RNA SNORD1161110469365110469457Rat
41110617LOC120100270small nucleolar RNA SNORD1151110210797110210874Rat
41133992LOC120099898glyceraldehyde-3-phosphate dehydrogenase-like1156884450156934043Rat
41136282LOC120100464small nucleolar RNA SNORA401119956733119956858Rat
41166428LOC120100376small nucleolar RNA SNORA2/SNORA34 family1104515030104515165Rat
41166468LOC120099902uncharacterized LOC1200999021160415733160433407Rat
41166596LOC120100265small nucleolar RNA SNORD1151110308960110309037Rat
41200941LOC120100407small nucleolar RNA SNORA481134251885134252021Rat
41201883Hbb-b2hemoglobin, beta adult minor chain1158243696158245076Rat
41202226LOC120100150U6 spliceosomal RNA1106789754106789860Rat
41233713LOC120099880uncharacterized LOC1200998801143975541143984048Rat
41234278LOC120100290small nucleolar RNA SNORD1151110184594110184670Rat
40945041Trnaa-agc69transfer RNA alanine (anticodon AGC) 6919497229894972372Rat
40971092LOC120100305small nucleolar RNA SNORD1161110974703110974795Rat
40972134Trnap-cggtransfer RNA proline (anticodon CGG)19247162192471695Rat
40996824LOC120100273small nucleolar RNA SNORD1151110315578110315662Rat
40973162LOC120100241small nucleolar RNA SNORD1151110240543110240620Rat
40973358LOC120100244small nucleolar RNA SNORD1151110247891110247968Rat
41015843LOC120100242small nucleolar RNA SNORD1151110244217110244294Rat
40950485Snx4-ps1sorting nexin 4, pseudogene 11118719465118723782Rat
40951011LOC120100219U7 small nuclear RNA1159294900159294947Rat
40974504Rps29-ps9ribosomal protein S29, pseudogene 91119451277119451561Rat
40975001LOC120099854uncharacterized LOC1200998541127347845127351622Rat
40975144LOC120097344uncharacterized LOC1200973441145457745145462979Rat
41341028Rpl26l1-ps1ribosomal protein L26-like 1, pseudogene 11134875225134875637Rat
40952192LOC120099808uncharacterized LOC12009980819712204697126401Rat
40952513Snord15asmall nucleolar RNA, C/D box 15A1153782788153782935Rat
40976304LOC120100448small nucleolar RNA SNORA171123620368123620504Rat
40977331Mrgprb4-ps1MAS-related GPR, member B4, pseudogene 119797848197980262Rat
41012795Snord88asmall nucleolar RNA, C/D box 88A19473429994734388Rat
41012988LOC120100329small nucleolar RNA SNORD1161110979851110979943Rat
41013486Rpl36-ps8ribosomal protein L36, pseudogene1117148209117148529Rat
40926109LOC120097340uncharacterized LOC1200973401120775852120778917Rat
40953130LOC12009778560S ribosomal protein L27-like1124728576124728938Rat
40953491LOC120100293small nucleolar RNA SNORD1151110200168110200253Rat
40953947LOC120099899MLV-related proviral Env polyprotein-like1158445311158447321Rat
40978348G3bp1-ps1G3BP stress granule assembly factor 1, pseudogene 11158768853158770150Rat
40978721LOC120099868uncharacterized LOC1200998681133652575133654456Rat
41015411LOC120100324small nucleolar RNA SNORD1161110482541110482633Rat
40927059LOC120100340small nucleolar RNA SNORD3419561043295610498Rat
40927834LOC120100306small nucleolar RNA SNORD1161110977274110977366Rat
40956054LOC120100387U2 spliceosomal RNA1113515184113515344Rat
40979199LOC120100272small nucleolar RNA SNORD1151110307020110307096Rat
40979258LOC120097159uncharacterized LOC12009715919570437495707794Rat
40999106LOC120100332small nucleolar RNA SNORD1161111005695111005787Rat
40999933LOC120100494U4 spliceosomal RNA1121936095121936219Rat
40929172LOC120099842uncharacterized LOC1200998421119297968119315737Rat
40957095Rpl7a-ps34ribosomal protein L7a, pseudogene 341117339434117347725Rat
40982279Pnpla8-ps1patatin-like phospholipase domain containing 8, pseudogene 11138732722138759449Rat
41001342LOC120100413small nucleolar RNA SNORA171142114137142114268Rat
41002066LOC120099839uncharacterized LOC1200998391118747408118781774Rat
40958364LOC120100454U2 spliceosomal RNA1133230750133230898Rat
40982950LOC120100285small nucleolar RNA SNORD1151110238704110238780Rat
40983394LOC120100261small nucleolar RNA SNORD1151110271033110271110Rat
40983475LOC120100257small nucleolar RNA SNORD1151110287232110287309Rat
40983518LOC120100263small nucleolar RNA SNORD1151110236867110236944Rat
41003782LOC120099862uncharacterized LOC1200998621132785368132793311Rat
40933693Trnap-gggtransfer RNA proline (anticodon GGG)19606763996067719Rat
40984706Snrpc-ps10small nuclear ribonucleoprotein polypeptide C, pseudogene 101137642550137643027Rat
40985241Vmn2r116l-ps15vomeronasal 2, receptor 116 like, pseudogene 151139595637139617784Rat
41004471LOC120097182uncharacterized LOC12009718219602475096033425Rat
40935431LOC120099815uncharacterized LOC1200998151101354768101380898Rat
40986524LOC120097346uncharacterized LOC1200973461155432265155458440Rat
41008579LOC120097338uncharacterized LOC1200973381118247652118262726Rat
40938955LOC120100316small nucleolar RNA SNORD1161111000373111000465Rat
40939292LOC120100115U4 spliceosomal RNA19955785499557970Rat
40964065LOC120099806uncharacterized LOC12009980619689199996904056Rat
40964929LOC120100151U6 spliceosomal RNA1103004250103004356Rat
40990384Rnu6-658RNA, U6 small nuclear 65819361098493611083Rat
40940142LOC120099878uncharacterized LOC1200998781143707970143731710Rat
40966335LOC120100251small nucleolar RNA SNORD1151110258920110258997Rat
40941743LOC120100286small nucleolar RNA SNORD1151110311820110311899Rat
40942925Snora3Bsmall nucleolar RNA, H/ACA box 3B1163541736163541866Rat
40943119LOC120100274small nucleolar RNA SNORD1151110242382110242458Rat
40994046LOC120099799uncharacterized LOC12009979919387125693874563Rat
40943754LOC120100307small nucleolar RNA SNORD1161110987576110987668Rat
40943837LOC120100279small nucleolar RNA SNORD1151110305181110305258Rat
40943897LOC120100268small nucleolar RNA SNORD1151110212636110212713Rat
40970916LOC120100439small nucleolar RNA SNORA171157186339157186469Rat
41046890LOC120100116U4 spliceosomal RNA1160433810160433960Rat
41047128LOC120099826uncharacterized LOC1200998261113454803113493548Rat
41074683LOC120099813uncharacterized LOC12009981319769140697706639Rat
41312538Atp5mpl-ps1ATP synthase membrane subunit 6.8PL, pseudogene 11133428752133429328Rat
41024969LOC120099847uncharacterized LOC1200998471122285441122312506Rat
41048269LOC120099818uncharacterized LOC1200998181103031956103034632Rat
41025307LOC120097343uncharacterized LOC1200973431145498645145531228Rat
41049276Trnap-agg45transfer RNA proline (anticodon AGG) 4519541589095415964Rat
41049822Rnu6-946RNA, U6 small nuclear 9461135620777135620883Rat
41077517LOC120099851uncharacterized LOC1200998511124972989125042272Rat
41077533LOC120100327small nucleolar RNA SNORD1161110490401110490493Rat
41316835LOC120100481small nucleolar RNA U131163428009163428118Rat
41050960LOC120099861uncharacterized LOC1200998611132181245132187438Rat
41079516LOC120100288small nucleolar RNA SNORD1151110189568110189645Rat
41080214LOC120099897uncharacterized LOC1200998971155953421155981611Rat
41247311LOC120100287small nucleolar RNA SNORD1151110313740110313816Rat
41247581LOC120099863uncharacterized LOC1200998631132800647132808007Rat
41248172Klk5l-ps2kallikrein related-peptidase 5 like, pseudogene 219460846594612477Rat
41029545LOC120099819uncharacterized LOC1200998191105731072105743435Rat
41248427LOC120099831uncharacterized LOC1200998311114615464114620387Rat
41255323Trnap-agg47transfer RNA proline (anticodon AGG) 471118957548118957629Rat
41255502LOC120100360small nucleolar RNA SNORA41154965714154965854Rat
41332605Snord33small nucleolar RNA, C/D box 3319561069995610783Rat
41054606Snord107small nucleolar RNA, C/D box 1071111099306111099377Rat
41143699LOC120099855uncharacterized LOC1200998551127368228127374172Rat
41143867LOC120099848uncharacterized LOC1200998481122441489122510976Rat
41338037LOC120100255small nucleolar RNA SNORD1151110294577110294654Rat
41338298LOC120100260small nucleolar RNA SNORD1151110227613110227690Rat
41257043Actg1-ps11actin, gamma 1, pseudogene 111128530958128550705Rat
41335386LOC120100237small nucleolar RNA SNORD1151110289065110289142Rat
41336186LOC120100222U7 small nuclear RNA1141120935141120995Rat
41153489LOC120100164U6 spliceosomal RNA1105964547105964651Rat
41297869LOC120100284small nucleolar RNA SNORD1151110186394110186471Rat
41317864LOC120100248small nucleolar RNA SNORD1151110253404110253481Rat
41298225LOC120093062mas-related G-protein coupled receptor member B8-like19805785298058838Rat
41299698Trnag-acc7transfer RNA glycine (anticodon ACC) 71152191930152192004Rat
41033562LOC120100264small nucleolar RNA SNORD1151110180033110180111Rat
41034538Trnap-agg55transfer RNA proline (anticodon AGG) 551120030751120030832Rat
41059698Usp17laubiquitin specific peptidase 17-like A1159165961159169738Rat
41060371Trnaa-agc48transfer RNA alanine (anticodon AGC) 481160879981160880061Rat
41060898LOC120099814uncharacterized LOC1200998141101052794101087616Rat
41224851LOC120100335small nucleolar RNA SNORD1161110992583110992674Rat
41301263Ptp4a1-ps2protein tyrosine phosphatase 4A1, pseudogene 21143359417143360017Rat
41337281LOC120100320small nucleolar RNA SNORD1161111014871111014964Rat
41061314LOC120100421small nucleolar RNA SNORA171109086517109086648Rat
41062554LOC120100372small nucleolar RNA SNORA441135195011135195135Rat
41226711LOC120099840uncharacterized LOC1200998401118932104118936851Rat
41334291Set-ps4Set nuclear proto-oncogene, pseudogene 41154329801154343007Rat
41335333LOC120099893uncharacterized LOC1200998931154865137154884266Rat
41037345LOC120100425small nucleolar RNA SNORA171147306143147306271Rat
41235310LOC120100314small nucleolar RNA SNORD1161110477332110477424Rat
41303197LOC120100243small nucleolar RNA SNORD1151110246052110246129Rat
41303997LOC120099860uncharacterized LOC1200998601131469335131484623Rat
41016316LOC120100236small nucleolar RNA SNORD1151110283559110283636Rat
41039507LOC120100209U7 small nuclear RNA19086153790861598Rat
41064894LOC120100295small nucleolar RNA SNORD1161110498125110498217Rat
41236265LOC120100246small nucleolar RNA SNORD1151110249730110249807Rat
41236487Dnajb6-ps3DnaJ heat shock protein family (Hsp40) member B6, pseudogene 31102565949102567063Rat
41237199LOC120100343small nucleolar RNA SNORA701146918150146918259Rat
41304089LOC120100239small nucleolar RNA SNORD1151110272865110272942Rat
41041613Rnu6-856RNA, U6 small nuclear 85619119747691197582Rat
41041741LOC120100361small nucleolar RNA SNORA151136662596136662746Rat
41237530LOC120100125U6 spliceosomal RNA1124419603124419709Rat
41019099LOC120100465U2 spliceosomal RNA1137371689137371783Rat
41042766Shisal3shisa like 31134296708134298626Rat
41042878LOC120100262small nucleolar RNA SNORD1151110190139110190216Rat
41067967Rnu6-891RNA, U6 small nuclear 8911138601694138601800Rat
41068534LOC120099869uncharacterized LOC1200998691133590983133598028Rat
41069108LOC120097222uncharacterized LOC12009722219982886399830975Rat
41239287LOC120099830uncharacterized LOC1200998301114155536114162109Rat
41241885LOC120100156U1 spliceosomal RNA1128006617128006780Rat
41309315LOC120100235small nucleolar RNA SNORD1151110274700110274777Rat
41022847LOC120099833uncharacterized LOC1200998331115011988115017347Rat
41023737LOC120100319small nucleolar RNA SNORD1161110467179110467271Rat
155630625LOC127212837Sec61 pseudogene19275253692752936Rat
329845492LOC130062809uncharacterized LOC13006280919390078493913081Rat

Nucleotide Sequences
RefSeq Transcripts NM_001106290 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_574425 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide FQ210902 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211108 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ211330 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212363 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ217529 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221029 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221117 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221539 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ221745 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222210 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222357 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222908 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G73044 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  G73045 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH612587.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4889419Cstrr2Cold stress response QTL 20.05urine catecholamine amount (VT:0010502)absolute change in urine norepinephrine level (CMO:0001634)1155866514158592016Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
1302788Scl19Serum cholesterol QTL 194.60.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)190532338123479925Rat
631569Bp93Blood pressure QTL 930.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847121834139Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
631570Bp94Blood pressure QTL 940.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123479780142990467Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2317833Alcrsp19Alcohol response QTL 1912.40.001response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2303591Gluco41Glucose level QTL 412blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1102168504147168504Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1331800Scl25Serum cholesterol level QTL 253.013blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)194494440117601394Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)182174743118944897Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)192948896144267916Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
1582204Livw1Liver weight QTL 13.60.0003liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)1155422851172949803Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
1354623Rf46Renal function QTL 463.8blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)1102813953151162766Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)185424647100358001Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
9590300Scort16Serum corticosterone level QTL 164.390.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1103111621148111621Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
61346Rf2Renal disease susceptibility QTL 23.7urine protein amount (VT:0005160)urine protein level (CMO:0000591)199267916144267916Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)190664883143200202Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
631206Niddm40Non-insulin dependent diabetes mellitus QTL 40blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1136745990163747690Rat
1641897Alcrsp1Alcohol response QTL 1response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
2293142Bp314Blood pressure QTL 314arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192184926137184926Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
61370Mcs3Mammary carcinoma susceptibility QTL 32.15mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1102268556147268556Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
631496Bp97Blood pressure QTL 973.08arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847151047847Rat
634315Niddm45Non-insulin dependent diabetes mellitus QTL 457.16blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1144267916172949660Rat
61379Bp44Blood pressure QTL 4419.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144267916174133260Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
61399Tcat1Tongue tumor resistance QTL 13.3tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879)199267916144267916Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)180592172125592172Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
8694370Bw154Body weight QTL 1548.910.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)1103111621148111621Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)183547917128547917Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
631548Bp88Blood pressure QTL 8850.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1156677124176484451Rat
61433Cia2Collagen induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)17843075491209302Rat
2325726Eae30Experimental allergic encephalomyelitis QTL 30nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1123053310128593844Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 293418 UniSTS
  499133 UniSTS
UniSTS 230861 UniSTS