AU049773 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: AU049773

Symbol:

AU049773

Previously known as:

RGD ID:

5090477

Expected Size:

214 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	103,112,117 - 103,112,326 (+)	MAPPER	mRatBN7.2
Rnor_6.0	2	105,598,767 - 105,598,975	NCBI	Rnor6.0
Rnor_6.0	2	105,409,517 - 105,409,725	NCBI	Rnor6.0
Rnor_5.0	2	125,139,643 - 125,139,851	UniSTS	Rnor5.0
Rnor_5.0	2	125,328,893 - 125,329,101	UniSTS	Rnor5.0
RGSC_v3.4	2	105,796,773 - 105,796,981	UniSTS	RGSC3.4
Celera	2	98,477,591 - 98,477,787	UniSTS
Cytogenetic Map	2	q24	UniSTS

Is Marker For:

Genes: Med14-ps1 LOC100911493

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	TCTGGGACAGTGGAGATGAAA
Reverse Primer	ACGTACACATATGCACACACACAC

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
41073287	LOC120100782	uncharacterized LOC120100782	2	103099138	103118399	Rat

Nucleotide Sequences


GenBank Nucleotide	AU049773	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1302794	Stl27	Serum triglyceride level QTL 27	4.4	0.0001	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	2	25413423	143657569	Rat
1358894	Kidm24	Kidney mass QTL 24	4.03		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358899	Kidm23	Kidney mass QTL 23	3.88		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358901	Cm38	Cardiac mass QTL 38	2		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1358904	Cm39	Cardiac mass QTL 39	2.26		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	157142209	Rat
1358910	Kidm27	Kidney mass QTL 27	5.77		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358911	Kidm28	Kidney mass QTL 28	5.42		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	25413423	157142209	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1358887	Bw50	Body weight QTL 50	2.39		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1358908	Bw49	Body weight QTL 49	3.36		body mass (VT:0001259)	body weight (CMO:0000012)	2	25413652	157142078	Rat
1354603	Bp243	Blood pressure QTL 243	3.9		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	26917817	127469484	Rat
2290453	Scl55	Serum cholesterol level QTL 55	2.83		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	2	26917817	136917119	Rat
2293835	Kiddil5	Kidney dilation QTL 5	3.8		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	157142209	Rat
2293843	Kiddil6	Kidney dilation QTL 6	3.1		kidney pelvis morphology trait (VT:0004194)	hydronephrosis severity score (CMO:0001208)	2	42804607	182042367	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	43154682	202446871	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	43154682	202446871	Rat
2293676	Bmd19	Bone mineral density QTL 19	10.7	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	2	43162366	111362592	Rat
2293682	Bmd24	Bone mineral density QTL 24	8.9	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	2	43162366	111362592	Rat
2293671	Bss44	Bone structure and strength QTL 44	10.97	0.0001	lumbar vertebra morphology trait (VT:0010494)	lumbar vertebra cortical cross-sectional area (CMO:0001690)	2	43162366	148478373	Rat
1354601	Slep1	Serum leptin concentration QTL 1	5.39		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	2	43171017	184114403	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	46123260	202447032	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	56043031	202447032	Rat
1558648	Smcn1	Smooth muscle cell number QTL 1		0.039	blood vessel smooth muscle cell quantity (VT:0010525)	aorta smooth muscle cell count per unit vessel length (CMO:0001646)	2	59134147	127460910	Rat
5684990	Bmd82	Bone mineral density QTL 82	2.8		tibia mineral mass (VT:1000283)	bone mineral content (CMO:0001554)	2	59324377	103795077	Rat
5684996	Bmd85	Bone mineral density QTL 85	4.7	0.024	tibia mineral mass (VT:1000283)	bone mineral density (CMO:0001226)	2	59324377	103795077	Rat
61438	Cia7	Collagen induced arthritis QTL 7	4.6	0.0001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	2	59324377	141596857	Rat
1578777	Stresp15	Stress response QTL 15	2	0.05	blood aldosterone amount (VT:0005346)	plasma aldosterone level (CMO:0000551)	2	59846005	104846005	Rat
2306903	Bp336	Blood pressure QTL 336		0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	64366971	109366971	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118275	202447032	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118463	226797303	Rat
7411551	Bw131	Body weight QTL 131	29.6	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	2	67942638	112942638	Rat
1558653	Prcr1	Prostate cancer resistance QTL 1	5		prostate integrity trait (VT:0010571)	area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)	2	72532993	157142209	Rat
1354605	Rf48	Renal function QTL 48	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	2	74786664	206665859	Rat
631198	Cm22	Cardiac mass QTL 22	4.3	0.0008	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	76539322	150540526	Rat
61374	Edpm2	Estrogen-dependent pituitary mass QTL 2	4.42	0.86	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	76539322	202447032	Rat
2299162	Iddm32	Insulin dependent diabetes mellitus QTL 32	2.36		blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	78665616	143657569	Rat
1581569	Uae32	Urinary albumin excretion QTL 32		0.0001	urine protein amount (VT:0005160)	urine albumin excretion rate (CMO:0000757)	2	78665619	219826953	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	78665619	249053267	Rat
61392	Bp6	Blood pressure QTL 6	7		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	2	80270434	125270434	Rat
1598865	Bp296	Blood pressure QTL 296	2.1		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	81018907	126018907	Rat
8662832	Vetf7	Vascular elastic tissue fragility QTL 7	3.5		aorta elastin amount (VT:0003905)	aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)	2	81689826	221035911	Rat
1354622	Kidm16	Kidney mass QTL 16	3		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	2	81754530	222436696	Rat
1354649	Kidm17	Kidney mass QTL 17	2.9		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	2	81754530	227146641	Rat
1578772	Stresp14	Stress response QTL 14	5	0.001	blood renin amount (VT:0003349)	plasma renin activity level (CMO:0000116)	2	82345893	130923501	Rat
7207808	Bmd89	Bone mineral density QTL 89	4.1		femur strength trait (VT:0010010)	femoral neck ultimate force (CMO:0001703)	2	88862519	133862519	Rat
2300165	Bmd49	Bone mineral density QTL 49	4.8	0.0001	lumbar vertebra mineral mass (VT:0010511)	bone mineral density (CMO:0001226)	2	88862519	133862519	Rat
2300170	Bmd45	Bone mineral density QTL 45	12.1	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	2	88862519	133862519	Rat
2300185	Bmd46	Bone mineral density QTL 46	8.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	2	88862519	133862519	Rat
1598862	Glom9	Glomerulus QTL 9	3.5		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	2	92337601	137337601	Rat
1598863	Cm65	Cardiac mass QTL 65	2.3		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	92337601	137337601	Rat
631566	Bp90	Blood pressure QTL 90		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	102803808	147803808	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100911493	UniSTS
	680654	UniSTS
UniSTS	146219	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: AU049773