AU049221 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU049221

Symbol: AU049221
Previously known as:
RGD ID: 5089549
Expected Size: 222 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25130,432,062 - 130,433,042 (+)MAPPERmRatBN7.2
mRatBN7.21138,004,755 - 138,004,977 (+)MAPPERmRatBN7.2
Rnor_6.01146,168,209 - 146,168,430NCBIRnor6.0
Rnor_6.05135,822,807 - 135,823,785NCBIRnor6.0
Rnor_5.01147,096,944 - 147,097,165UniSTSRnor5.0
Rnor_5.05139,618,171 - 139,619,149UniSTSRnor5.0
RGSC_v3.45137,264,077 - 137,265,055UniSTSRGSC3.4
Celera5128,958,684 - 128,959,662UniSTS
Celera1130,025,714 - 130,025,937UniSTS
Cytogenetic Map5q36UniSTS
Cytogenetic Map1q31UniSTS
Is Marker For: Genes:   Cemip   Zswim5  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCATCTCCTGAGTGCTGGG
Reverse Primer AGAGGGGAAGGCTCTGGAGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310741Zswim5zinc finger, SWIM-type containing 55130346733130463791Rat
1305254Cemipcell migration inducing hyaluronidase 11137906921138062430Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)597570330136479578Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)587468046132468046Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
1581505Rf54Renal function QTL 54kidney physiology trait (VT:0002136)kidney 20-HETE level (CMO:0001854)5128033842133011550Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
7394710Emca12Estrogen-induced mammary cancer QTL 12mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5124160767133749643Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)590450144135450144Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)587765973132765973Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
631570Bp94Blood pressure QTL 940.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123479780142990467Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)587468046132468046Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
2317833Alcrsp19Alcohol response QTL 1912.40.001response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
2303591Gluco41Glucose level QTL 412blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1102168504147168504Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)192948896144267916Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
1354623Rf46Renal function QTL 463.8blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)1102813953151162766Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)587765973132765973Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
9590300Scort16Serum corticosterone level QTL 164.390.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1103111621148111621Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)597570330136479578Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
61346Rf2Renal disease susceptibility QTL 23.7urine protein amount (VT:0005160)urine protein level (CMO:0000591)199267916144267916Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)190664883143200202Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
631206Niddm40Non-insulin dependent diabetes mellitus QTL 40blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1136745990163747690Rat
1641897Alcrsp1Alcohol response QTL 1response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
61370Mcs3Mammary carcinoma susceptibility QTL 32.15mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1102268556147268556Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
631496Bp97Blood pressure QTL 973.08arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847151047847Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
61399Tcat1Tongue tumor resistance QTL 13.3tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879)199267916144267916Rat
1581505Rf54Renal function QTL 54kidney physiology trait (VT:0002136)kidney 20-HETE level (CMO:0001854)5128033842133011550Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
7394710Emca12Estrogen-induced mammary cancer QTL 12mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5124160767133749643Rat
8694370Bw154Body weight QTL 1548.910.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)1103111621148111621Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)590450144135450144Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 308797 UniSTS
  313524 UniSTS
UniSTS 145669 UniSTS