AU048540 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU048540

Symbol: AU048540
Previously known as:
RGD ID: 5088389
Expected Size: 238 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2183,756,101 - 3,756,339 (+)MAPPERmRatBN7.2
Rnor_6.0183,945,599 - 3,945,836NCBIRnor6.0
Rnor_5.0183,943,979 - 3,944,216UniSTSRnor5.0
RGSC_v3.4184,125,786 - 4,126,023UniSTSRGSC3.4
Celera183,811,070 - 3,811,307UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGCGGAAGTTTGCATTCA
Reverse Primer GTCAAGCATGATGACCCAAGTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41295872LOC120098331uncharacterized LOC1200983311836930753768701Rat

Nucleotide Sequences
GenBank Nucleotide AU048540 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH619136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552968Pigfal19Plasma insulin-like growth factor 1 level QTL 1911.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)18125758124Rat
9590248Scort10Serum corticosterone level QTL 1019.710.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)18125758124Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor surface area measurement (CMO:0002078)18224947722066430Rat
1641910Colcr3Colorectal carcinoma resistance QTL 35.020.000007intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)18224947722066430Rat


Additional Information

Database Acc Id Source(s)
UniSTS 144990 UniSTS