Hspa5 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Hspa5

Symbol: Hspa5
Previously known as:
RGD ID: 5087905
Expected Size: 133 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2318,059,672 - 18,059,805 (+)MAPPERmRatBN7.2
Rnor_6.0313,842,467 - 13,842,599NCBIRnor6.0
Rnor_5.0319,162,037 - 19,162,169UniSTSRnor5.0
RGSC_v3.4313,787,782 - 13,787,914UniSTSRGSC3.4
Celera312,780,817 - 12,780,949UniSTS
Cytogenetic Map3p11UniSTS
Is Marker For: Genes:   Hspa5  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAAAATGCTATAGCCCAAGTGG
Reverse Primer CAAGGTGAACACACACCCTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2843Hspa5heat shock protein family A (Hsp70) member 531805550718059969Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358357Srcrtb1Stress Responsive Cort Basal QTL 16.360.002blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)3865816227494778Rat
6893355Bw101Body weight QTL 1010.40.38body mass (VT:0001259)body weight (CMO:0000012)31077870430357018Rat
11528620Bss113Bone structure and strength QTL 1139.752e-10femur morphology trait (VT:0000559)femoral neck width (CMO:0001695)31649064819241681Rat
634306Bp140Blood pressure QTL 1403.30.0013arterial blood pressure trait (VT:2000000)body weight (CMO:0000012)31737470335528639Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
1298526Arunc3Aerobic running capacity QTL 32.2exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)3822719433703538Rat
8693641Alc30Alcohol consumption QTL 3020.739drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)31043430624512004Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
1558657Cm43Cardiac mass QTL 436.63e-08heart mass (VT:0007028)heart wet weight (CMO:0000069)31077882330356773Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
6893363Bw105Body weight QTL 1052.60.0036body mass (VT:0001259)body weight (CMO:0000012)31077870430357018Rat
61468Bp15Blood pressure QTL 154.4blood pressure trait (VT:0000183)pulse pressure (CMO:0000292)3133278763Rat
631831Alc8Alcohol consumption QTL 82.7consumption behavior trait (VT:0002069)calculated ethanol drink intake rate (CMO:0001615)3133230976Rat
1558647Cm46Cardiac mass QTL 465.40.0000055heart mass (VT:0007028)heart wet weight (CMO:0000069)31077882330356773Rat
4889966Bss95Bone structure and strength QTL 954.4tibia area (VT:1000281)tibia-fibula cross-sectional area (CMO:0001718)3136847613Rat
1558654Bw56Body weight QTL 564.50.0000171body mass (VT:0001259)body weight (CMO:0000012)31077870430357018Rat
1558650Cm48Cardiac mass QTL 4840.0001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)31077882330356773Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)31077870450302886Rat
631545Bp85Blood pressure QTL 853.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3133278763Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31695470861954708Rat
631679Cm10Cardiac mass QTL 107.340.0001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)3131158234Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
70203Gcr2Gastric cancer resistance QTL 22.6stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)3865816227494778Rat
70202Alc19Alcohol consumption QTL 192.5drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)3127494778Rat
2312664Scl62Serum cholesterol level QTL 620.05blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)3138710544Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 25617 UniSTS