D5Wsu145e Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D5Wsu145e

Symbol: D5Wsu145e
Previously known as:
RGD ID: 5087805
Expected Size: 276 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2149,563,362 - 9,563,638 (+)MAPPERmRatBN7.2
mRatBN7.298,714,926 - 8,715,204 (+)MAPPERmRatBN7.2
Rnor_6.01411,204,384 - 11,204,659NCBIRnor6.0
Rnor_6.096,477,158 - 6,477,435NCBIRnor6.0
Rnor_5.01411,148,219 - 11,148,494UniSTSRnor5.0
Rnor_5.095,523,650 - 5,523,927UniSTSRnor5.0
RGSC_v3.41410,866,034 - 10,866,309UniSTSRGSC3.4
Celera149,664,515 - 9,664,790UniSTS
Celera94,515,496 - 4,515,773UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTTTATTCATTTTGATCAGG
Reverse Primer TTTTAAATGCCTACAACTTTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309950Hnrnpdlheterogeneous nuclear ribonucleoprotein D-like1495574309563659Rat

Nucleotide Sequences
GenBank Nucleotide FQ214237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ222460 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14381307421217635Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)14381307418274691Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14908897839057237Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14381307430767156Rat
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
71115Niddm15Non-insulin dependent diabetes mellitus QTL 154.8blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14121760611030812Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14381307424531477Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14121760616960180Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14381307421217635Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)14381307418274691Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14381307430767156Rat
71115Niddm15Non-insulin dependent diabetes mellitus QTL 154.8blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14121760611030812Rat
61450Ciaa3CIA Autoantibody QTL 36.5blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)9795472022071169Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
1354650Despr5Despair related QTL 54.010.0017locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)9125408446254084Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9140594091Rat
70226Eae4Experimental allergic encephalomyelitis QTL 4nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)9125661317Rat
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
631211Bw4Body weight QTL45.31retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)9510982650109826Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14908897839057237Rat
10054141Gmadr4Adrenal mass QTL 42.450.0074adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)9114209783Rat
2303559Gluco54Glucose level QTL 542blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)9125408446254084Rat
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
1578675Bss17Bone structure and strength QTL 173.8femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)9336865213533896Rat
9589055Scfw5Subcutaneous fat weight QTL 55.550.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)9137999212Rat
1641911Alcrsp13Alcohol response QTL 13response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)9143718459Rat
61425Cia15Collagen induced arthritis QTL 154.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)9510982642921101Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14381307424531477Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
9589158Gluco65Glucose level QTL 656.820.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)9137999212Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
11353947Bp392Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)9728325252283252Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
7411592Foco8Food consumption QTL 87.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9137999212Rat
1331757Cdexp1CD45RC expression in CD8 T cells QTL 14.3CD8-positive T cell quantity (VT:0008077)blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)9102453767509080Rat
1298088Edpm11Estrogen-dependent pituitary mass QTL 112.5pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)9143718459Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14121760616960180Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat


Additional Information