Cfl1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Cfl1

Symbol: Cfl1
Previously known as:
RGD ID: 5087737
Expected Size: 874 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21054,675,300 - 54,676,175 (+)MAPPERmRatBN7.2
Rnor_6.01056,562,267 - 56,563,141NCBIRnor6.0
Rnor_5.01056,307,386 - 56,308,260UniSTSRnor5.0
RGSC_v3.41056,795,989 - 56,796,862UniSTSRGSC3.4
Celera1053,829,226 - 53,830,099UniSTS
Cytogenetic Map1q43UniSTS
Is Marker For: Genes:   Cfl1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCACTCATGGAAGCAGGAC
Reverse Primer AGGTGGAGTGCTTGCCTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1560367Rbm6RNA binding motif protein 68108452687108552783Rat
1588858LOC688430similar to Cofilin-1 (Cofilin, non-muscle isoform)8108489949108491597Rat
69285Cfl1cofilin 11202796012202801337Rat

Nucleotide Sequences
RefSeq Transcripts NM_017147 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_001067293 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_002727135 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC059143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC086533 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH473953 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH473954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ209459 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212325 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212794 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ212910 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213567 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213701 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213897 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214120 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214214 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ214438 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220384 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220422 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ220571 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ226405 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227487 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229073 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229602 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229766 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229833 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229875 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ230001 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ230091 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231379 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ233750 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ234162 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ234303 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X62908 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)846531639119088624Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)861290298119084929Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)866142385111142385Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight to body weight ratio (CMO:0000654)869349194112783834Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)870513503118219066Rat
8694446Bw170Body weight QTL 17012.070.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)871888757116888757Rat
9590292Uminl3Urine mineral level QTL 33.620.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)871888757116888757Rat
8694200Abfw4Abdominal fat weight QTL 49.070.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)871888757116888757Rat
8694392Bw161Body weight QTL 1618.060.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)871888757116888757Rat
1549909Stresp11Stress response QTL 116.830.0019stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)873473045118473045Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)876468691121468691Rat
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)882460758122812818Rat
2313400Anxrr25Anxiety related response QTL 25aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)889265192114019816Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)893535351123900184Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)895718998123900184Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)895718998123900184Rat
724539Cm19Cardiac mass QTL 192.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)8100149864120994388Rat
631217Activ1Activity QTL 115.9voluntary movement trait (VT:0003491)number of photobeam interruptions in an experimental apparatus (CMO:0001517)8102370617108923645Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642722214537671Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393213533942Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164747424209747424Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1164747424209747424Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
61341Bp26Blood pressure QTL 26arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169537671214537671Rat
724562Rends1Renal damage susceptibility QTL 10.05kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)1169537671214537671Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1180359209210702199Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
724559Pancm1Pancreatic morphology QTL 17.1islet of Langerhans morphology trait (VT:0005215)pancreatic islet damage composite score (CMO:0001156)1181759564214537555Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1182623426219932796Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1185145134221264292Rat
1359018Hrtrt20Heart rate QTL 203.08heart pumping trait (VT:2000009)heart rate (CMO:0000002)1185356336202902618Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1188377360224054420Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
634338Hcar4Hepatocarcinoma resistance QTL 44.6liver integrity trait (VT:0010547)liver tumorous lesion number to liver area ratio (CMO:0001210)1193422268214537671Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
1358292Cm37Cardiac mass QTL 376.20.00000081heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1331790Bp201Blood pressure QTL 2013.127arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1198211513225126682Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
2292218Kidm35Kidney mass QTL 35kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1199368955224569684Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29271 UniSTS
UniSTS 527286 UniSTS