AA891650 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AA891650

Symbol: AA891650
Previously known as:
RGD ID: 5086471
Expected Size: 145 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2784,757,765 - 84,757,910 (+)MAPPERmRatBN7.2
mRatBN7.22176,566,340 - 176,566,485 (-)MAPPERmRatBN7.2
Rnor_6.02191,596,685 - 191,596,829NCBIRnor6.0
Rnor_6.0792,984,515 - 92,984,659NCBIRnor6.0
Rnor_5.0793,625,058 - 93,625,202UniSTSRnor5.0
Rnor_5.02213,270,164 - 213,270,308UniSTSRnor5.0
RGSC_v3.42183,551,840 - 183,551,984UniSTSRGSC3.4
RGSC_v3.4789,773,966 - 89,774,110UniSTSRGSC3.4
Celera781,597,179 - 81,597,323UniSTS
Celera2174,004,432 - 174,004,576UniSTS
RH 3.4 Map7584.7UniSTS
Cytogenetic Map7q31UniSTS
Is Marker For: Genes:   LOC689360  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AACCTCCTTAACCAGGGACAGTT
Reverse Primer TCCAGTCTTCCCTTTCTTCAGG
 

Region

Nucleotide Sequences
GenBank Nucleotide AC115452 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2114837527185876470Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527185876470Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2135552573202446871Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2136445150202447032Rat
1581502Esta3Estrogen-induced thymic atrophy QTL 3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2136916935189599348Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2141596551202447032Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2143157029210020885Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2143657411190602963Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2143657411190602963Rat
6903312Bw112Body weight QTL 1123.20.0013body mass (VT:0001259)body weight (CMO:0000012)2143657569184114274Rat
61401Niddm2Non-insulin dependent diabetes mellitus QTL 24.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2144599348189599348Rat
1598833Bp295Blood pressure QTL 2953.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147798556192798556Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561221167075Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
1598805Memor8Memory QTL 83exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)2150341585189039377Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150341684202446871Rat
2301966Bp322Blood pressure QTL 3223.58arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150540301202447032Rat
1354609Niddm62Non-insulin dependent diabetes mellitus QTL 624.720.000006insulin secretion trait (VT:0003564)plasma insulin level (CMO:0000342)2150540301202447032Rat
12879836Kidm61Kidney mass QTL 610.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2152413072185122374Rat
12879837Am2Aortic mass QTL 20.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)2152413072185122374Rat
12879838Cm86Cardiac mass QTL 860.002heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2152413072185122374Rat
12879839Cm85Cardiac mass QTL 850.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)2152413072185122374Rat
12879840Bw179Body weight QTL 1790.005body mass (VT:0001259)body weight (CMO:0000012)2152413072185122374Rat
1359032Hrtrt18Heart rate QTL 18heart pumping trait (VT:2000009)heart rate (CMO:0000002)2157142078192625452Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)2157142078211086598Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2157142078226277316Rat
1302793Bw16Body weight QTL 1650.0001body mass (VT:0001259)body weight (CMO:0000012)2157142209202446871Rat
7488925Bp364Blood pressure QTL 3640.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2160564068205564068Rat
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2161699179222436696Rat
7488927Bp365Blood pressure QTL 3650.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2162765032207765032Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2164073756227146641Rat
1598838Bp290Blood pressure QTL 2901.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2166539266211539266Rat
1549833Bp257Blood pressure QTL 2570.003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2168354880185122374Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2168358098223265385Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2168594495213594495Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
631522Bp74Blood pressure QTL 740.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2172710921184114403Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2174930955213594495Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)74486753389867533Rat
738030Anxrr8Anxiety related response QTL 84.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)74659007091590070Rat
2293696Bmd32Bone mineral density QTL 325.10.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)74765143992651439Rat
2293707Bss32Bone structure and strength QTL 327.640.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)74765143992651439Rat
2300178Bmd54Bone mineral density QTL 545.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)74765143992651439Rat
2293644Bmd29Bone mineral density QTL 295.40.0001femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)74765143992651439Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
2293685Bmd21Bone mineral density QTL 214.20.0003femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)74765143992651439Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)753612714103945643Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)761074194106074194Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)762004452101773158Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)762004452101773158Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)768938720113886318Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)768938720113886318Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)768938720113886318Rat
631540Bw9Body weight QTL 94.5body mass (VT:0001259)body weight (CMO:0000012)769736226117455174Rat
1357338Stl17Serum triglyceride level QTL 173.23blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)769736356112729554Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
7411654Foco25Food consumption QTL 259.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
7411607Foco15Food consumption QTL 150.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)775918751120918751Rat
724537Niddm52Non-insulin dependent diabetes mellitus QTL 520.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)78022129993595843Rat
1641908Teswt1Testicular weight QTL 13.28testis mass (VT:1000644)both testes wet weight (CMO:0000175)78022129994811326Rat
631529Tls2T-lymphoma susceptibility QTL 200.001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)780221299109401111Rat
1331746Kidm9Kidney mass QTL 93.934kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)780221299112308525Rat
1331728Bp214Blood pressure QTL 2142.825arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)780221299124373579Rat
1331768Kidm10Kidney mass QTL 104.62096kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)780221299125221299Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)781737938126737938Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 689360 UniSTS
UniSTS 261336 UniSTS