BM384482 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BM384482

Symbol: BM384482
Previously known as:
RGD ID: 5085936
Expected Size: 213 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21185,819,342 - 185,819,555 (+)MAPPERmRatBN7.2
mRatBN7.21159,032,978 - 159,033,191 (+)MAPPERmRatBN7.2
Rnor_6.01169,759,302 - 169,759,514NCBIRnor6.0
Rnor_6.01203,333,721 - 203,333,933NCBIRnor6.0
Rnor_5.01176,772,355 - 176,772,568NCBIRnor5.0
RGSC_v3.41162,410,291 - 162,410,503UniSTSRGSC3.4
Celera1157,016,162 - 157,016,374UniSTS
RH 3.4 Map11290.39UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CACTAAGAGCCCTCCACAGCTT
Reverse Primer TTGAGATGGCTACCTTGGATCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1332871Or52n4eolfactory receptor family 52 subfamily N member 4E1159042896159043864Rat
1334090Or56b37-ps1olfactory receptor family 56 subfamily B member 37, pseudogene 11159068812159069569Rat
1332985Or56b2kolfactory receptor family 56 subfamily B member 2K1159075031159077896Rat
41141466LOC120100117U4 spliceosomal RNA1159079697159079847Rat
1333841Or52n4dolfactory receptor family 52 subfamily N member 4D1159108148159109107Rat
1333881Or52n1olfactory receptor family 52 subfamily N member 11159128222159129187Rat
6500127Usp17la2ubiquitin specific peptidase 17-like a21159151417159155192Rat
41094097Usp17lhubiquitin specific peptidase 17 like H1159158689159162463Rat
41059698Usp17laubiquitin specific peptidase 17-like A1159165961159169738Rat
1588758Usp17l8ubiquitin specific peptidase 17 like family member 81159173249159182920Rat
1333974Or52n3olfactory receptor family 52 subfamily N member 31159196782159197732Rat
1332903Or52n2olfactory receptor family 52 subfamily N member 21159204524159205480Rat
1334174Or52n2d-ps1olfactory receptor family 52 subfamily N member 2D, pseudogene 11159219730159220348Rat
1334393Or52n2folfactory receptor family 52 subfamily N member 2F1159223286159224242Rat
1332599Or52n2bolfactory receptor family 52 subfamily N member 2B1159248753159249718Rat
1332638Or52n2eolfactory receptor family 52 subfamily N member 2E1159256560159257516Rat
1598287Hspa8-ps29heat shock protein family A (Hsp70) member 8, pseudogene 291159266674159268569Rat
1333554Or52n5-ps1olfactory receptor family 52 subfamily N member 5, pseudogene 11159288667159289619Rat
41207204LOC120100221U7 small nuclear RNA1159294824159294888Rat
40951011LOC120100219U7 small nuclear RNA1159294900159294947Rat
1333263Or52e18olfactory receptor family 52 subfamily E member 181159307874159308812Rat
1334060Or52e15olfactory receptor family 52 subfamily E member 151159349202159350140Rat
1334364Or52e8olfactory receptor family 52 subfamily E member 81159360430159361380Rat
1333770Or52e15bolfactory receptor family 52 subfamily E member 15B1159391482159392420Rat
1334024Or52e55-ps1olfactory receptor family 52 subfamily E member 55, pseudogene 11159396920159397344Rat
1333157Or52e15colfactory receptor family 52 subfamily E member 15C1159401875159402816Rat
1333955Or52e8bolfactory receptor family 52 subfamily E member 8B1159412927159413880Rat
1332841Or52e7olfactory receptor family 52 subfamily E member 71159422789159423742Rat
1332760Or52e5olfactory receptor family 52 subfamily E member 51159429383159430324Rat
1332618Or52e7b-ps1olfactory receptor family 52 subfamily E member 7B, pseudogene 11159437067159438014Rat
1332780Or52e4olfactory receptor family 52 subfamily E member 41159454581159455519Rat
1333390Or52e5bolfactory receptor family 52 subfamily E member 5B1159461887159462828Rat
1332687Or56a3bolfactory receptor family 56 subfamily A member 3B1159476168159477115Rat
1334270Or56a41-ps1olfactory receptor family 56 subfamily A member 41, pseudogene 11159481250159481948Rat
1559839Ankrd49-ps3ankyrin repeat domain 49, pseudogene 31159492560159493383Rat
1332789Or56a5olfactory receptor family 56 subfamily A member 51159500672159501610Rat
1332887Olr193olfactory receptor 1931159514613159515554Rat
1334283Or52l1bolfactory receptor family 52 subfamily L member 1B1159543892159544842Rat
1333130Or52x1b-ps1olfactory receptor family 52 subfamily X member 1B, pseudogene 11159554499159555417Rat
1332776Or52l1olfactory receptor family 52 subfamily L member 11159582521159583471Rat
1333835Or52x1olfactory receptor family 52 subfamily X member 11159601106159602059Rat
1333227Or56b6olfactory receptor family 56 subfamily B member 61159619288159620253Rat
1334153Or56b6colfactory receptor family 56 subfamily B member 6C1159635655159636605Rat
1334048Or56b6bolfactory receptor family 56 subfamily B member 6B1159657311159658276Rat
1333229Or52b1olfactory receptor family 52 subfamily B member 11159684419159685363Rat
1332958Or52b2olfactory receptor family 52 subfamily B member 21159695507159696475Rat
1594988Or52w1olfactory receptor family 52 subfamily W member 11159715755159716744Rat
1359585Fhip1bFHF complex subunit HOOK interacting protein 1B1159718679159748449Rat
1561034C1h11orf42similar to human chromosome 11 open reading frame 421159722255159725863Rat
619844Cnga4cyclic nucleotide gated channel subunit alpha 41159752357159756369Rat
11492064LOC108349007uncharacterized LOC1083490071159756929159773172Rat
2290Cckbrcholecystokinin B receptor1159771733159781738Rat
628755Cavin3caveolae associated protein 31159826549159828138Rat
1549719Smpd1sphingomyelin phosphodiesterase 11159892946159896789Rat
2122Apbb1amyloid beta precursor protein binding family B member 11159896889159920505Rat
62040Hpxhemopexin1159932819159940327Rat
70074Trim3tripartite motif-containing 31159950921159973600Rat
1303204Arfip2ADP-ribosylation factor interacting protein 21159974255159980398Rat
71097Timm10btranslocase of inner mitochondrial membrane 10B1159980525159983371Rat
1584052Dnhd1dynein heavy chain domain 11159990785160077990Rat
1308302Rrp8ribosomal RNA processing 81160081092160088709Rat
620063Ilkintegrin-linked kinase1160088839160095140Rat
1305907Taf10TATA-box binding protein associated factor 101160095108160096401Rat
621296Tpp1tripeptidyl peptidase 11160097984160104108Rat
1309878Dchs1dachsous cadherin-related 11160104931160138958Rat
70943Mrpl17mitochondrial ribosomal protein L171160162181160163870Rat
1308274Gvinp1GTPase, very large interferon inducible 11160195394160203003Rat
1583990Egln1-ps2egl-9 family hypoxia-inducible factor 1, pseudogene 21160266448160268021Rat
1598220Gvin1GTPase, very large interferon inducible 11160279767160306701Rat
1582907Rsl24d1-ps2ribosomal L24 domain containing 1, pseudogene 21160336026160337165Rat
1598219Atmin-ps1ATM interactor, pseudogene 11160351454160353967Rat
1333669Or2ag13olfactory receptor family 2 subfamily AG member 131160362110160363057Rat
41166468LOC120099902uncharacterized LOC1200999021160415733160433407Rat
1334348Or2ag16olfactory receptor family 2 subfamily AG member 161160417660160418607Rat
41046890LOC120100116U4 spliceosomal RNA1160433810160433960Rat
1334018Or2ag19bolfactory receptor family 2 subfamily AG member 19B1160458552160459502Rat
1333885Or2ag16bolfactory receptor family 2 subfamily AG member 16B1160476725160477672Rat
1333949Or2ag17b-ps1olfactory receptor family 2 subfamily AG member 17B, pseudogene 11160491806160492754Rat
1333636Or2ag18olfactory receptor family 2 subfamily AG member 181160512174160513124Rat
1332741Or2ag17olfactory receptor family 2 subfamily AG member 171160531819160532769Rat
1333691Or2ag2bolfactory receptor family 2 subfamily AG member 2B1160565659160566609Rat
1334173Or13n4olfactory receptor family 13 subfamily N member 41160570018160570944Rat
1334402Or2ag21-psolfactory receptor family 2 subfamily AG member 21, pseudogene 11160599025160599427Rat
1332902Or13n4bolfactory receptor family 13 subfamily N member 4B1160609645160610571Rat
1333664Or2ag19olfactory receptor family 2 subfamily AG member 191160633102160634052Rat
1333866Or2ag20olfactory receptor family 2 subfamily AG member 201160656583160657530Rat
1332678Olr216-psolfactory receptor pseudogene 2161160669331160670304Rat
6491324Rack1-ps2receptor for activated C kinase 1, pseudogene 21160670664160674437Rat
1332882Or2ag1olfactory receptor family 2 subfamily AG member 11160683723160684673Rat
1332846Or2ag2olfactory receptor family 2 subfamily AG member 21160695621160696571Rat
1334028Or2d3olfactory receptor family 2 subfamily D member 31160701351160702274Rat
1332718Olr220olfactory receptor 2201160730837160731760Rat
1334043Or2d3colfactory receptor family 2 subfamily D member 3C1160756927160757850Rat
1333443Or2d4olfactory receptor family 2 subfamily D member 41160777353160778285Rat
1333522Or6b9olfactory receptor family 6 subfamily B member 91160795402160831530Rat
1333026Or6b6olfactory receptor family 6 subfamily B member 61160812705160813649Rat
1333307Or6i2-ps1olfactory receptor family 6 subfamily I member 2, pseudogene 11160824097160824727Rat
68340Or6a2olfactory receptor family 6 subfamily A member 21160827258160828241Rat
1332598Or10a5olfactory receptor family 10 subfamily A member 51160863556160864509Rat
41060371Trnaa-agc48transfer RNA alanine (anticodon AGC) 481160879981160880061Rat
1333459Or10a5c-ps1olfactory receptor family 10 subfamily A member 5C, pseudogene 11160897439160898390Rat
2324470Tm9sf3-ps1transmembrane 9 superfamily member 3, pseudogene 11160899639160905468Rat
1333075Or2d36bolfactory receptor family 2 subfamily D member 36B1160930225160931169Rat
1334002Or10a2olfactory receptor family 10 subfamily A member 21160948001160948954Rat
1333909Or10a4olfactory receptor family 10 subfamily A member 41160957099160958046Rat
1334160Or2d2bolfactory receptor family 2 subfamily D member 2B1160964638160965585Rat
1333500Or2d2olfactory receptor family 2 subfamily D member 21160979415160980362Rat
6490164Snx18-ps1sorting nexin 18, pseudogene 11161003246161007281Rat
1333621Or2d36olfactory receptor family 2 subfamily D member 361161028174161029118Rat
1598218Nlrp14NLR family, pyrin domain containing 141161069141161089158Rat
41291278LOC120099903uncharacterized LOC1200999031161073386161079124Rat
1598286Rbmxl2Rbmx like 21161116768161118249Rat
6489382Eef1a1-ps10eukaryotic translation elongation factor 1 alpha 1, pseudogene 101161270336161272186Rat
621169Syt9synaptotagmin 91161275882161456384Rat
1311854Olfml1olfactomedin-like 11161478129161502541Rat
1565383Ppfibp2PPFIA binding protein 21161504774161687339Rat
1308421Cyb5r2cytochrome b5 reductase 21161655862161664359Rat
1565730Cdv3l1carnitine deficiency-associated gene expressed in ventricle 3 like 11161678311161681564Rat
1564636Ovch2ovochymase 21161693619161713952Rat
1333421Or5p5bolfactory receptor family 5 subfamily P member 5B1161735695161736633Rat
1334142Or8i6-ps1olfactory receptor family 8 subfamily I member 6, pseudogene 11161737746161738184Rat
1333336Or5p50olfactory receptor family 5 subfamily P member 501161742688161743632Rat
1334107Olr238-psolfactory receptor pseudogene 2381161751470161752093Rat
1334219Or5p5olfactory receptor family 5 subfamily P member 51161759509161760447Rat
1333958Or5p52olfactory receptor family 5 subfamily P member 521161782220161785357Rat
1334165Or5p53olfactory receptor family 5 subfamily P member 531161813580161814512Rat
9444072LOC103691202glyceraldehyde-3-phosphate dehydrogenase pseudogene1161819802161820840Rat
1332645Or5p56olfactory receptor family 5 subfamily P member 561161842163161843095Rat
1333090Or5p56b-ps1olfactory receptor family 5 subfamily P member 56B, pseudogene 11161871812161872744Rat
1332781Or5p6olfactory receptor family 5 subfamily P member 61161900087161901031Rat
1334180Or10ab4olfactory receptor family 10 subfamily AB member 41161927803161928786Rat
1334008Or5p4olfactory receptor family 5 subfamily P member 41161949772161950710Rat
1334362Or5p6bolfactory receptor family 5 subfamily P member 6B1161968555161969499Rat
1334208Or5p84-ps1olfactory receptor family 5 subfamily P member 84, pseudogene 11161974994161975991Rat
1562400Or5p58olfactory receptor family 5 subfamily P member 581162007132162008103Rat
1334370Or5p59olfactory receptor family 5 subfamily P member 591162033893162034840Rat
1333255Or5p66bolfactory receptor family 5 subfamily P member 66B1162053881162054825Rat
1593423Skp2-ps1S-phase kinase-associated protein 2, pseudogene 11162065613162066882Rat
1333639Or5p60colfactory receptor family 5 subfamily P member 60C1162080213162081184Rat
1332743Or5p60bolfactory receptor family 5 subfamily P member 60B1162153461162154426Rat
1332840Or5p61-ps1olfactory receptor family 5 subfamily P member 61, pseudogene 11162179357162180300Rat
1334255Or5p60dolfactory receptor family 5 subfamily P member 60D1162219346162220290Rat
1333699Olr258-psolfactory receptor pseudogene 2581162227180162228025Rat
1333441Or5p66olfactory receptor family 5 subfamily P member 661162235096162236037Rat
1333174Or5p1olfactory receptor family 5 subfamily P member 11162267801162268733Rat
1333278Or8af1-ps1olfactory receptor family 8 subfamily AF member 1, pseudogene 11162273789162274537Rat
1334168Or5p68olfactory receptor family 5 subfamily P member 681162283866162284822Rat
1332928Or5p72olfactory receptor family 5 subfamily P member 721162293541162294485Rat
1334301Or5p73olfactory receptor family 5 subfamily P member 731162325587162326531Rat
1332927Or5p78b-ps1olfactory receptor family 5 subfamily P member 78B, pseudogene 11162357696162358623Rat
1334284Or5p83-ps1olfactory receptor family 5 subfamily P member 83, pseudogene 11162382685162383211Rat
1592241Smapl-ps1small acidic protein like, pseudogene 11162387205162387742Rat
1332813Or5p69bolfactory receptor family 5 subfamily P member 69B1162396498162397442Rat
1333901Or5p78colfactory receptor family 5 subfamily P member 78C1162420650162421594Rat
1334304Or5p75-ps1olfactory receptor family 5 subfamily P member 75, pseudogene 11162438130162439074Rat
1333728Or5p69olfactory receptor family 5 subfamily P member 691162461108162462052Rat
1332950Or5p78olfactory receptor family 5 subfamily P member 781162473821162474765Rat
1333977Or5p79olfactory receptor family 5 subfamily P member 791162479829162480773Rat
1334156Or5p80-ps1olfactory receptor family 5 subfamily P member 80, pseudogene 11162488901162490033Rat
1590087Or5p80olfactory receptor family 5 subfamily P member 801162509473162510405Rat
1592197Or10ab5olfactory receptor family 10 subfamily AB member 51162529010162529975Rat
1333605Or5p81olfactory receptor family 5 subfamily P member 811162544353162545297Rat
1564933Olr271-ps1olfactory receptor 271, pseudogene 11162580418162589573Rat
1332675Or5p76bolfactory receptor family 5 subfamily P member 76B1162591358162592302Rat
1332769Or5p76olfactory receptor family 5 subfamily P member 761162617193162618137Rat
2323421Or5p81bolfactory receptor family 5 subfamily P member 81B1162646352162647296Rat
41285702Olr281-ps1olfactory receptor 281, pseudogene 11162691385162692348Rat
1588967Or5e1olfactory receptor family 5 subfamily E member 11162724328162725263Rat
1588958Gnai2-ps1G protein subunit alpha i2, pseudogene 11162752964162754015Rat
1588954Cops7b-ps2COP9 signalosome subunit 7B, pseudogene 21162757275162758072Rat
1334387Or10a48olfactory receptor family 10 subfamily A member 48B1162793841162794776Rat
1333025Or10a48b-ps1olfactory receptor family 10 subfamily A member 48B, pseudogene 11162825264162826252Rat
2323231Scly-ps1selenocysteine lyase, pseudogene 11162839235162842235Rat
1333156Or10a49olfactory receptor family 10 subfamily A member 491162843548162844492Rat
1333752Or10a3olfactory receptor family 10 subfamily A member 31162856896162857876Rat
1334171Or10a3colfactory receptor family 10 subfamily A member 3C1162870107162871051Rat
1307387Nlrp10NLR family, pyrin domain containing 101162922806162930363Rat
1306112Eif3feukaryotic translation initiation factor 3, subunit F1162934220162943204Rat
3918TubTUB bipartite transcription factor1163008198163030958Rat
1588939Ric3RIC3 acetylcholine receptor chaperone1163030621163086583Rat
11382437LOC108349532high mobility group protein B1 pseudogene1163050054163050871Rat
621166Lmo1LIM domain only 11163132338163168521Rat
41203530LOC120097351uncharacterized LOC1200973511163187266163190378Rat
1590972Stk33serine/threonine kinase 331163276176163458580Rat
41316835LOC120100481small nucleolar RNA U131163428009163428118Rat
1595847Trim66tripartite motif-containing 661163468944163539633Rat
1309771Rpl27aribosomal protein L27A1163539732163542771Rat
41330851Snora3Asmall nucleolar RNA, H/ACA box 3A1163540664163540793Rat
40942925Snora3Bsmall nucleolar RNA, H/ACA box 3B1163541736163541866Rat
1308995Dennd2bDENN domain containing 2B1163544075163734736Rat
1306959Akip1A-kinase interacting protein 11163734730163743648Rat
1565905C1h11orf16similar to human chromosome 11 open reading frame 161163742987163754920Rat
621631Ascl3achaete-scute family bHLH transcription factor 31163755306163755951Rat
1310775Tmem9bTMEM9 domain family, member B1163755307163783880Rat
1304777Nrip3nuclear receptor interacting protein 31163789738163815036Rat
1563998Scube2signal peptide, CUB domain and EGF like domain containing 21163831876163899925Rat
41332604Trnas-aga46transfer RNA serine (anticodon AGA) 461163867257163867330Rat
1306759Dennd5aDENN domain containing 5A1163928183163994207Rat
1310870Tmem41btransmembrane protein 41B1164012585164026967Rat
40961947LOC120100367U2 spliceosomal RNA1164020562164020659Rat
1598285Nhp2-ps5NHP2 ribonucleoprotein, pseudogene 51164051065164052045Rat
1310849Ipo7importin 71164062702164102938Rat
41029790Snora23small nucleolar RNA, H/ACA box 231164091024164091206Rat
1305662Zfp143zinc finger protein 1431164109041164144902Rat
1307895Wee1WEE1 G2 checkpoint kinase1164173681164197688Rat
41171990Rnu6-1168RNA, U6 small nuclear 11681164181113164181219Rat
1305579Swap70switching B-cell complex subunit SWAP701164267588164328796Rat
1588657Sbf2SET binding factor 21164352892164719883Rat
1560265Ybx1-ps18Y box binding protein 1, pseudogene 181164469576164471095Rat
11499584Kmt5a-ps1lysine methyltransferase 5A, pseudogene 11164470159164472142Rat
41067342LOC120097354uncharacterized LOC1200973541164542501164557133Rat
2047Admadrenomedullin1164745484164747655Rat
1588628Kpna1-ps9karyopherin subunit alpha 1, pseudogene 91164788138164789691Rat
11423621LOC108349612uncharacterized LOC1083496121164828353164859432Rat
9142791LOC103691204uncharacterized LOC1036912041164862825164886508Rat
2111Ampd3adenosine monophosphate deaminase 31164884823164929899Rat
1303154rnf141ring finger protein 1411164933972164957081Rat
1310864Lyve1lymphatic vessel endothelial hyaluronan receptor 11164962872164976309Rat
1309828Irag1inositol 1,4,5-triphosphate receptor associated 11164981716165094232Rat
1311097Ctr9CTR9 homolog, Paf1/RNA polymerase II complex component1165137277165167303Rat
1305294Eif4g2eukaryotic translation initiation factor 4, gamma 21165181433165193583Rat
41129599Snord97small nucleolar RNA, C/D box 971165186791165186978Rat
9241707Zbed5l-ps1zinc finger BED-type containing 5 like, pseudogene 11165234060165240783Rat
6489976LOC100911864uncharacterized LOC1009118641165274998165281034Rat
1566189Ftl1l7ferritin light chain 1 like 71165377580165378490Rat
11502966Trnas-gcu1transfer RNA serine (anticodon GCU) 11165571303165571384Rat
11374957LOC108349779keratin-associated protein 10-6-like1165574345165575331Rat
1309623Galnt18polypeptide N-acetylgalactosaminyltransferase 181165593180165904268Rat
40966768LOC120099905uncharacterized LOC1200999051165614823165635270Rat
41014533LOC120100128U6 spliceosomal RNA1165942462165942568Rat
1310411Usp47ubiquitin specific peptidase 471166152104166235312Rat
621846Dkk3dickkopf WNT signaling pathway inhibitor 31166237969166281271Rat
1311773Mical2microtubule associated monooxygenase, calponin and LIM domain containing 21166345853166530575Rat
71021Parvaparvin, alpha1166547142166704958Rat
41376786LOC120100416small nucleolar RNA SNORA171166729024166729154Rat
1549742Tead1TEA domain transcription factor 11166791900167010591Rat
41147698LOC120099907NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2-like1166888513166888812Rat
40927122LOC120099908uncharacterized LOC1200999081166913881166916228Rat
1309847Rassf10Ras association domain family member 101167058277167063591Rat
7694563LOC102547978uncharacterized LOC1025479781167177345167193454Rat
1587415Ckap2-ps3cytoskeleton-associated protein 2, pseudogene 31167203062167213037Rat
41245374LOC120099909uncharacterized LOC1200999091167221216167259345Rat
62003Bmal1basic helix-loop-helix ARNT like 11167331756167430235Rat
1306301Btbd10BTB domain containing 101167431311167489320Rat
40976055Rnu6-26RNA, U6 small nuclear 261167476849167476955Rat
3440Pthparathyroid hormone1167508121167511530Rat
1598284Eno1-ps9enolase 1, pseudogene 91167611484167612975Rat
1306647Far1fatty acyl CoA reductase 11167644622167705868Rat
41120816LOC120099910cytochrome c, somatic-like1167660539167660823Rat
7538108LOC102548137uncharacterized LOC1025481371167724321167750850Rat
1598217Metap2-ps3methionyl aminopeptidase 2, pseudogene 31167766146167768505Rat
7593729LOC102548271uncharacterized LOC1025482711167886561167901539Rat
619918Spon1spondin 11167929049168228239Rat
11466449LOC10834962060S ribosomal protein L31 pseudogene1168146986168147396Rat
1310793Rras2RAS related 21168233693168303111Rat
1598283Rpl27a-ps4ribosomal protein L27a, pseudogene 41168336483168336924Rat
1586255Rps14-ps6ribosomal protein S14, pseudogene 61168339073168339543Rat
1565301Rps18l4ribosomal protein S18-like 41168385938168386642Rat
620861Copb1COPI coat complex subunit beta 11168404334168438589Rat
61841Psma1proteasome 20S subunit alpha 11168442421168453440Rat
41368180Atp5mj-ps1ATP synthase membrane subunit j, pseudogene 11168472019168472630Rat
61943Pde3bphosphodiesterase 3B1168606762168770078Rat
7667300LOC102548890ubiquitin-like protein FUBI-like1168627468168627978Rat
1311866Cyp2r1cytochrome P450, family 2, subfamily r, polypeptide 11168749302168798079Rat
2254Calcacalcitonin-related polypeptide alpha1168878212168883176Rat
620997Calcbcalcitonin-related polypeptide, beta1168965383168970259Rat
1311379InscINSC, spindle orientation adaptor protein1168993032169100438Rat
40942999LOC120100423small nucleolar RNA SNORA171169083085169083212Rat
41367209LOC120097959uncharacterized LOC1200979591169464515169471269Rat
1309000Sox6SRY-box transcription factor 61169723306170334846Rat
40995085Trnav-aac35transfer RNA valine (anticodon AAC) 351169956121169956193Rat
1311703C1h11orf58similar to human chromosome 11 open reading frame 581170334950170346864Rat
1598216Plekha7pleckstrin homology domain containing A71170364524170547843Rat
41271539LOC120099912uncharacterized LOC1200999121170546748170550493Rat
621027Rps13ribosomal protein S131170572925170575355Rat
41025316Snord14asmall nucleolar RNA, C/D box 14A1170574389170574475Rat
1310389Pik3c2aphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha1170577942170684353Rat
6494996LOC100911093CCA tRNA nucleotidyltransferase 1, mitochondrial-like1170720730170722745Rat
620888Nucb2nucleobindin 21170750830170787356Rat
41201048Rnu6-651RNA, U6 small nuclear 6511170936910170937016Rat
41154129LOC120100415small nucleolar RNA SNORA171171168503171168634Rat
41035175LOC120097960uncharacterized LOC1200979601171287279171301330Rat
6486912Ybx1l1Y box binding protein 1 like 11171304587171306092Rat
620093Xylt1xylosyltransferase 11171643925171929774Rat
1586193Gapdh-ps109Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 1091172292417172292996Rat
619939Rps15aribosomal protein S15a1172420151172427021Rat
735205Arl6ip1ADP-ribosylation factor like GTPase 6 interacting protein 11172430475172439990Rat
1563508Smg1SMG1, nonsense mediated mRNA decay associated PI3K related kinase1172441892172543667Rat
7544889LOC102549940uncharacterized LOC1025499401172626577172632763Rat
41302139LOC120099915uncharacterized LOC1200999151172632858172636221Rat
6503302Clec19aC-type lectin domain containing 19A1172667793172677953Rat
708576Syt17synaptotagmin 171172695275172761906Rat
1564255Itpripl2ITPRIP like 21172801152172803047Rat
41171220LOC120099916uncharacterized LOC1200999161172832432172841087Rat
2381Coq7coenzyme Q7, hydroxylase1172836359172851173Rat
1564267Tmc7transmembrane channel-like 71172853531172905796Rat
7701116LOC102550534ubiquitin-like protein FUBI-like1172860549172861181Rat
41283769LOC120099917uncharacterized LOC1200999171172905921172914944Rat
1307037Tmc5transmembrane channel-like 51172914915172999478Rat
621788Gde1glycerophosphodiester phosphodiesterase 11173016984173032396Rat
1310509Ccp110centriolar coiled-coil protein 1101173042238173072873Rat
1564485Vps35lVPS35 endosomal protein sorting factor like1173076219173179663Rat
41014644LOC120100364small nucleolar RNA SNORA241173170301173170415Rat
1565096Knop1lysine-rich nucleolar protein 11173180400173199253Rat
6502881IqckIQ motif containing K1173199308173316982Rat
41297868LOC120100373small nucleolar RNA SNORA441173218181173218293Rat
1309510Gprc5bG protein-coupled receptor, class C, group 5, member B1173316904173340933Rat
7553300LOC102550985uncharacterized LOC1025509851173325465173358499Rat
1311729Gpr139G protein-coupled receptor 1391173478137173522615Rat
41149238LOC120100417small nucleolar RNA SNORA171173643130173643260Rat
621695Gp2glycoprotein 21173797057173812619Rat
3940Umoduromodulin1173816341173829681Rat
1307822Pdiltprotein disulfide isomerase-like, testis expressed1173837477173868685Rat
1309578Acsm5acyl-CoA synthetase medium-chain family member 51173870873173896838Rat
708383Acsm2acyl-CoA synthetase medium-chain family member 21173916368173955116Rat
1559600RGD1559600RGD15596001173973318173988758Rat
1306813Acsm1acyl-CoA synthetase medium-chain family member 11173985715174020565Rat
7656358LOC102551259uncharacterized LOC1025512591173998998174001331Rat
727928Acsm4acyl-CoA synthetase medium-chain family member 41174053931174078345Rat
1308854Thumpd1THUMP domain containing 11174078875174084915Rat
62086Acsm3acyl-CoA synthetase medium-chain family member 31174133260174159966Rat
1583889Eri2ERI1 exoribonuclease family member 21174140831174168757Rat
1305412Rexo5RNA exonuclease 51174168633174264526Rat
1308893Dcun1d3defective in cullin neddylation 1 domain containing 31174243001174285647Rat
1563498Lyrm1LYR motif containing 11174284116174305053Rat
1305855Dnah3dynein, axonemal, heavy chain 31174305929174479490Rat
41178995LOC120100199U6 spliceosomal RNA1174355676174355782Rat
41128770LOC120099919uncharacterized LOC1200999191174417870174439858Rat
7670154Rpa3-ps1replication protein A3, pseudogene 11174474378174475061Rat
727895Ldaf1lipid droplet assembly factor 11174484438174503037Rat
620605Zp2zona pellucida glycoprotein 21174513507174525288Rat
1584204Anks4bankyrin repeat and sterile alpha motif domain containing 4B1174534195174557798Rat
620943Crymcrystallin, mu1174560423174575660Rat
1561491Abca14ATP-binding cassette, subfamily A (ABC1), member 141174577466174683407Rat
1305981Abca15ATP-binding cassette, subfamily A (ABC1), member 151174686666174794395Rat
1588550Hspd1-ps5heat shock protein family D (Hsp60) member 1, pseudogene 51174752712174754893Rat
1563534Abca16ATP-binding cassette, subfamily A (ABC1), member 161174795054174975193Rat
1598215Hnrnpa1-ps9heterogeneous nuclear ribonucleoprotein A1, pseudogene 91174829774174831052Rat
1582803Vmn2r116l-ps36vomeronasal 2, receptor 116 like, pseudogene 361174983856174997928Rat
1582795Ankrd62lankyrin repeat domain 62 like1175074189175162056Rat
40927136Rpl36-ps12ribosomal protein L36, pseudogene1175156882175167650Rat
1359150Uqcrc2ubiquinol cytochrome c reductase core protein 21175167933175198499Rat
1560558Pdzd9PDZ domain containing 91175188270175217491Rat
7606925Mosmomodulator of smoothened1175217680175288521Rat
41159195LOC120100485small nucleolar RNA U131175228635175228731Rat
7663810LOC102555900uncharacterized LOC1025559001175279154175293597Rat
1311670Vwa3avon Willebrand factor A domain containing 3A1175293782175355588Rat
41319484LOC120099921uncharacterized LOC1200999211175343435175352194Rat
6504299Sdr42e2short chain dehydrogenase/reductase family 42E, member 21175361630175382769Rat
11390492Trnal-uag1transfer RNA leucine (anticodon UAG) 11175386163175386244Rat
7669860LOC102556194uncharacterized LOC1025561941175389733175392998Rat
2538Eef2keukaryotic elongation factor-2 kinase1175393119175456756Rat
11384146Trnal-aag1transfer RNA leucine (anticodon AAG) 11175465857175465938Rat
1308086Polr3eRNA polymerase III subunit E1175466091175494679Rat
1310578Cdr2cerebellar degeneration-related protein 21175502837175527746Rat
1582763Mfsd13bmajor facilitator superfamily domain containing 13B1175528077175560263Rat
40990662LOC120100377small nucleolar RNA SNORA211175531005175531140Rat
40962139LOC120100397small nucleolar RNA SNORA481175549477175549618Rat
41267784LOC120100194U6 spliceosomal RNA1175567629175567731Rat
2311609Mettl9methyltransferase 9, His-X-His N1(pi)-histidine1175575805175623065Rat
620663Igsf6immunoglobulin superfamily, member 61175610167175620662Rat
1562741Otoaotoancorin1175642978175710528Rat
11383913LOC108349630uncharacterized LOC1083496301175811711175851645Rat
727787Hs3st2heparan sulfate-glucosamine 3-sulfotransferase 21175956161176077400Rat
41305885Gapdh-ps59Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 591175984378175985956Rat
41380449LOC120099923uncharacterized LOC1200999231176077141176106686Rat
1308183Usp31ubiquitin specific peptidase 311176211334176278183Rat
3641Scnn1gsodium channel epithelial 1 subunit gamma1176304942176338816Rat
3640Scnn1bsodium channel epithelial 1 subunit beta1176430063176484451Rat
1566058Cog7component of oligomeric golgi complex 71176489795176549455Rat
1304800Gga2golgi associated, gamma adaptin ear containing, ARF binding protein 21176552046176585332Rat
1307904Ears2glutamyl-tRNA synthetase 2, mitochondrial1176597986176625848Rat
1306614Ubfd1ubiquitin family domain containing 11176626003176640993Rat
1305619Ndufab1NADH:ubiquinone oxidoreductase subunit AB11176644696176658131Rat
1304759Palb2partner and localizer of BRCA21176665076176689053Rat
1305654Dctn5dynactin subunit 51176689176176705907Rat
3352Plk1polo-like kinase 11176716420176726400Rat
1308743Ern2endoplasmic reticulum to nucleus signaling 21176726454176743289Rat
727796Chp2calcineurin-like EF hand protein 21176757945176772443Rat
3396Prkcbprotein kinase C, beta1176832173177163539Rat
628803Cacng3calcium voltage-gated channel auxiliary subunit gamma 31177201361177297019Rat
41223864LOC120099927uncharacterized LOC1200999271177281328177289987Rat
1311964Rbbp6RB binding protein 6, ubiquitin ligase1177503988177537397Rat
1307268Tnrc6atrinucleotide repeat containing adaptor 6A1177561898177715669Rat
41045503Rnu6-799RNA, U6 small nuclear 7991177586062177586168Rat
40946073LOC120099930uncharacterized LOC1200999301177624419177630543Rat
621410Slc5a11solute carrier family 5 member 111177735511177795193Rat
628767Arhgap17Rho GTPase activating protein 171177807579177897027Rat
735118Lcmt1leucine carboxyl methyltransferase 11177904119177960111Rat
2146Aqp8aquaporin 81177993313177999158Rat
1359568Zkscan2zinc finger with KRAB and SCAN domains 21178006003178028239Rat
1598214Pkm-ps17pyruvate kinase M1/2, pseudogene 171178160227178162181Rat
11422907Hs3st4heparan sulfate-glucosamine 3-sulfotransferase 41178539078178944850Rat
41216593LOC120100422small nucleolar RNA SNORA171178691996178692130Rat
11380105Rpl32-ps5ribosomal protein L32, pseudogene 51178932751178934454Rat
41171888LOC120100410small nucleolar RNA SNORA481179035249179035391Rat
1304666Paip2l1polyadenylate-binding protein-interacting protein 2-like 11179077576179079040Rat
1596000Rps15a-ps9ribosomal protein S15a, pseudogene 91179267937179268386Rat
1598282Hsp90aa1-ps12heat shock protein 90 alpha family class A member 1, pseudogene 121179298331179300568Rat
9134980LOC103691232uncharacterized LOC1036912321179491910179525433Rat
9467587LOC103695038uncharacterized LOC1036950381179567858179588897Rat
7565604LOC102548041uncharacterized LOC1025480411179870042179895619Rat
2304343C1h16orf82similar to human chromosome 16 open reading frame 821179913067179915467Rat
41343776LOC120097358uncharacterized LOC1200973581180007548180011104Rat
1304823Kdm8lysine demethylase 81180013969180028829Rat
1307760Nsmce1NSE1 homolog, SMC5-SMC6 complex component1180030355180058541Rat
9122392LOC103691233uncharacterized LOC1036912331180060750180065930Rat
2899Il4rinterleukin 4 receptor1180115061180139981Rat
41057227LOC120097359uncharacterized LOC1200973591180145598180148961Rat
1304950Il21rinterleukin 21 receptor1180168028180195690Rat
621048Gtf3c1general transcription factor IIIC subunit 11180203995180270201Rat
1595846Katnipkatanin interacting protein1180270194180436766Rat
1562278Gsg1lGSG1-like1180440398180654342Rat
1311491Xpo6exportin 61180672114180761543Rat
11508576LOC108349639uncharacterized LOC1083496391180764861180777765Rat
41179471LOC120099931uncharacterized LOC1200999311180777618180793202Rat
11478799LOC108349640uncharacterized LOC1083496401180783169180807007Rat
628713Sbk1SH3 domain binding kinase 11180807092180851910Rat
7541351LOC102548820uncharacterized LOC1025488201180906441180915707Rat
620802Latlinker for activation of T cells1180936536180941561Rat
1305613Spns1SPNS lysolipid transporter 1, lysophospholipid1180942088180949415Rat
1359096Nfatc2ipnuclear factor of activated T-cells 2 interacting protein1180954834180971847Rat
2320900Rpl36l3ribosomal protein L36 like 31180985733180986204Rat
1309086Cd19CD19 molecule1180987286180993920Rat
621416Rabep2rabaptin, RAB GTPase binding effector protein 21181010305181026651Rat
621293Atp2a1ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 11181026606181044859Rat
620132Sh2b1SH2B adaptor protein 11181048622181057036Rat
1305501TufmTu translation elongation factor, mitochondrial1181073788181077395Rat
1565868Atxn2lataxin 2-like1181078293181090079Rat
3118Mt1-ps1metallothionein 1, pseudogene 11181132896181133270Rat
1308871Eif3ceukaryotic translation initiation factor 3, subunit C1181134604181152489Rat
41098606LOC120100182U6 spliceosomal RNA1181153246181153352Rat
1359537Cln3CLN3 lysosomal/endosomal transmembrane protein, battenin1181156071181169458Rat
1565169Apobrapolipoprotein B receptor1181169019181173206Rat
1561420Il27interleukin 271181173108181178720Rat
41126597Rnu2-62RNA, U2 small nuclear 621181189588181189777Rat
1597558Rpl36a-ps16ribosomal protein L36A, pseudogene 161181198779181200729Rat
69363Nupr1nuclear protein 1, transcriptional regulator1181213292181215327Rat
1310609Sgf29SAGA complex associated factor 291181238458181271931Rat
1595928Dppa3l3developmental pluripotency associated 3 like 31181255033181256222Rat
3767Sult1a1sulfotransferase family 1A member 11181272022181276750Rat
1311568Slx1bSLX1 homolog B, structure-specific endonuclease subunit1181286190181291739Rat
1565363Bola2bolA family member 21181291967181292833Rat
620009Coro1acoronin 1A1181295561181300566Rat
11363866LOC108349642uncharacterized LOC1083496421181314109181322318Rat
3046Mapk3mitogen activated protein kinase 31181366646181372863Rat
1308386Gdpd3glycerophosphodiester phosphodiesterase domain containing 31181373505181383063Rat
1564579Ypel3yippee-like 31181384385181387706Rat
1307716Tbx6T-box transcription factor 61181387851181392762Rat
621225Ppp4cprotein phosphatase 4, catalytic subunit1181392899181399703Rat
2089Aldoaaldolase, fructose-bisphosphate A1181402275181407476Rat
9213265LOC103691235uncharacterized LOC1036912351181402275181421545Rat
41298058LOC120100124U6 spliceosomal RNA1181409122181409228Rat
1308215Tlcd3bTLC domain containing 3B1181421104181439744Rat
1563217C1h16orf92similar to human chromosome 16 open reading frame 921181434524181441000Rat
620518Doc2adouble C2 domain alpha1181457415181462528Rat
1359572Ino80eINO80 complex subunit E1181461406181472059Rat
1306463Hirip3HIRA interacting protein 31181472537181475082Rat
621590Taok2TAO kinase 21181475708181494738Rat
1560566Tmem219transmembrane protein 2191181496195181509259Rat
11415131LOC108349643uncharacterized LOC1083496431181508682181514176Rat
735189Kctd13potassium channel tetramerization domain containing 131181534534181552843Rat
1306636Asphd1aspartate beta-hydroxylase domain containing 11181552968181556902Rat
1565281Sez6l2seizure related 6 homolog like 21181557109181577456Rat
7676737CdiptosCDIP transferase, opposite strand1181579385181583017Rat
620576CdiptCDP-diacylglycerol--inositol 3-phosphatidyltransferase1181583098181587409Rat
70932Mvpmajor vault protein1181594734181622336Rat
1305592Pagr1Paxip1-associated glutamate-rich protein 11181622698181625024Rat
1564195Prrt2proline-rich transmembrane protein 21181625243181628833Rat
1594632MazMYC associated zinc finger protein1181629742181635193Rat
1311886Kif22kinesin family member 221181635347181650351Rat
11480240LOC108349644uncharacterized LOC1083496441181649574181655535Rat
620346Zg16zymogen granule protein 161181657722181660079Rat
1591907Psme2-ps3proteasome activator subunit 2, pseudogene 31181699598181701538Rat
1564503C1h16orf54similar to human chromosome 16 open reading frame 541181702447181705128Rat
1310309Qprtquinolinate phosphoribosyltransferase1181718189181733486Rat
40974486LOC120099934uncharacterized LOC1200999341181728557181731580Rat
3750Spnsialophorin1181746937181759564Rat
1311741Cd2bp2Cd2 (cytoplasmic tail) binding protein 21181809399181815269Rat
1309191Tbc1d10bTBC1 domain family, member 10b1181814972181826628Rat
3141Myl11myosin light chain 111181829703181832546Rat
1307216Septin1septin 11181832700181836566Rat
9115869Znf48zinc finger protein 481181854481181858987Rat
1305903Zfp771zinc finger protein 7711181864035181875136Rat
620933Dctpp1dCTP pyrophosphatase 11181877440181880833Rat
1308827Sephs2selenophosphate synthetase 21181893146181895464Rat
1598280Ndufa13-ps4NADH:ubiquinone oxidoreductase subunit A13, pseudogene 41181908186181908668Rat
2319903Ankrd37-ps1ankyrin repeat domain 37, pseudogene 11181915673181916779Rat
631424Itgalintegrin subunit alpha L1181918183181955735Rat
7609558Zfp768zinc finger protein 7681181966314181968950Rat
1594599Zfp764l1zinc finger protein 764 like 11182003282182005886Rat
7540019Zfp764zinc finger protein 7641182009002182013169Rat
9416532LOC103695040eukaryotic translation initiation factor 1 pseudogene1182013409182018191Rat
7690555Odc1-ps5ornithine decarboxylase 1, pseudogene 51182021072182023661Rat
1310765Zfp688zinc finger protein 6881182039366182043035Rat
628696Zfp689zinc finger protein 6891182065885182074343Rat
1594592Prr14proline rich 141182083838182089330Rat
1594591Fbrsfibrosin1182090741182104026Rat
41270294LOC120099937uncharacterized LOC1200999371182104306182122935Rat
1565642SrcapSnf2-related CREBBP activator protein1182123562182172643Rat
41103194Snora30small nucleolar RNA, H/ACA box 301182139388182139521Rat
7523242Tmem265transmembrane protein 2651182172704182176600Rat
620024Phkg2phosphorylase kinase catalytic subunit gamma 21182184362182197124Rat
1593368Cfap119cilia and flagella associated protein 1191182197171182216936Rat
628638Rnf40ring finger protein 401182202475182217899Rat
1306257Zfp629zinc finger protein 6291182217499182258585Rat
41326170LOC1201003285S ribosomal RNA1182252145182252263Rat
1308439Bcl7cBAF chromatin remodeling complex subunit BCL7C1182277163182324274Rat
9685081Mir762microRNA 7621182323863182323937Rat
2442Ctf1cardiotrophin 11182328035182336346Rat
1308254Ctf2cardiotrophin 21182334061182342406Rat
1310989Fbxl19F-box and leucine-rich repeat protein 191182356899182380839Rat
1306538Orai3ORAI calcium release-activated calcium modulator 31182381196182386055Rat
1311624Setd1aSET domain containing 1A, histone lysine methyltransferase1182386197182411695Rat
628727Hsd3b7hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 71182412216182415447Rat
3784Stx1bsyntaxin 1B1182415544182434385Rat
621019Stx4syntaxin 41182451108182459701Rat
1308623Zfp668zinc finger protein 6681182474633182484957Rat
1561579Zfp646zinc finger protein 6461182485009182494961Rat
1566127Prss53serine protease 531182494944182501607Rat
1303107Vkorc1vitamin K epoxide reductase complex, subunit 11182502491182505012Rat
2198Bckdkbranched chain ketoacid dehydrogenase kinase1182515335182520007Rat
1311512Kat8lysine acetyltransferase 81182524355182536638Rat
619973Prss8serine protease 81182536229182540745Rat
1593186Prss36serine protease 361182543085182561141Rat
1308864FusFus RNA binding protein1182576479182590417Rat
628637PycardPYD and CARD domain containing1182601657182603013Rat
41368305LOC120099938uncharacterized LOC1200999381182611965182616488Rat
1562778Trim72tripartite motif containing 721182613753182621613Rat
41367722LOC120099939uncharacterized LOC1200999391182637160182642709Rat
7624587LOC102556135uncharacterized LOC1025561351182651431182657380Rat
41357835Rnu1-140RNA, U1 small nuclear 1401182658147182658307Rat
2926Itgamintegrin subunit alpha M1182659047182709501Rat
1561123Itgaxintegrin subunit alpha X1182709653182740709Rat
71075Itgadintegrin subunit alpha D1182759762182788422Rat
2385Cox6a2cytochrome c oxidase subunit 6A21182788528182790746Rat
90746049130023H24RikRIKEN cDNA 9130023H24 gene like1182809465182820548Rat
1306553Armc5armadillo repeat containing 51182820141182826913Rat
620173Tgfb1i1transforming growth factor beta 1 induced transcript 11182828553182835465Rat
620217Slc5a2solute carrier family 5 member 21182847185182853309Rat
1310127Rusf1RUS family member 11182852257182881652Rat
1306725Ahspalpha hemoglobin stabilizing protein1182879901182885508Rat
40967984LOC120099940uncharacterized LOC1200999401182890478182896780Rat
9242866LOC103691239uncharacterized LOC1036912391182934054182937398Rat
3562Rgs10regulator of G-protein signaling 101182946334182987729Rat
1595845Tial1Tia1 cytotoxic granule-associated RNA binding protein-like 11183008358183045092Rat
1596229Rps2-ps13ribosomal protein S2, pseudogene 131183041102183041973Rat
11482889LOC10834978340S ribosomal protein S19 pseudogene1183046566183051192Rat
1307794Bag3BAG cochaperone 31183103038183126862Rat
1305777Inpp5finositol polyphosphate-5-phosphatase F1183190480183270276Rat
1306730Mcmbpminichromosome maintenance complex binding protein1183270598183316975Rat
41171707LOC120100354small nucleolar RNA SNORA36 family1183310598183310728Rat
1309328Sec23ipSEC23 interacting protein1183320950183363944Rat
41346008LOC120100487small nucleolar RNA U1091183371628183371752Rat
11426694LOC108349652uncharacterized LOC1083496521183588849183601186Rat
1306289Plpp4phospholipid phosphatase 41183829794183959319Rat
1593335Parl-ps1presenilin associated, rhomboid-like, pseudogene 11183970720183973464Rat
41149849LOC120098013uncharacterized LOC1200980131184024534184029616Rat
9370590LOC103691243uncharacterized LOC1036912431184081122184090817Rat
1587347Wdr11WD repeat domain 111184165260184210834Rat
41136694LOC120099941uncharacterized LOC1200999411184226008184228759Rat
7704573Ska2l1spindle and kinetochore associated complex subunit 2 like 11184226732184300750Rat
7732136LOC102555965uncharacterized LOC1025559651184499296184507745Rat
41270156LOC120100399small nucleolar RNA SNORA481184576350184576490Rat
2611Fgfr2fibroblast growth factor receptor 21184745418184850655Rat
6494949LOC100911081uncharacterized LOC1009110811184919721184921647Rat
1309335Ate1arginyltransferase 11184961548185081112Rat
11478122LOC108349649glyceraldehyde-3-phosphate dehydrogenase pseudogene1185016384185017383Rat
1563285RGD1563285similar to RIKEN cDNA 1700022C211185084823185091961Rat
1309025Nsmce4aNSE4 homolog A, SMC5-SMC6 complex component1185102075185109166Rat
1303004Tacc2transforming, acidic coiled-coil containing protein 21185139223185327881Rat
41366349Trnap-agg25transfer RNA proline (anticodon AGG) 251185164152185164232Rat
9097294LOC103691241uncharacterized LOC1036912411185235012185242949Rat
1311454Btbd16BTB domain containing 161185334971185389518Rat
1564153Plekha1pleckstrin homology domain containing A11185427982185479157Rat
69235Htra1HtrA serine peptidase 11185497815185547380Rat
61984Dmbt1deleted in malignant brain tumors 11185617469185696476Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
631206Niddm40Non-insulin dependent diabetes mellitus QTL 40blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1136745990163747690Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
634315Niddm45Non-insulin dependent diabetes mellitus QTL 457.16blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1144267916172949660Rat
61379Bp44Blood pressure QTL 4419.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144267916174133260Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
1582204Livw1Liver weight QTL 13.60.0003liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)1155422851172949803Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
631548Bp88Blood pressure QTL 8850.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1156677124176484451Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393213533942Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164747424209747424Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1164747424209747424Rat
737974Bp161Blood pressure QTL 1610.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1164747558181133855Rat
2312558Glom17Glomerulus QTL 173.90.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1166532971191278129Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169112897197261052Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1169112897197261052Rat
61341Bp26Blood pressure QTL 26arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169537671214537671Rat
724562Rends1Renal damage susceptibility QTL 10.05kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)1169537671214537671Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
61326Eae6Experimental allergic encephalomyelitis QTL 65.3body mass (VT:0001259)change in body weight (CMO:0002045)1172949660181830018Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
631670Iddm10Insulin dependent diabetes mellitus QTL 101.9blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1174133260196383668Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
2325727Pia41Pristane induced arthritis QTL 41joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1178810256180814005Rat
2325725Eae31Experimental allergic encephalomyelitis QTL 31nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1178810256188377506Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1180359209210702199Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
61378Bp43Blood pressure QTL 4322.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1181746937196383668Rat
724559Pancm1Pancreatic morphology QTL 17.1islet of Langerhans morphology trait (VT:0005215)pancreatic islet damage composite score (CMO:0001156)1181759564214537555Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1182623426219932796Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1185145134221264292Rat
1359018Hrtrt20Heart rate QTL 203.08heart pumping trait (VT:2000009)heart rate (CMO:0000002)1185356336202902618Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat


Additional Information

Database Acc Id Source(s)
UniSTS 261014 UniSTS