AW531802 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AW531802

Symbol: AW531802
Previously known as:
RGD ID: 5085147
Expected Size: 151 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.281,921,117 - 1,921,268 (+)MAPPERmRatBN7.2
mRatBN7.2154,615,370 - 4,615,517 (-)MAPPERmRatBN7.2
Rnor_6.081,933,354 - 1,933,504NCBIRnor6.0
Rnor_5.081,956,740 - 1,956,890UniSTSRnor5.0
Celera81,800,389 - 1,800,539UniSTS
Celera15250 - 399UniSTS
RH 3.4 Map1568.9UniSTS
Cytogenetic Map15p16UniSTS
Cytogenetic Map8q11UniSTS
Is Marker For: Genes:   Gria4   Spetex2f   Spetex2e  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGTGTTCTGTAGTATCTCCCAGGAA
Reverse Primer CCCTGAAAGGTCTTGCAATTTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
61863Gria4glutamate ionotropic receptor AMPA type subunit 4815621182035035Rat

Nucleotide Sequences
GenBank Nucleotide CH474418.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474705.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
71120Niddm21Non-insulin dependent diabetes mellitus QTL 213.73blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)813402289Rat
9590084Insglur5Insulin/glucose ratio QTL 518.540.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)8124597739Rat
2317882Alcrsp24Alcohol response QTL 243.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)8125902202Rat
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)15226636822711984Rat
5684946Bss98Bone structure and strength QTL 983.90.0026tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)15105825014481294Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15142356671Rat
731170Pur3Proteinuria QTL 32.30.0005urine protein amount (VT:0005160)urine protein excretion rate (CMO:0000759)15141686771Rat
738017Hcas7Hepatocarcinoma susceptibility QTL 72.91liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)15226636846921453Rat
9589149Insul29Insulin level QTL 299.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)15134723002Rat
71120Niddm21Non-insulin dependent diabetes mellitus QTL 213.73blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)813402289Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1530632945306329Rat
1354657Despr13Despair related QTL 130.0022locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)15129912054Rat
9590084Insglur5Insulin/glucose ratio QTL 518.540.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)8124597739Rat
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)15155302115Rat
2317882Alcrsp24Alcohol response QTL 243.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)8125902202Rat
8552920Pigfal8Plasma insulin-like growth factor 1 level QTL 83blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)15134723002Rat
8694361Abfw6Abdominal fat weight QTL 610.20.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)15134723002Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29629 UniSTS
  316940 UniSTS
  361012 UniSTS
UniSTS 260537 UniSTS