BE119243 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BE119243

Symbol: BE119243
Previously known as:
RGD ID: 5082357
Expected Size: 182 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25103,893,165 - 103,893,330 (+)MAPPERmRatBN7.2
mRatBN7.21059,686,265 - 59,686,447 (+)MAPPERmRatBN7.2
Rnor_6.01061,671,922 - 61,672,103NCBIRnor6.0
Rnor_6.05107,731,219 - 107,731,383NCBIRnor6.0
Rnor_5.01061,393,658 - 61,393,839UniSTSRnor5.0
Rnor_5.05111,699,803 - 111,699,967UniSTSRnor5.0
RGSC_v3.45108,808,872 - 108,809,036UniSTSRGSC3.4
RGSC_v3.41062,133,263 - 62,133,444UniSTSRGSC3.4
Celera1058,716,802 - 58,716,983UniSTS
Celera5102,608,004 - 102,608,168UniSTS
Cytogenetic Map10q24UniSTS
Cytogenetic Map5q32UniSTS
Is Marker For: Genes:   Mtap   Mettl16   LOC100365303   LOC100362816  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCGTAGACTGACCTTACACCCA
Reverse Primer AGCTTGCTTTGGAGGTAGAACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310114Mtapmethylthioadenosine phosphorylase5103874460103920684Rat
1593242Mettl16methyltransferase 16, RNA N6-adenosine105964091559697291Rat

Nucleotide Sequences
RefSeq Transcripts XR_085570 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide CR937047 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
1576317Eutr2Estrogen induced uterine response QTL 20.01uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)534730116104251008Rat
2316959Gluco59Glucose level QTL 594.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)534944474113558310Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
1331801Rf33Renal function QTL 334.149kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)543726656129132602Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
1358895Bp254Blood pressure QTL 2543.60.0003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)558829236128034027Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
2316957Pur21Proteinuria QTL 216.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)559793528113558156Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
2290005Mcs24Mammary carcinoma susceptibility QTL 24mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)564719390109719390Rat
2306971Anxrr21Anxiety related response QTL 219.47fear/anxiety-related behavior trait (VT:1000241)number of entries into a discrete space in an experimental apparatus (CMO:0000960)566174080124160948Rat
2312671Scl64Serum cholesterol level QTL 640.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)568984307104251008Rat
61380Edpm5Estrogen-dependent pituitary mass QTL 54.50.92pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)568984307104251008Rat
1357396Bw44Body weight QTL 444.19body mass (VT:0001259)body weight (CMO:0000012)568984307104251008Rat
1357402Bw46Body weight QTL 464.47body mass (VT:0001259)body mass index (BMI) (CMO:0000105)568984307104251008Rat
2302381Bw84Body weight QTL 844.47body mass (VT:0001259)body mass index (BMI) (CMO:0000105)568984307104251008Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
1298070Scl18Serum cholesterol level QTL 183.7blood LDL cholesterol amount (VT:0000181)calculated plasma low density lipoprotein cholesterol level (CMO:0001245)579584860124584860Rat
1598846Bp293Blood pressure QTL 2933.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)579584860124584860Rat
1598859Cm66Cardiac mass QTL 662heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)579584860124584860Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1298086Bp156Blood pressure QTL 156arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)584132602129132602Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)587468046132468046Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)587765973132765973Rat
1358889Bp261Blood pressure QTL 2612.86arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)590067849128034027Rat
1358909Kidm25Kidney mass QTL 251.87kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)590067849128034027Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)590450144135450144Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)597570330136479578Rat
1582212Livw2Liver weight QTL 23.50.0004liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)599016066119085810Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
7394708Emca11Estrogen-induced mammary cancer QTL 11mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)599753548113061097Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10580199062146030Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101502851360430477Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101527595560275955Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101816784163167841Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101960648364606483Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101960648364606483Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102132980561345413Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102652195761345413Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102652195798952741Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102694462871944628Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102845313673453136Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102929950464155584Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103063205375632053Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103122402675632053Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103397392178973921Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103539226764155584Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103539245763642539Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)103756507982565079Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)103756507982565079Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)104114263386142633Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104133325886333258Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104194452678307017Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14232313287323132Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104232313287323132Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)104287676679813922Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104444169989441699Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104444169989441699Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104444169989441699Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104502965095600334Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104736947092369470Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)104944455181709989Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)104944455181709989Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)104944455181709989Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
70364Bp72Blood pressure QTL 72arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105112110096121100Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1051770177107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)105177294096772940Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)105177461295600334Rat
631535Cm51Cardiac mass QTL 513heart mass (VT:0007028)calculated heart weight (CMO:0000073)105178628291669536Rat
2306787Ean3Experimental allergic neuritis QTL 33.1nervous system integrity trait (VT:0010566)body weight loss (CMO:0001399)105379738566979128Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
70164Bw21Body weight QTL 214.360.00005body mass (VT:0001259)body weight (CMO:0000012)105379749498952626Rat
1354608Cm33Cardiac mass QTL 332.8heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)105480929299809292Rat
2298495Eae23Experimental allergic encephalomyelitis QTL 2316.93nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis duration (CMO:0001424)105527369660677262Rat
2312662Slep8Serum leptin concentration QTL 80.05blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1057134272102134272Rat
2312668Scl65Serum cholesterol level QTL 650.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1057134272102134272Rat
2312672Insul15Insulin level QTL 150.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1057134272102134272Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1057576521102576521Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100362816 UniSTS
  100365303 UniSTS
  298227 UniSTS
  360568 UniSTS
UniSTS 249135 UniSTS