BE118755 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BE118755

Symbol: BE118755
Previously known as:
RGD ID: 5081919
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2339,783,267 - 39,783,417 (+)MAPPERmRatBN7.2
mRatBN7.22189,643,290 - 189,643,440 (+)MAPPERmRatBN7.2
Rnor_6.02204,632,060 - 204,632,209NCBIRnor6.0
Rnor_6.0340,854,279 - 40,854,428NCBIRnor6.0
Rnor_5.0345,940,419 - 45,940,568UniSTSRnor5.0
Rnor_5.02224,064,398 - 224,064,547UniSTSRnor5.0
RGSC_v3.42197,301,752 - 197,301,901UniSTSRGSC3.4
RGSC_v3.4336,904,312 - 36,904,461UniSTSRGSC3.4
Celera337,898,416 - 37,898,565UniSTS
Celera2182,075,670 - 182,075,819UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTTGCTCCTTGTAGCCTTCTC
Reverse Primer ACCAGATTAACCTGTGGACAAGC
 

Region

Nucleotide Sequences
GenBank Nucleotide FT007361 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2161699179222436696Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2168358098223265385Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2136445150202447032Rat
61458Bp10Blood pressure QTL 103.42arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2143657411190602963Rat
1302793Bw16Body weight QTL 1650.0001body mass (VT:0001259)body weight (CMO:0000012)2157142209202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2135552573202446871Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)2157142078211086598Rat
4889834Pur24Proteinuria QTL 245.80.014urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)2184114274202447032Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2189599258226936289Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2185876309219753474Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2182171407227171407Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2182171407227171407Rat
1359032Hrtrt18Heart rate QTL 18heart pumping trait (VT:2000009)heart rate (CMO:0000002)2157142078192625452Rat
2301966Bp322Blood pressure QTL 3223.58arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150540301202447032Rat
1298083Bp158Blood pressure QTL 1582.62arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2189599258218414891Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2189599258234599258Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2182171407227171407Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2179335906224335906Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2157142078226277316Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150341684202446871Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2168594495213594495Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2141596551202447032Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2143157029210020885Rat
7488929Bp366Blood pressure QTL 3660.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2184974550193094998Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2184165752229165752Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189599258234599258Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561221167075Rat
1354609Niddm62Non-insulin dependent diabetes mellitus QTL 624.720.000006insulin secretion trait (VT:0003564)plasma insulin level (CMO:0000342)2150540301202447032Rat
1598833Bp295Blood pressure QTL 2953.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147798556192798556Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2179946951224946951Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2182171407227171407Rat
7488927Bp365Blood pressure QTL 3650.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2162765032207765032Rat
1598838Bp290Blood pressure QTL 2901.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2166539266211539266Rat
7488925Bp364Blood pressure QTL 3640.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2160564068205564068Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2164073756227146641Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2174930955213594495Rat
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2161699179222436696Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2168358098223265385Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32749462144188411Rat
61458Bp10Blood pressure QTL 103.42arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
631568Bp92Blood pressure QTL 922.20.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3139874793Rat
1302793Bw16Body weight QTL 1650.0001body mass (VT:0001259)body weight (CMO:0000012)2157142209202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2135552573202446871Rat
10450816Scl75Serum cholesterol level QTL 754.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)2157142078211086598Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2182171407227171407Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31831145447233430Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31831145447233430Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31831145447233430Rat
2301966Bp322Blood pressure QTL 3223.58arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150540301202447032Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31831145447233430Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)31077870450302886Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31831145447233430Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31831145447233430Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31831145447233430Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32824968773249687Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2189599258218414891Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2182171407227171407Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33142640370668733Rat
10450852Stl33Serum triglyceride level QTL 333.40.05blood LDL triglyceride amount (VT:0010699)blood lipoprotein triglyceride level (CMO:0002685)33819223350749747Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33142640370668733Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33142640370668733Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
4889975Bmd81Bone mineral density QTL 814.3tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)33871036550302886Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2179335906224335906Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33142640370668733Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33142640370668733Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32793691972936919Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2168594495213594495Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)33945463789115240Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33370334778196190Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32846857173468571Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32846857173468571Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2143157029210020885Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)33945463789115240Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33068464275684642Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32749462150302886Rat
1354609Niddm62Non-insulin dependent diabetes mellitus QTL 624.720.000006insulin secretion trait (VT:0003564)plasma insulin level (CMO:0000342)2150540301202447032Rat
2302276Bw82Body weight QTL 824.32body mass (VT:0001259)body weight (CMO:0000012)33945463762951183Rat
1598833Bp295Blood pressure QTL 2953.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2147798556192798556Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1598838Bp290Blood pressure QTL 2901.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2166539266211539266Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32824968773249687Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31695470861954708Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2164073756227146641Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333703347104104347Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2174930955213594495Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2136445150202447032Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
10043136Iddm54Insulin dependent diabetes mellitus QTL 543.40.0001blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2143657411190602963Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32824968773249687Rat
4889834Pur24Proteinuria QTL 245.80.014urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)2184114274202447032Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2189599258226936289Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2185876309219753474Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2182171407227171407Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)32749462150302886Rat
1359032Hrtrt18Heart rate QTL 18heart pumping trait (VT:2000009)heart rate (CMO:0000002)2157142078192625452Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33068464275684642Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32749462150302886Rat
1298083Bp158Blood pressure QTL 1582.62arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2189599258234599258Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2157142078226277316Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150341684202446871Rat
634317Bw117Body weight QTL 1173.58abdominal fat pad mass (VT:1000711)abdominal fat pad weight to body weight ratio (CMO:0000095)33945463753296578Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2141596551202447032Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
7488929Bp366Blood pressure QTL 3660.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2184974550193094998Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2184165752229165752Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189599258234599258Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33370334761017857Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561221167075Rat
10450813Scl74Serum cholesterol level QTL 745.80.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)33851780383517803Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2179946951224946951Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32824968773249687Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2182171407227171407Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)33035677398535386Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
7488927Bp365Blood pressure QTL 3650.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2162765032207765032Rat
7488925Bp364Blood pressure QTL 3640.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2160564068205564068Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32824968773249687Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33142640370668733Rat


Additional Information

Database Acc Id Source(s)
UniSTS 248880 UniSTS