BF414488 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: BF414488

Symbol: BF414488
Previously known as:
RGD ID: 5081659
Expected Size: 167 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23139,665,302 - 139,666,791 (+)MAPPERmRatBN7.2
Rnor_6.03146,636,286 - 146,637,774NCBIRnor6.0
Rnor_5.03152,995,199 - 152,996,687UniSTSRnor5.0
RGSC_v3.43141,474,876 - 141,476,364UniSTSRGSC3.4
Celera3138,427,048 - 138,428,536UniSTS
RH 3.4 Map31195.21UniSTS
Cytogenetic Map3q41UniSTS
Is Marker For: Genes:   Abhd12  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGGAGACTCCAATATAAGGGCA
Reverse Primer GCATGACATATGATGCACTCCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562570Abhd12abhydrolase domain containing 12, lysophospholipase3139659315139719529Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
1578653Vnigr3Vascular neointimal growth QTL 33.1artery morphology trait (VT:0002191)artery neointimal hyperplastic lesion area (CMO:0001414)3130656562169034231Rat
1598877Bp285Blood pressure QTL 2851.50.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3120538241165538241Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
2298477Eau4Experimental allergic uveoretinitis QTL 40.0011uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)3137398739169034231Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
1578754Stresp16Stress response QTL 1640.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)3112681431157681431Rat
1300173Rf11Renal function QTL 113.38renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)3121056165145956249Rat
9589106Insul23Insulin level QTL 2313.860.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)3131635904169034231Rat
10755461Coatc16Coat color QTL 16coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)3122438700167438700Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
2303620Vencon4Ventilatory control QTL 43.9respiration trait (VT:0001943)tidal volume (CMO:0000222)3127162703168026850Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
1576306Schws3Schwannoma susceptibility QTL 30.001nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)3118839124163839124Rat
619618Rf3Renal disease susceptibility QTL 36.50.001urine albumin amount (VT:0002871)urine albumin excretion rate to body weight ratio (CMO:0001270)3107693393152693393Rat
1300159Kidm4Kidney mass QTL 43.83kidney mass (VT:0002707)right kidney wet weight to body weight ratio (CMO:0001953)3121056165157309487Rat
631673Iddm13Insulin dependent diabetes mellitus QTL 131.30.663blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)3130193298161695983Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
1578656Vnigr2Vascular neointimal growth QTL 24.2artery morphology trait (VT:0002191)lesioned artery residual lumen area (CMO:0001417)3130656562169034231Rat
8552952Pigfal13Plasma insulin-like growth factor 1 level QTL 13blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)3138799500169034231Rat
631541Bp81Blood pressure QTL 814arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3124122556169034231Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499913 UniSTS