RH141809 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH141809

Symbol: RH141809
Previously known as: AI069917; 
RGD ID: 5080834
Expected Size: 180 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21216,907,618 - 16,907,812 (+)MAPPERmRatBN7.2
mRatBN7.21146,645,948 - 146,646,128 (+)MAPPERmRatBN7.2
Rnor_6.01157,416,788 - 157,416,967NCBIRnor6.0
Rnor_6.01219,173,043 - 19,173,236NCBIRnor6.0
Rnor_5.01221,231,854 - 21,232,047UniSTSRnor5.0
Rnor_5.01163,660,936 - 163,661,115UniSTSRnor5.0
RGSC_v3.41149,423,690 - 149,423,869UniSTSRGSC3.4
RGSC_v3.41217,468,350 - 17,468,543UniSTSRGSC3.4
Celera1218,845,556 - 18,845,749UniSTS
Celera1144,825,489 - 144,825,668UniSTS
Cytogenetic Map1q32UniSTS
Cytogenetic Map12q11UniSTS
Is Marker For: Genes:   Gjc3   Ccdc90b  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGCACTTCTATCTCAAGCCAGG
Reverse Primer GGTTCTGGAAGGAGAACTGACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
727930Gjc3gap junction protein, gamma 3121689984616912309Rat
7581366Ccdc90b-ps1coiled-coil domain containing 90B, pseudogene 1121690674816908225Rat
1308637Ccdc90bcoiled-coil domain containing 90B1146632756146646314Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12119611090Rat
10755457Coatc14Coat color QTL 140.01759coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)12122591684Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12123297788Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12129333307Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6556449546669029Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449846669029Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12610757946669029Rat
1600391Edcs2Endometrial carcinoma susceptibility QTL23.50.01uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)12683319017870186Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12719673046669029Rat
2293086Iddm30Insulin dependent diabetes mellitus QTL 303.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)12844949028302290Rat
61331Eau2Experimental allergic uveoretinitis QTL 20.0005uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)12852542328064601Rat
1300157Rf21Renal function QTL 214.4renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)12931821632103380Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)12960327746669029Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121047413746669029Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121047413746669029Rat
1331786Kidm11Kidney mass QTL 113.571kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)121107382524234895Rat
1331755Bp219Blood pressure QTL 2193.041arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382528064557Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382545055165Rat
61404Bw120Body weight QTL 1205.1body mass (VT:0001259)body mass index (BMI) (CMO:0000105)121235161946669029Rat
1641928Alcrsp5Alcohol response QTL 5response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)121281238546669029Rat
2303569Gluco44Glucose level QTL 442blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121281238546669029Rat
7204484Bp358Blood pressure QTL 3580.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121300829619212979Rat
1549902Bp269Blood pressure QTL 269arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121318273646669029Rat
1549912Bp268Blood pressure QTL 268arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)101318273646669029Rat
2302060Pia37Pristane induced arthritis QTL 376.10.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)121319815746669029Rat
61416Pia4Pristane induced arthritis QTL 48.4joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)121363552330827399Rat
61421Cia12Collagen induced arthritis QTL 124.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121363552335682913Rat
61443Btemp2Thermal response to stress QTL 23.30.000094body temperature trait (VT:0005535)core body temperature (CMO:0001036)121502518320794014Rat
631543Bp83Blood pressure QTL 835.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121555082638478808Rat
2293684Bmd26Bone mineral density QTL 264.40.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)121587265332974238Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
2303591Gluco41Glucose level QTL 412blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1102168504147168504Rat
61370Mcs3Mammary carcinoma susceptibility QTL 32.15mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1102268556147268556Rat
1354623Rf46Renal function QTL 463.8blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)1102813953151162766Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
9590300Scort16Serum corticosterone level QTL 164.390.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1103111621148111621Rat
8694370Bw154Body weight QTL 1548.910.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)1103111621148111621Rat
631496Bp97Blood pressure QTL 973.08arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847151047847Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
631206Niddm40Non-insulin dependent diabetes mellitus QTL 40blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1136745990163747690Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
634315Niddm45Non-insulin dependent diabetes mellitus QTL 457.16blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1144267916172949660Rat
61379Bp44Blood pressure QTL 4419.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144267916174133260Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 288529 UniSTS
  308820 UniSTS
UniSTS 223801 UniSTS