RH141692 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH141692

Symbol: RH141692
Also known as: AI045064; 
RGD ID: 5080632
Expected Size: 199 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2598,270,687 - 98,270,877 (+)MAPPER
mRatBN7.21347,263,719 - 47,263,918 (+)MAPPER
Rnor_6.01352,659,372 - 52,659,570NCBIRnor6.0
Rnor_6.05101,998,889 - 101,999,078NCBIRnor6.0
Rnor_5.01357,707,740 - 57,707,938UniSTSRnor5.0
Rnor_5.05106,007,912 - 106,008,101UniSTSRnor5.0
RGSC_v3.41348,864,375 - 48,864,573UniSTSRGSC3.4
RGSC_v3.45102,698,459 - 102,698,648UniSTSRGSC3.4
Celera596,802,419 - 96,802,608UniSTS
Celera1347,580,819 - 47,581,017UniSTS
Cytogenetic Map5q31UniSTS
Cytogenetic Map13q13UniSTS
Is Marker For: Genes:   Ccdc171   Lad1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTCTGGGTGAGAGAATACGCA
Reverse Primer CACTCAGTGTGCCTGTGACATC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310652Lad1ladinin 1135264525752659619Rat
1560884Ccdc171coiled-coil domain containing 1715101639355102017300Rat
1596966Lad1-ps1ladinin 1, pseudogene 15101996776101999167Rat

Nucleotide Sequences
RefSeq Transcripts NM_001107942 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC167044 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131107975663Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13901690682995569Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13901690682995569Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1312193394108478121Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)131409633059096330Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)131409633059096330Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131462463159624631Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131462463159624631Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131981081464810814Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)132005247765052477Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)132148248158537177Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1324502279108770533Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132800833873008338Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132858445273584452Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132907693474076934Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132907693474076934Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1335301263107975663Rat
2301962Cm72Cardiac mass QTL 724.12heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)133614753364868393Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133614753399968921Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133734634882346348Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133937292784372927Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133950130093652524Rat
4889861Pur29Proteinuria QTL 2913.80.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)134231074486833540Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)134231074487310744Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)134357571788575717Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134567662990676629Rat
4145117Mcs27Mammary carcinoma susceptibility QTL 270.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)134877665553264877Rat
6893344Cm79Cardiac mass QTL 791.50.04heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)134905850767207219Rat
12879472Bp399Blood pressure QTL 399arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135060922853264877Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135108098996080989Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135156924896569248Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)135157782490675199Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51136640934Rat
7394712Emca13Estrogen-induced mammary cancer QTL 13mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)59514842103580403Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512651967117554267Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531926122136640934Rat
1576317Eutr2Estrogen induced uterine response QTL 20.01uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)535225432108092802Rat
2316959Gluco59Glucose level QTL 594.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)535661945117554267Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535788756147487820Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540777918154732375Rat
1331801Rf33Renal function QTL 334.149kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)544404276134502294Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)547745646167946134Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)551418671147487820Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)556991667137729065Rat
1358895Bp254Blood pressure QTL 2543.60.0003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)560072951133313852Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)561086525149030144Rat
2316957Pur21Proteinuria QTL 216.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)561086653117554114Rat
61386Bp49Blood pressure QTL 4916.6cerebrum integrity trait (VT:0010549)brain infarction volume (CMO:0001013)561612600102331727Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)561612600168109659Rat
2306971Anxrr21Anxiety related response QTL 219.47fear/anxiety-related behavior trait (VT:1000241)number of entries into a discrete space in an experimental apparatus (CMO:0000960)565696672129038896Rat
2290005Mcs24Mammary carcinoma susceptibility QTL 24mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)568838385113838385Rat
1357396Bw44Body weight QTL 444.19body mass (VT:0001259)body weight (CMO:0000012)571154828108092802Rat
1357402Bw46Body weight QTL 464.47body mass (VT:0001259)body mass index (BMI) (CMO:0000105)571154828108092802Rat
2312671Scl64Serum cholesterol level QTL 640.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)571154828108092802Rat
2302381Bw84Body weight QTL 844.47body mass (VT:0001259)body mass index (BMI) (CMO:0000105)571154828108092802Rat
61380Edpm5Estrogen-dependent pituitary mass QTL 54.50.92pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)571154828108092802Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)571552569157225114Rat
1298070Scl18Serum cholesterol level QTL 183.7blood LDL cholesterol amount (VT:0000181)calculated plasma low density lipoprotein cholesterol level (CMO:0001245)583424556128424556Rat
1598846Bp293Blood pressure QTL 2933.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)583424556128424556Rat
1598859Cm66Cardiac mass QTL 662heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)583424556128424556Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)584963058173504662Rat
1298086Bp156Blood pressure QTL 156arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)589502294134502294Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)591585539136585539Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)591585539136585539Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)591585539136585539Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)591884213136884213Rat
1358889Bp261Blood pressure QTL 2612.86arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)593037304133313852Rat
1358909Kidm25Kidney mass QTL 251.87kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)593037304133313852Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)593273130138273130Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)597921932149030144Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)5100723739153577831Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)5101265591141912026Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 313325 UniSTS
  362538 UniSTS
UniSTS 223685 UniSTS