RH139821 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: RH139821

Symbol: RH139821
Previously known as: AI010778; 
RGD ID: 5077552
Expected Size: 209 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2162,121,529 - 2,121,738 (+)MAPPERmRatBN7.2
Rnor_6.0162,563,130 - 2,563,338NCBIRnor6.0
Rnor_5.0162,537,878 - 2,538,086UniSTSRnor5.0
RGSC_v3.4162,182,219 - 2,182,427UniSTSRGSC3.4
Celera162,089,409 - 2,089,617UniSTS
RH 3.4 Map161.6UniSTS
Cytogenetic Map16p16UniSTS
Is Marker For: Genes:   Appl1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGGAGTGTTCAACTGAATGAGC
Reverse Primer AACACCAACAGACATGTGAGGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596812Asb14ankyrin repeat and SOCS box-containing 141620955672123259Rat
1309388Appl1adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 11621185032166741Rat

Nucleotide Sequences
RefSeq Transcripts XM_002728373 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide FQ226179 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2325838Bp347Blood pressure QTL 3470.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1613080679Rat
1357403Slep4Serum leptin concentration QTL 43.91blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1619639137Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1549842Bp248Blood pressure QTL 2480.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)163802452995463Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
12903278Am16Aortic mass QTL 160.019aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)168323802995225Rat
12903279Cm115Cardiac mass QTL 1150.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)168323802995225Rat
12903281Cm116Cardiac mass QTL 1160.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)168323802995225Rat
12903952Cm117Cardiac mass QTL 1170.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)168323802995225Rat
12903954Bw186Body weight QTL 1860.011body mass (VT:0001259)body weight (CMO:0000012)168323802995225Rat
2301404Bp321Blood pressure QTL 3210.05arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)168323802995225Rat
12903955Kidm69Kidney mass QTL 690.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)168323804227609Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 290537 UniSTS
UniSTS 221905 UniSTS