RH137052 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH137052

Symbol: RH137052
Previously known as: AA955909; 
RGD ID: 5072786
Expected Size: 210 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21827,988,858 - 27,989,066 (+)MAPPERmRatBN7.2
mRatBN7.2245,006,866 - 45,007,076 (+)MAPPERmRatBN7.2
Rnor_6.0245,233,930 - 45,234,139NCBIRnor6.0
Rnor_6.01829,208,281 - 29,208,488NCBIRnor6.0
Rnor_5.01828,914,328 - 28,914,535UniSTSRnor5.0
Rnor_5.0264,266,679 - 64,266,888UniSTSRnor5.0
RGSC_v3.4245,203,841 - 45,204,050UniSTSRGSC3.4
RGSC_v3.41829,018,096 - 29,018,303UniSTSRGSC3.4
Celera1827,717,567 - 27,717,774UniSTS
Celera240,776,450 - 40,776,659UniSTS
RH 3.4 Map2282.3UniSTS
Cytogenetic Map2q14UniSTS
Is Marker For: Genes:   Cspg4b   Cystm1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGCCAAACCAAGGCATCAA
Reverse Primer GGAGTCTCCTCGGGTTGGTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2323233Cystm1cysteine-rich transmembrane module containing 1182794586228013509Rat
1561161Cspg4bchondroitin sulfate proteoglycan 4B24493980745008284Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
1331735Rf44Renal function QTL 442.981urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181823456431359530Rat
1331775Bp235Blood pressure QTL 2353.201arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181823456431359530Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182206624252293055Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
12904673Cm127Cardiac mass QTL 1270.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)182654808246969551Rat
12904675Am19Aortic mass QTL 190.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)182654808246969551Rat
12904677Kidm72Kidney mass QTL 720.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)182654808246969551Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182654808246969551Rat
12904669Cm125Cardiac mass QTL 1250.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)182654808246969551Rat
12904670Cm126Cardiac mass QTL 1260.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)182654808246969551Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182654808246969551Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat
10402051Gdil2Gastrointestinal dilation QTL 2enteric ganglion morphology trait (VT:0001045)length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)22490385374786777Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)22691781781754745Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)22691781781754745Rat
1354617Bp240Blood pressure QTL 2404arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)22691781781754745Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
1643006Pain1Pain QTL 13.630.005mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)22699957148268661Rat
9590095Sffal3Serum free fatty acids level QTL 36.780.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)22715716072157160Rat
1300160Hrtrt3Heart rate QTL 33.62heart pumping trait (VT:2000009)absolute change in heart rate (CMO:0000534)22997159351729300Rat
10755434Coatc7Coat color QTL 70.04794coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23064806575648065Rat
10755436Coatc8Coat color QTL 80.02431coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)23502311780023117Rat
61371Edpm1Estrogen-dependent pituitary mass QTL 140.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)23513484188029593Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)240067944102785628Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)240067944102785628Rat
12879863Bp402Blood pressure QTL 4020.003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)24112578956532139Rat
1300155Bp174Blood pressure QTL 1744.09arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)24280460760653831Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243162366111362592Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)243162366111362592Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
631208Bw1Body weight QTL15.09mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight to body weight ratio (CMO:0000654)24317101783575226Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100363310 UniSTS
  294747 UniSTS
UniSTS 219141 UniSTS