Prdx1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Prdx1

Symbol: Prdx1
Previously known as:
RGD ID: 5070490
Expected Size: 70 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22193,602,573 - 193,602,643 (+)MAPPERmRatBN7.2
mRatBN7.25130,154,646 - 130,156,228 (+)MAPPERmRatBN7.2
mRatBN7.25130,156,177 - 130,156,228 (+)MAPPERmRatBN7.2
Rnor_6.02208,738,546 - 208,738,615NCBIRnor6.0
Rnor_6.05135,543,785 - 135,545,366NCBIRnor6.0
Rnor_5.02228,162,502 - 228,162,571UniSTSRnor5.0
Rnor_5.05139,340,009 - 139,341,590UniSTSRnor5.0
RGSC_v3.45136,983,429 - 136,985,010UniSTSRGSC3.4
RGSC_v3.42201,373,781 - 201,373,850UniSTSRGSC3.4
Celera2186,293,818 - 186,293,887UniSTS
Celera5128,681,817 - 128,683,398UniSTS
Cytogenetic Map2q34UniSTS
Cytogenetic Map5q36UniSTS
Is Marker For: Genes:   Prdx1   Chi3l4   LOC100365936   Prdx1l1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGATGAAGGTATCTCTTTCAG
Reverse Primer ATTGTTATCTGTCGAAGGATA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620039Prdx1peroxiredoxin 15130147258130162856Rat
11359983Chia-ps1chitinase, acidic, pseudogene 12193495684193739324Rat
2323165Prdx1l1peroxiredoxin 1-like 12193602142193603085Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)587468046132468046Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)587765973132765973Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)590450144135450144Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)597570330136479578Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
7394710Emca12Estrogen-induced mammary cancer QTL 12mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)5124160767133749643Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
1581505Rf54Renal function QTL 54kidney physiology trait (VT:0002136)kidney 20-HETE level (CMO:0001854)5128033842133011550Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)2135552573202446871Rat
70175BpQTLCluster3Blood pressure QTL cluster 34.128arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)2135552573202446871Rat
1298076Bp166Blood pressure QTL 1660.0009arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2136445150202447032Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
71113Cari2Carrageenan-induced inflammation QTL 22.70.009hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)2141596551202447032Rat
724568Uae13Urinary albumin excretion QTL 134.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)2143157029210020885Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561221167075Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
631501Bp101Blood pressure QTL 1012.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150341684202446871Rat
2301966Bp322Blood pressure QTL 3223.58arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2150540301202447032Rat
1354609Niddm62Non-insulin dependent diabetes mellitus QTL 624.720.000006insulin secretion trait (VT:0003564)plasma insulin level (CMO:0000342)2150540301202447032Rat
1358900Bw48Body weight QTL 484.88body mass (VT:0001259)body weight (CMO:0000012)2157142078211086598Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2157142078226277316Rat
1302793Bw16Body weight QTL 1650.0001body mass (VT:0001259)body weight (CMO:0000012)2157142209202446871Rat
7488925Bp364Blood pressure QTL 3640.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2160564068205564068Rat
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2161699179222436696Rat
7488927Bp365Blood pressure QTL 3650.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2162765032207765032Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2164073756227146641Rat
1598838Bp290Blood pressure QTL 2901.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2166539266211539266Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2168358098223265385Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2168594495213594495Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2174930955213594495Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2179335906224335906Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2179946951224946951Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2182171407227171407Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2182171407227171407Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2182171407227171407Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2182171407227171407Rat
4889834Pur24Proteinuria QTL 245.80.014urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)2184114274202447032Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2184165752229165752Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2185876309219753474Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2185876309219753474Rat
61458Bp10Blood pressure QTL 103.42arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
1298083Bp158Blood pressure QTL 1582.62arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2189599258218414891Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2189599258226936289Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2189599258234599258Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189599258234599258Rat
2301408Kidm36Kidney mass QTL 360.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2190613715226808892Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2193452645245889826Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100363379 UniSTS
  100365936 UniSTS
  117254 UniSTS
  310771 UniSTS
UniSTS 166199 UniSTS