AU046608 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU046608

Symbol: AU046608
Previously known as:
RGD ID: 5069268
Expected Size: 248 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25165,952,103 - 165,952,179 (-)MAPPERmRatBN7.2
mRatBN7.2842,603,027 - 42,603,104 (+)MAPPERmRatBN7.2
mRatBN7.21227,712,117 - 227,712,193 (-)MAPPERmRatBN7.2
mRatBN7.21136,768,638 - 36,768,714 (-)MAPPERmRatBN7.2
mRatBN7.21395,880,937 - 95,881,013 (-)MAPPERmRatBN7.2
mRatBN7.21479,988,399 - 79,988,476 (-)MAPPERmRatBN7.2
mRatBN7.2179,849,979 - 9,850,055 (-)MAPPERmRatBN7.2
mRatBN7.2322,579,167 - 22,579,243 (-)MAPPERmRatBN7.2
mRatBN7.23164,082,726 - 164,082,802 (-)MAPPERmRatBN7.2
mRatBN7.25146,170,614 - 146,170,690 (-)MAPPERmRatBN7.2
mRatBN7.2939,100,023 - 39,100,099 (+)MAPPERmRatBN7.2
mRatBN7.2622,322,594 - 22,322,670 (-)MAPPERmRatBN7.2
mRatBN7.2766,820,684 - 66,820,761 (-)MAPPERmRatBN7.2
mRatBN7.2X105,922,529 - 105,922,605 (-)MAPPERmRatBN7.2
mRatBN7.21204,710,751 - 204,710,827 (+)MAPPERmRatBN7.2
mRatBN7.21219,601,774 - 19,601,850 (+)MAPPERmRatBN7.2
mRatBN7.21924,680,737 - 24,680,813 (+)MAPPERmRatBN7.2
mRatBN7.21933,770,458 - 33,770,534 (+)MAPPERmRatBN7.2
mRatBN7.2610,183,465 - 10,183,541 (+)MAPPERmRatBN7.2
mRatBN7.28102,357,927 - 102,357,992 (+)MAPPERmRatBN7.2
Rnor_6.0111,922,459 - 11,922,699NCBIRnor6.0
Rnor_5.0113,523,594 - 13,524,357UniSTSRnor5.0


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGTTGCTGGGAATTGAACTC
Reverse Primer TGGGATAGGAAGTAAAAAAGCTTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307258Ewsr1EWS RNA-binding protein 1147996536579994108Rat
3249Serpine1serpin family E member 1121960127219611657Rat
11359665LOC108351685uncharacterized LOC10835168584258703242610607Rat
620775Sc5dsterol-C5-desaturase84262964942641257Rat
41090425LOC120094489small nucleolar RNA SNORA1784269549242695620Rat
1309824Tectatectorin alpha84270796242779726Rat
1308880Tbceltubulin folding cofactor E-like84279564842854552Rat
7503878LOC102549755uncharacterized LOC10254975584287104742877228Rat
41398114LOC120094129uncharacterized LOC12009412984289401742900855Rat
2734Grik4glutamate ionotropic receptor kainate type subunit 484290304343331990Rat
41372312Rpl10-ps5ribosomal protein L10, pseudogene 584313522443135987Rat
1305111Arhgef12Rho guanine nucleotide exchange factor 1284335007043475404Rat
1565079Tlcd5TLC domain containing 584348138843486288Rat
621691Pou2f3POU class 2 homeobox 384349540843577795Rat
1305890Oafout at first homolog84359436243612334Rat
1307858Trim29tripartite motif-containing 2984368222143706992Rat
41272318LOC120094130uncharacterized LOC12009413084378126843800378Rat
7617270LOC102555063uncharacterized LOC10255506384382301643830274Rat
11511573LOC108351687uncharacterized LOC10835168784383129143835286Rat
41073558LOC120094131uncharacterized LOC12009413184396438143966974Rat
620791Nectin1nectin cell adhesion molecule 184410177644164863Rat
41291834LOC120094415U6 spliceosomal RNA84425965444259757Rat
11384736LOC108351689uncharacterized LOC10835168984431212444316357Rat
3860Thy1Thy-1 cell surface antigen84438949544394688Rat
621073Usp2ubiquitin specific peptidase 284441145744439668Rat
1307477Mfrpmembrane frizzled-related protein84444563644450859Rat
1308802C1qtnf5C1q and TNF related 584445093444453075Rat
1305953Rnf26ring finger protein 2684445455144456745Rat
41046946LOC120094132uncharacterized LOC12009413284446930544475593Rat
620463Mcammelanoma cell adhesion molecule84447939144487575Rat
1561386CblCbl proto-oncogene84448782444571620Rat
1305351Drc12dynein regulatory complex subunit 12 homolog84457652844584345Rat
1559807Nherf4NHERF family PDZ scaffold protein 484458439044588838Rat
1311293Nlrx1NLR family member X184458847644606678Rat
1305840Abcg4ATP binding cassette subfamily G member 484461118744629818Rat
1311492Hinfphistone H4 transcription factor84463433344644288Rat
1310281C2cd2lC2CD2-like84464807444658856Rat
735124Dpagt1dolichyl-phosphate N-acetylglucosaminephosphotransferase 184466405544671102Rat
1566119H2axH2A.X variant histone84467190744673262Rat
2801Hmbshydroxymethylbilane synthase84467355444680950Rat
1308038Vps11VPS11 core subunit of CORVET and HOPS complexes84468412944698568Rat
621146Hyou1hypoxia up-regulated 184470607344718189Rat
62066Slc37a4solute carrier family 37 member 484472321644729301Rat
1302991Trappc4trafficking protein particle complex subunit 484472945844733285Rat
621043Rps25ribosomal protein s2584473362344735999Rat
1597440Cenataccentrosomal AT-AC splicing factor84473596844742859Rat
1591087Mettl9-ps1methyltransferase like 9, pseudogene 184474565544746391Rat
1309739Foxr1forkhead box R184476058744768696Rat
1597393Upk2uroplakin 284477919844781190Rat
1309096Bcl9lBCL9 like84481197744840611Rat
62010Cxcr5C-X-C motif chemokine receptor 584484209844858425Rat
41365399LOC120094133uncharacterized LOC12009413384488317244886607Rat
1564560Ddx6DEAD-box helicase 684493112744967773Rat
61831Trehtrehalase84499018245003881Rat
11482331Rpl35al11ribosomal protein L35A like 1184499214544992574Rat
620878Phldb1pleckstrin homology-like domain, family B, member 184500354345051541Rat
41329639LOC120094134uncharacterized LOC12009413484500826045008955Rat
1359110Arcn1archain 184505761745082224Rat
1307682Ift46intraflagellar transport 4684508159345104052Rat
1596132Tmem25transmembrane protein 2584510711645112657Rat
1359544Ttc36tetratricopeptide repeat domain 3684511273745116345Rat
1586165Kmt2alysine methyltransferase 2A84511676345193320Rat
40971005LOC120094493U2 spliceosomal RNA84516929845169488Rat
41216140LOC120094525U6atac minor spliceosomal RNA84520816045208283Rat
40984864Trnas-aga38transfer RNA serine (anticodon AGA) 3884521065545210729Rat
1303259Atp5mgATP synthase membrane subunit G84522568045233630Rat
1303173Ube4aubiquitination factor E4A84523602245278129Rat
41346119Piga-ps1phosphatidylinositol glycan anchor biosynthesis, class A, pseudogene 184526742445268174Rat
1307718Cd3gCD3 gamma subunit of T-cell receptor complex84528079745287271Rat
2304Cd3dCD3 delta subunit of T-cell receptor complex84528780345293342Rat
1309222Cd3eCD3 epsilon subunit of T-cell receptor complex84530384845315005Rat
1307196Mpzl2myelin protein zero-like 284534828545359298Rat
1310980Mpzl3myelin protein zero-like 384536047545380662Rat
41230475Snora41bsmall nucleolar RNA, H/ACA box 41B84537514745375278Rat
1562572Jamljunction adhesion molecule like84538483645415459Rat
41000181LOC1200945105S ribosomal RNA84540918945409294Rat
3633Scn2bsodium voltage-gated channel beta subunit 284542562945437765Rat
631404Scn4bsodium voltage-gated channel beta subunit 484544658045462294Rat
1305033Tmprss4transmembrane serine protease 484547581945508409Rat
41395099LOC120094136uncharacterized LOC12009413684553156745539351Rat
7587328Smim35small integral membrane protein 3584554971045558135Rat
620138Il10rainterleukin 10 receptor subunit alpha84556300945578041Rat
1559602Gstp1-ps4glutathione S-transferase pi 1, pseudogene 484560982745610741Rat
1310872Tmprss13transmembrane serine protease 1384562575945653943Rat
41127481LOC120094137uncharacterized LOC12009413784566652745670587Rat
69315Fxyd6FXYD domain-containing ion transport regulator 684567905445705958Rat
2173Fxyd2FXYD domain-containing ion transport regulator 284571290145720032Rat
1304887Dscaml1DS cell adhesion molecule-like 184574029846057322Rat
1561243Cep164centrosomal protein 16484607090146134511Rat
2191Bace1beta-secretase 184614206046166268Rat
1307500Rnf214ring finger protein 21484616626946202048Rat
3275Pcsk7proprotein convertase subtilisin/kexin type 784620207946224699Rat
3723Taglntransgelin84622493946230413Rat
1308311Sidt2SID1 transmembrane family, member 284623237946248913Rat
41323129LOC120094332uncharacterized LOC12009433284624639946259868Rat
620332Pafah1b2platelet-activating factor acetylhydrolase 1b, catalytic subunit 284626006946312073Rat
41024980Rps26-ps6ribosomal protein S26, pseudogene 684628687546288369Rat
1593938Sik3SIK family kinase 384631225346522444Rat
40954807LOC120094333uncharacterized LOC12009433384633539646337233Rat
41023870Pou5f1-ps1POU class 5 homeobox 1, pseudogene 184644880646457521Rat
2130Apoa1apolipoprotein A184652725146529035Rat
2136Apoc3apolipoprotein C384653147846533658Rat
2132Apoa4apolipoprotein A484653908346541464Rat
70903Apoa5apolipoprotein A584656118046563818Rat
1562173Zpr1ZPR1 zinc finger84656489846574719Rat
1308076Bud13BUD13 homolog84657512446590964Rat
15616334931429L15RiklRIKEN cDNA 4931429L15 gene like84659524946610558Rat
41348957LOC120094520small nucleolar RNA SNORA1784687192046872035Rat
7680811LOC102549886uncharacterized LOC10254988684692025646924107Rat
41252071Rps29-ps2ribosomal protein S29, pseudogene 284693760146937865Rat
41192037LOC120094138uncharacterized LOC12009413884703821847043573Rat
11443679LOC108351693uncharacterized LOC10835169384705985747061895Rat
41018096LOC120094369uncharacterized LOC12009436984719339647199371Rat
41389139LOC120094559U6 spliceosomal RNA84734545847345564Rat
41338585LOC120094483small nucleolar RNA SNORA4884771752047717649Rat
7621914Cadm1l1cell adhesion molecule 1 like 184784442847847847Rat
1310999Cadm1cell adhesion molecule 184784783648178703Rat
7627355LOC102550632uncharacterized LOC10255063284791529847953291Rat
7531008LOC102550769uncharacterized LOC10255076984821884048226958Rat
41400266LOC120094370uncharacterized LOC12009437084832711148329606Rat
1560781Nxpe4neurexophilin and PC-esterase domain family member 484850269748744101Rat
2323193Nxpe2neurexophilin and PC-esterase domain family, member 284866170848695555Rat
1566243Nxpe1neurexophilin and PC-esterase domain family, member 184874925048773762Rat
1304874Rexo2RNA exonuclease 284881190048823622Rat
1308017Rbm7RNA binding motif protein 784883189448838399Rat
1563941C8h11orf71similar to human chromosome 11 open reading frame 7184883855648838970Rat
1309606Nnmtnicotinamide N-methyltransferase84892866348947734Rat
41362515LOC120094143uncharacterized LOC12009414384893598248941209Rat
727921Zbtb16zinc finger and BTB domain containing 1684898937649177011Rat
41199271LOC120094144uncharacterized LOC12009414484909029449092983Rat
61818Htr3a5-hydroxytryptamine receptor 3A84924201849254475Rat
61820Htr3b5-hydroxytryptamine receptor 3B84927929149308444Rat
1311555Usp28ubiquitin specific peptidase 2884932576649386229Rat
40966354Pclaf-ps4PCNA clamp associated factor, pseudogene 484935425549354590Rat
2322263Cldn25claudin 2584939193049392664Rat
1309197Zw10zw10 kinetochore protein84939654149424743Rat
628625Tmprss5transmembrane serine protease 584943732149461395Rat
41387742LOC120094541U4 spliceosomal RNA84957462049574709Rat
2520Drd2dopamine receptor D284970892749772876Rat
1305538Ankk1ankyrin repeat and kinase domain containing 184977986249788024Rat
1303264Ttc12tetratricopeptide repeat domain 1284979991649847940Rat
7643606LOC102555969uncharacterized LOC10255596984984690849849158Rat
67378Ncam1neural cell adhesion molecule 184986562950165687Rat
41031104LOC120094484small nucleolar RNA SNORA4885053210050532248Rat
41107867LOC120094147uncharacterized LOC12009414785053799350548159Rat
1597367Pgam1-ps13phosphoglycerate mutase 1, pseudogene 1385058125550583845Rat
1359217Plet1placenta expressed transcript 185084224250853666Rat
68367Pts6-pyruvoyl-tetrahydropterin synthase85087083850877869Rat
1309022Bco2beta-carotene oxygenase 285088217450907676Rat
2889Il18interleukin 1885090463050932887Rat
1597300Tex12testis expressed 1285090816150913202Rat
735231Sdhdsuccinate dehydrogenase complex subunit D85094470250954298Rat
619840Timm8btranslocase of inner mitochondrial membrane 8 homolog B85095435050955730Rat
2293296Nkapd1NKAP domain containing 185095565050966915Rat
1310503Pih1d2PIH1 domain containing 285096688550976901Rat
619859Dlatdihydrolipoamide S-acetyltransferase85097915151004435Rat
1309902Dixdc1DIX domain containing 185100783551081191Rat
41253877LOC120094337uncharacterized LOC12009433785104222951045902Rat
1586341C8h11orf52similar to human chromosome 11 open reading frame 5285108134251088333Rat
70914Hspb2heat shock protein family B (small) member 285109326751094528Rat
2414Cryabcrystallin, alpha B85109344151099161Rat
2323870Hmgn2-ps2high mobility group nucleosomal binding domain 2, pseudogene 285109999651100574Rat
1564937Cfap68cilia and flagella associated protein 6885110766351113192Rat
1562252Fdxacb1ferredoxin-fold anticodon binding domain containing 185111183151118253Rat
1311272Alg9ALG9, alpha-1,2-mannosyltransferase85111705751188790Rat
11463616LOC10835170360S ribosomal protein L27a-like85119237451193172Rat
1304764Ppp2r1bprotein phosphatase 2 scaffold subunit A beta85119586051228442Rat
1559698Sik2salt-inducible kinase 285122554351325343Rat
41251080Trnap-agg89transfer RNA proline (anticodon AGG) 8985132092851321008Rat
41018421LOC120094336uncharacterized LOC12009433685132544351375670Rat
41339739LOC120094545U4 spliceosomal RNA85132725551327387Rat
1564444Laynlayilin85136392851384748Rat
2323814HoatzHOATZ cilia and flagella associated protein85138593151409796Rat
2325585Mir34cmicroRNA 34c85140972651409802Rat
2325432Mir34bmicroRNA 34b85141024451410327Rat
1308809Btg4BTG anti-proliferation factor 485141077451425802Rat
1562811RGD1562811RGD156281185143227451485901Rat
1594728Pou2af1POU class 2 homeobox associating factor 185152181351548819Rat
1563866Pou2af3POU class 2 homeobox associating factor 385158823751597114Rat
9395767LOC103693092uncharacterized LOC10369309285160279851633998Rat
1562914Pou2af2POU class 2 homeobox associating factor 285160778051648790Rat
41148406LOC120094149uncharacterized LOC12009414985171286951733602Rat
40970295LOC120094151uncharacterized LOC12009415185193163651933767Rat
41141235LOC120094544U4 spliceosomal RNA85203065752030795Rat
1303160Arhgap20Rho GTPase activating protein 2085207447252155739Rat
62036Fdx1ferredoxin 185226853652287344Rat
41139247Mrpl1-ps1mitochondrial ribosomal protein L1, pseudogene 185231086152311889Rat
1359472Rdxradixin85237949452437673Rat
41262489Rps19-ps12ribosomal protein S19, pseudogene 1285241178952412208Rat
7488976Mir6329microRNA 632985243794452438034Rat
1565078Zc3h12czinc finger CCCH type containing 12C85244379152508643Rat
41230409LOC120094154uncharacterized LOC12009415485248045952486428Rat
41005047LOC120094155uncharacterized LOC12009415585258492852594256Rat
41368188LOC120094503small nucleolar RNA SNORA1785264761552647744Rat
1586164Eef1a1-ps17eukaryotic translation elongation factor 1 alpha 1, pseudogene 1785269727952699339Rat
41119279LOC120094156uncharacterized LOC12009415685271696452746188Rat
6502009Btf3-ps12basic transcription factor 3, pseudogene 1285277360652774913Rat
1642426C8h11orf87similar to human chromosome 11 open reading frame 8785306236153069882Rat
7599914LOC102551665uncharacterized LOC10255166585308072653143607Rat
41181783LOC120094404U6 spliceosomal RNA85313954453139653Rat
11442638LOC108351706uncharacterized LOC10835170685320858653216357Rat
11365903LOC108351705uncharacterized LOC10835170585325818453311443Rat
1592250Dctpp1-ps3dCTP pyrophosphatase 1, pseudogene 385334453453345157Rat
1308990Ddx10DEAD-box helicase 1085348865653643373Rat
40939774Anapc15-ps1anaphase promoting complex subunit 15, pseudogene 185356419853564566Rat
1560308Exph5exophilin 585369882553775371Rat
40938247LOC120094158uncharacterized LOC12009415885375165953765698Rat
1562027Poglut3protein O-glucosyltransferase 385377761453795404Rat
1311251C8h11orf65similar to human chromosome 11 open reading frame 6585379603353825277Rat
1593265AtmATM serine/threonine kinase85382874153932773Rat
41193082LOC120094159uncharacterized LOC12009415985390302553921036Rat
1311947Npatnuclear protein, co-activator of histone transcription85393299353970875Rat
2016Acat1acetyl-CoA acetyltransferase 185397981354008861Rat
11436071LOC10835170960S ribosomal protein L17 pseudogene85398660853988300Rat
621742Cul5cullin 585401296354066751Rat
41369228LOC120094468small nucleolar RNA SNORA6185404273054042858Rat
40991508LOC120094160uncharacterized LOC12009416085405174954054337Rat
1311286Rab39aRAB39A, member RAS oncogene family85408824654105867Rat
1311242Slc35f2solute carrier family 35, member F285415997054203614Rat
1305224Slnsarcolipin85422138954248110Rat
41290367LOC120094162uncharacterized LOC12009416285426655954267447Rat
41037667LOC120094163uncharacterized LOC12009416385426746054273668Rat
1564186Elmod1ELMO domain containing 185429836354355348Rat
1311533Tnfaip8l3TNF alpha induced protein 8 like 385441350354455512Rat
41013761LOC120094479small nucleolar RNA SNORA4885442900954429149Rat
9399090LOC103693097uncharacterized LOC10369309785455011854564648Rat
2457Cyp19a1cytochrome P450, family 19, subfamily a, polypeptide 185455297854580375Rat
727879Gldngliomedin85467901554723198Rat
41140541LOC120094446small nucleolar RNA SNORD113/SNORD114 family85468644754686527Rat
1586163Dmxl2Dmx-like 285474116454884948Rat
7556443Ptbp1-ps2polypyrimidine tract binding protein 1, pseudogene 285476481654771085Rat
1309791Sh2d7SH2 domain containing 785491839954930129Rat
1308718Cib2calcium and integrin binding family member 285493026554947157Rat
70889Idh3aisocitrate dehydrogenase (NAD(+)) 3 catalytic subunit alpha85497169454991085Rat
708557Acsbg1acyl-CoA synthetase bubblegum family member 185499129455047276Rat
1310035Dnaja4DnaJ heat shock protein family (Hsp40) member A485508524655102715Rat
1308228Skic8SKI8 subunit of superkiller complex85510354255120837Rat
2400Crabp1cellular retinoic acid binding protein 185513836355159360Rat
41285356Ndufb4-ps5NADH:ubiquinone oxidoreductase subunit B4, pseudogene 585521356055213943Rat
621539Ireb2iron responsive element binding protein 285522808055311613Rat
1308677Hykkhydroxylysine kinase85531591955339720Rat
61846Psma4proteasome 20S subunit alpha 485534043155347893Rat
2347Chrna5cholinergic receptor nicotinic alpha 5 subunit85536979455398526Rat
1596097Zc3h15-ps2zinc finger CCCH-type containing 15, pseudogene 285538506155386940Rat
2345Chrna3cholinergic receptor nicotinic alpha 3 subunit85540166855415165Rat
41116915LOC120094166uncharacterized LOC12009416685541281355497821Rat
2351Chrnb4cholinergic receptor nicotinic beta 4 subunit85541758355437027Rat
1307680Ube2q2ubiquitin conjugating enzyme E2 Q285551840255578342Rat
1306664Fbxo22F-box protein 2285557990655595981Rat
1589860Nrg4neuregulin 485558625355677829Rat
2322868Serbp1-ps1Serpine1 mRNA binding protein 1, pseudogene 185567664455685774Rat
1562084Tmem266transmembrane protein 26685570712255820692Rat
628747Etfaelectron transfer flavoprotein subunit alpha85583511555891890Rat
1563585Bola2-ps1bolA family member 2, pseudogene 185590434055904691Rat
621849Isl2ISL LIM homeobox 285592380555928790Rat
621585ScaperS-phase cyclin A-associated protein in the ER85593271756332222Rat
15635784930563M21RiklRIKEN cDNA 4930563M21 gene like85634793656413500Rat
1588677Dppa3l1developmental pluripotency associated 3-like 185642160956422277Rat
3548Rcn2reticulocalbin 285644920656466253Rat
11390746LOC108351848uncharacterized LOC10835184885647585856481272Rat
1307557Pstpip1proline-serine-threonine phosphatase-interacting protein 185649928756538593Rat
1359444Tspan3tetraspanin 385654606756569815Rat
41139383Rpl17-ps2ribosomal protein L17, pseudogene 285657714156580015Rat
1312026Peak1pseudopodium-enriched atypical kinase 185660504056819748Rat
41106535Isca2-ps2iron-sulfur cluster assembly 2, pseudogene 285668455056698422Rat
1564760Hmg20ahigh mobility group 20A85681967356895658Rat
1308668Lingo1leucine rich repeat and Ig domain containing 185701127257193496Rat
41191557LOC120094170uncharacterized LOC12009417085706336857068210Rat
2322284Atp5mgl1ATP synthase membrane subunit G like 185714914157164984Rat
40988640LOC120094169ATP synthase subunit g, mitochondrial-like85716138157161733Rat
1304976Cimap1cciliary microtubule associated protein 1C85724874657281084Rat
619942Cspg4chondroitin sulfate proteoglycan 485726496257300010Rat
40968802Trnap-agg41transfer RNA proline (anticodon AGG) 4185727036857270448Rat
1307898Snx33sorting nexin 3385731586157328522Rat
9187952Rps15al7ribosomal protein S15a like 785733639757336928Rat
1306825Imp3IMP U3 small nucleolar ribonucleoprotein 385733952857340416Rat
1303191Snupnsnurportin 185734741257388345Rat
9177537LOC103693102uncharacterized LOC10369310285738839757392878Rat
628726Ptpn9protein tyrosine phosphatase, non-receptor type 985739129057472352Rat
7498715LOC102553607uncharacterized LOC10255360785746579257467264Rat
1311598Sin3aSIN3 transcription regulator family member A85748153957536195Rat
41363268LOC120094171uncharacterized LOC12009417185748387457486288Rat
41003300LOC120094172uncharacterized LOC12009417285750484757538496Rat
628787Man2c1mannosidase, alpha, class 2C, member 185753787957549691Rat
1306077Neil1nei-like DNA glycosylase 185755014257556884Rat
1306104Commd4COMM domain containing 485756623657569701Rat
2322085Vdac2-ps2voltage-dependent anion channel 2, pseudogene 285758306857583966Rat
9197090LOC103693103uncharacterized LOC10369310385759636457608016Rat
1305464C8h15orf39similar to human chromosome 15 open reading frame 3985764632457655896Rat
1306267Ppcdcphosphopantothenoylcysteine decarboxylase85781519557842863Rat
68356Scamp5secretory carrier membrane protein 585784583157884516Rat
1305290Rpp25ribonuclease P and MRP subunit p2585790735257908732Rat
41071958Snora3csmall nucleolar RNA, H/ACA box 3C85791725157917381Rat
620607Cox5acytochrome c oxidase subunit 5A85792237457933781Rat
1310727Fam219bfamily with sequence similarity 219, member B85794132757946916Rat
3107Mpimannose phosphate isomerase85794788357956205Rat
41126862Trnaa-agc55transfer RNA alanine (anticodon AGC) 5585795051757950589Rat
68348Scamp2secretory carrier membrane protein 285796561257992248Rat
1587417Ulk3unc-51 like kinase 385799239658000220Rat
1560104Cplx3complexin 385800353558010297Rat
1310538Lman1llectin, mannose-binding, 1 like85801083958029599Rat
1308800CskC-terminal Src kinase85802974858048742Rat
2459Cyp1a2cytochrome P450, family 1, subfamily a, polypeptide 285807536758082255Rat
2458Cyp1a1cytochrome P450, family 1, subfamily a, polypeptide 185809602158102130Rat
1306898Edc3enhancer of mRNA decapping 385810614758151685Rat
41249759LOC120094560U6 spliceosomal RNA85810897858109084Rat
621259Clk3CDC-like kinase 385815215558167196Rat
7627001Ssbp1-ps4single stranded DNA binding protein 1, pseudogene 485818348858187717Rat
1306335Arid3bAT-rich interaction domain 3B85819326858240901Rat
1303055Ubl7ubiquitin-like 785832127958340353Rat
1305192Sema7asemaphorin 7A (John Milton Hagen blood group)85834844858370536Rat
9121844LOC103693105uncharacterized LOC10369310585840456558407384Rat
69325Cyp11a1cytochrome P450, family 11, subfamily a, polypeptide 185842280758434342Rat
1561126Ccdc33coiled-coil domain containing 3385843479858534338Rat
41130582LOC120094173uncharacterized LOC12009417385854867858556154Rat
1307551Stra6signaling receptor and transporter of retinol STRA685854889958568861Rat
1596359Islrimmunoglobulin superfamily containing leucine-rich repeat85857115558574128Rat
6497037Islr2immunoglobulin superfamily containing leucine-rich repeat 285860816558616246Rat
1562602PmlPML nuclear body scaffold85862734758661927Rat
1559463Stoml1stomatin like 185866198058669860Rat
1308752Loxl1lysyl oxidase-like 185869176358716365Rat
1590999Rpl38-ps1ribosomal protein L38, pseudogene 185874215558742473Rat
41400456LOC120094174uncharacterized LOC12009417485874472958753019Rat
1310243Tbc1d21TBC1 domain family, member 2185876156258773711Rat
41019779LOC120094175uncharacterized LOC12009417585881864558823112Rat
6494141LOC100911193uncharacterized LOC10091119385886069358876437Rat
1562618Insyn1inhibitory synaptic factor 185890415358914850Rat
727815Cd276Cd276 molecule85893775158968082Rat
620296Nptnneuroplastin85899687359063402Rat
1311874Rec114REC114 meiotic recombination protein85906335259221439Rat
71065Hcn4hyperpolarization activated cyclic nucleotide-gated potassium channel 485922220659259626Rat
619837Neo1neogenin 185927386059426486Rat
1586219Rps2-ps27ribosomal protein S2, pseudogene 2785965686559657609Rat
1306103AdpgkADP-dependent glucokinase85969940059727352Rat
1309134Bbs4Bardet-Biedl syndrome 485973191259765408Rat
1589878Rpl13-ps16ribosomal protein L13, pseudogene 1685976361459764315Rat
1308131Arih1ariadne RBR E3 ubiquitin protein ligase 185977737859879762Rat
1585107Tmem202transmembrane protein 20285991082459919342Rat
41331956LOC120094522small nucleolar RNA SNORA4085992295059923077Rat
2792Hexahexosaminidase subunit alpha85993652659961654Rat
1310451Celf6CUGBP, Elav-like family member 685997509560006060Rat
1310937Parp6poly (ADP-ribose) polymerase family, member 686001659460049108Rat
40961798LOC120094538U4 spliceosomal RNA86005421360054387Rat
3337Pkmpyruvate kinase M1/286005762960079600Rat
1564007Gramd2aGRAM domain containing 2A86007974460117788Rat
1309955Senp8SUMO peptidase family member, NEDD8 specific86013544660148836Rat
621395Myo9amyosin IXA86014923460352330Rat
11445923LOC10835171740S ribosomal protein S15a pseudogene86016472760165118Rat
41399473Tmsb10-ps1thymosin, beta 10, pseudogene 186018936160189597Rat
7732046LOC102546766uncharacterized LOC10254676686024857360362707Rat
2318602Nr2e3nuclear receptor subfamily 2, group E, member 386036558160373383Rat
1566296Thsd4thrombospondin type 1 domain containing 486038463660984419Rat
41006620LOC120094180uncharacterized LOC12009418086078450560797381Rat
41055777LOC120094490small nucleolar RNA SNORA1786088136260881487Rat
1309466Lrrc49leucine rich repeat containing 4986105326461160695Rat
11505794LOC108351719uncharacterized LOC10835171986116031761161426Rat
1308414Larp6La ribonucleoprotein 6, translational regulator86118374461205548Rat
11466450LOC10835172060S ribosomal protein L21 pseudogene86125187661252358Rat
1560011Uacauveal autoantigen with coiled-coil domains and ankyrin repeats86125941561347789Rat
1588688LOC691000hypothetical protein LOC69100086150666561511869Rat
7556147LOC102551127uncharacterized LOC10255112786152540061584245Rat
41167161LOC120094181uncharacterized LOC12009418186159163861602507Rat
9097864LOC103693111uncharacterized LOC10369311186163264661642054Rat
9453956LOC103693112uncharacterized LOC10369311286163532961641209Rat
9279927LOC103693113uncharacterized LOC10369311386182492861828616Rat
620292Tle3TLE family member 3, transcriptional corepressor86185779161903505Rat
7541432LOC102551666uncharacterized LOC10255166686190391161920863Rat
7661862LOC102552398uncharacterized LOC10255239886227115062281677Rat
621774Rplp1ribosomal protein lateral stalk subunit P186239400862395341Rat
1308596Kif23kinesin family member 2386239790862425162Rat
1311259Paqr5progestin and adipoQ receptor family member 586243186762513688Rat
1565253Glceglucuronic acid epimerase86254610462612144Rat
1563468Spesp1sperm equatorial segment protein 186275131362766657Rat
41029455Mrps16-ps1mitochondrial ribosomal protein S16, pseudogene 186277758662778095Rat
11508551Anp32aacidic nuclear phosphoprotein 32 family member A86282909962865443Rat
1561953Coro2bcoronin 2B86290686163017295Rat
41366886LOC120094182uncharacterized LOC12009418286290876762914282Rat
41303672LOC120094558U6 spliceosomal RNA86300763663007742Rat
11404765LOC108351728ubiquitin-conjugating enzyme E2 L3 pseudogene86308517763085933Rat
11358385LOC108351729uncharacterized LOC10835172986310537063108870Rat
7646170LOC102556363uncharacterized LOC10255636386312141763140722Rat
1311711Itga11integrin subunit alpha 1186314599863254714Rat
41067991LOC120094184uncharacterized LOC12009418486314612263147766Rat
41266508LOC120094185uncharacterized LOC12009418586317381663175326Rat
40936029LOC120094183uncharacterized LOC12009418386322696163229389Rat
1304569Fem1bfem-1 homolog B86326530163278577Rat
7663361LOC102546547uncharacterized LOC10254654786330181163304098Rat
1309714Cln6CLN6, transmembrane ER protein86330335663318360Rat
1583918Calml4calmodulin-like 486332342663335234Rat
1307843Pias1protein inhibitor of activated STAT, 186333815063451670Rat
40999696LOC120094554U6 spliceosomal RNA86347526363475369Rat
2320152Ppia-ps16peptidylprolyl isomerase A , pseudogene 1686357631463578473Rat
41336355LOC120094551U6 spliceosomal RNA86359404063594146Rat
1307687Skor1SKI family transcriptional corepressor 186359915363609727Rat
61890Map2k5mitogen activated protein kinase kinase 586362522063852090Rat
1309779C8h15orf61similar to human chromosome 15 open reading frame 6186386812563872863Rat
1310670IqchIQ motif containing H86388981664083248Rat
41223240LOC12009311960S ribosomal protein L37-like86390385363906035Rat
7569612LOC102547003uncharacterized LOC10254700386394107363967617Rat
621601Aagabalpha- and gamma-adaptin binding protein86408334364121903Rat
3032Smad3SMAD family member 386412682964236960Rat
1305069Smad6SMAD family member 686445011464519673Rat
1305177Lctllactase-like86461835664654851Rat
1583880Zwilchzwilch kinetochore protein86463840164670911Rat
41250441LOC120094536U12 minor spliceosomal RNA86464566764645817Rat
619824Rpl4ribosomal protein L486467117764676301Rat
40979856LOC120094440small nucleolar RNA SNORD1886467281864672885Rat
41253506Snord16small nucleolar RNA, C/D box 1686467319564673293Rat
41376305Snord18bsmall nucleolar RNA, C/D box 18B86467365664673726Rat
41165082LOC120094442small nucleolar RNA SNORD1686467437364674471Rat
40980514Snord18csmall nucleolar RNA, C/D box 18C86467483864674908Rat
1582813Snapc5small nuclear RNA activating complex, polypeptide 586467720464680769Rat
70495Map2k1mitogen activated protein kinase kinase 186468344964754900Rat
1564084Tipintimeless interacting protein86478081364801358Rat
41136166Trnas-aga48transfer RNA serine (anticodon AGA) 4886478259164782665Rat
41018855Scarna14small Cajal body-specific RNA 1486479352164793655Rat
1308959Dis3lDIS3-like exosome 3'-5' exoribonuclease86480392564840306Rat
1582797Megf11multiple EGF-like-domains 1186489231265218984Rat
619762Rab11aRAB11a, member RAS oncogene family86522369865246461Rat
11480280Trnaq-cug5transfer RNA glutamine (anticodon CUG) 586524680265246873Rat
1592008Rpl7-ps26ribosomal protein L7, pseudogene 2686526084165261761Rat
41279018LOC120094392thymosin beta-4-like86526637665266564Rat
7531986LOC102548661uncharacterized LOC10254866186531184965322682Rat
1562639Dennd4aDENN domain containing 4A86532292065436331Rat
41086543LOC120094514small nucleolar RNA SNORA1786539231565392442Rat
620080Slc24a1solute carrier family 24 member 186544084265466001Rat
1359616Ints14integrator complex subunit 1486547578865500807Rat
1565496Hacd33-hydroxyacyl-CoA dehydratase 386550124065538507Rat
40981180LOC120094339ATP synthase membrane subunit DAPIT, mitochondrial-like86554513065546714Rat
1310901Dpp8dipeptidylpeptidase 886555062065605828Rat
1310919Igdcc4immunoglobulin superfamily, DCC subclass, member 486562189365657651Rat
1307338Igdcc3immunoglobulin superfamily, DCC subclass, member 386566116565707961Rat
1564649Rps9-ps14ribosomal protein S9, pseudogene 1486571435565714932Rat
41235349LOC120094550U5 spliceosomal RNA86571751265717627Rat
41227585LOC120094549U5 spliceosomal RNA86572087665720991Rat
1306243Parp16poly (ADP-ribose) polymerase family, member 1686573115265749438Rat
1305124Cilpcartilage intermediate layer protein86577728165792251Rat
1304883Clpxcaseinolytic mitochondrial matrix peptidase chaperone subunit X86580546065845643Rat
1308961Pdcd7programmed cell death 786586260665877333Rat
1582742Ubap1lubiquitin associated protein 1-like86587748865897593Rat
1311093Kbtbd13kelch repeat and BTB domain containing 1386590982165911558Rat
1306268Rasl12RAS-like, family 1286591784065931885Rat
1565748Slc51bSLC51 subunit beta86593189165939953Rat
1309462Mtfmtmitochondrial methionyl-tRNA formyltransferase86595378765971841Rat
1359141Spg21SPG21 abhydrolase domain containing, maspardin86598099266008537Rat
1586052Ankdd1aankyrin repeat and death domain containing 1A86601757166043738Rat
1305718Plekho2pleckstrin homology domain containing O286607910666105283Rat
1586053Pif1PIF1 5'-to-3' DNA helicase86611064166120202Rat
1561222Rbpms2RNA binding protein, mRNA processing factor 286615316966184278Rat
9119107LOC103693122uncharacterized LOC10369312286619601266199609Rat
1562933Oaz2ornithine decarboxylase antizyme 286619969466213513Rat
1561651Zfp609zinc finger protein 60986621455366349319Rat
1306838Trip4thyroid hormone receptor interactor 486635186166439679Rat
41323214LOC120094556U6 spliceosomal RNA86642019666420302Rat
1303041PclafPCNA clamp associated factor86642060666432994Rat
621404Csnk1g1casein kinase 1, gamma 186643976066577247Rat
41131898LOC120094491small nucleolar RNA SNORA1786647803366478162Rat
620312Ppibpeptidylprolyl isomerase B86660387766609734Rat
1305042Snx22sorting nexin 2286660991466612932Rat
68935Snx1sorting nexin 186663008666670418Rat
1307481Ciao2acytosolic iron-sulfur assembly component 2A86667053366682455Rat
1304708Dapk2death-associated protein kinase 286670653666825567Rat
11467231LOC108351731uncharacterized LOC10835173186684740166856900Rat
1306366Herc1HECT and RLD domain containing E3 ubiquitin protein ligase family member 186685716967070318Rat
1311830Fbxl22F-box and leucine-rich repeat protein 2286706999867076685Rat
1308852Usp3ubiquitin specific peptidase 386707824967154109Rat
41014780LOC120094375uncharacterized LOC12009437586716657067171810Rat
1306612Car12carbonic anhydrase 1286727473967330428Rat
41032090LOC120094191uncharacterized LOC12009419186728412667290045Rat
1597236Aph1bl2aph-1 homolog B, gamma secretase subunit like 286734179067363967Rat
41103414Aph1bl1aph-1 homolog B, gamma secretase subunit like 186739229467414810Rat
1562468Aph1baph-1 homolog B, gamma secretase subunit86742919867454735Rat
628764Rab8bRAB8B, member RAS oncogene family86745892167536466Rat
41247804LOC120094455small nucleolar RNA SNORA886752339667523532Rat
2319494Cox6a1-ps1cytochrome c oxidase subunit 6A1, pseudogene 186754719867548236Rat
7713084LOC102554897uncharacterized LOC10255489786755475267558925Rat
1595396Rps27lribosomal protein S27-like86756248367567418Rat
1304788Lactblactamase, beta86757150467587592Rat
41005006LOC120094417U6 spliceosomal RNA86759571867595826Rat
3898Tpm1tropomyosin 186763547967662330Rat
1565416Tln2talin 286783092068252240Rat
2325453Mir190microRNA 19086785098767851071Rat
40957589LOC120094557U6 spliceosomal RNA86817542268175528Rat
1597204Taf12-ps1TATA-box binding protein associated factor 12, pseudogene 186828240368283243Rat
6493603LOC100911360uncharacterized LOC10091136086833490468336957Rat
1591932C2cd4bC2 calcium-dependent domain containing 4B86837279368396477Rat
1596010C2cd4aC2 calcium-dependent domain containing 4A86846701768469781Rat
1560364Vps13cvacuolar protein sorting 13 homolog C86847836668651893Rat
1596001Akap8-ps1A-kinase anchoring protein 8, pseuhogene 186872710768735855Rat
9163290LOC103693125uncharacterized LOC10369312586877636868798331Rat
1308419RoraRAR-related orphan receptor A86930163570034741Rat
41403177LOC120094342uncharacterized LOC12009434286949914069518217Rat
1585038Ice2interactor of little elongation complex ELL subunit 287004341970085217Rat
621170Anxa2annexin A287010526870141663Rat
9213299LOC103693133uncharacterized LOC10369313387018426070218566Rat
41252189LOC120094527U2 spliceosomal RNA87024543270245526Rat
1305217Foxb1forkhead box B187040722170409841Rat
41163972LOC120094195uncharacterized LOC12009419587045233670467507Rat
11487202LOC108351739uncharacterized LOC10835173987051246670514362Rat
41393631LOC120094198uncharacterized LOC12009419887057558070605286Rat
1308944Bnip2BCL2 interacting protein 287064043670661782Rat
620720Gtf2a2general transcription factor 2A subunit 287066244770675576Rat
631333Gcnt3glucosaminyl (N-acetyl) transferase 3, mucin type87068917370696476Rat
7711923Selenok-ps1selenoprotein K, pseudogene 187071951070720199Rat
1311958Fam81afamily with sequence similarity 81, member A87076285270821898Rat
41333547LOC120094501small nucleolar RNA SNORA1787082988670830017Rat
3144Myo1emyosin IE87088793471080180Rat
41237953Rpl37a-ps11ribosomal protein L37A, pseudogene 1187090209870945921Rat
41286225LOC120094553U6 spliceosomal RNA87107784671077952Rat
1308176Ccnb2cyclin B287108759471100794Rat
1310097Rnf111ring finger protein 11187110396771180172Rat
7704513Polr2k-ps1RNA polymerase II, I and III subunit K, pseudogene 187111895771119989Rat
41241038LOC120094412U6 spliceosomal RNA87119304671193152Rat
1307526SltmSAFB-like, transcription modulator87121599571261821Rat
1311456Mindy2MINDY lysine 48 deubiquitinase 287126827471327698Rat
7601035LOC102551907uncharacterized LOC10255190787127464871325291Rat
2032Adam10ADAM metallopeptidase domain 1087134600871477889Rat
3009Lipclipase C, hepatic type87150963371635663Rat
41172046LOC120094202uncharacterized LOC12009420287151847671528853Rat
1595952Hax1-ps5HCLS1 associated protein X-1, pseudogene 587169691671697860Rat
68433Aqp9aquaporin 987179723171837485Rat
620250Aldh1a2aldehyde dehydrogenase 1 family, member A287187785071957107Rat
619847Polr2mRNA polymerase II subunit M87213199272139423Rat
41189379LOC120094203uncharacterized LOC12009420387215531272169017Rat
1359197Myzapmyocardial zonula adherens protein87215581772243036Rat
11457738Dynll1-ps1dynein light chain LC8-type 1, pseudogene 187225148472252556Rat
1304623Cgnl1cingulin-like 187227340172424842Rat
3829Tcf12transcription factor 1287249044772799265Rat
40960317LOC120094424U6 spliceosomal RNA87280993872810046Rat
11488967LOC108351742uncharacterized LOC10835174287288524372897708Rat
7601784LOC102546620uncharacterized LOC10254662087296272472992449Rat
1560796Zfp280dzinc finger protein 280D87299265573080482Rat
11423940Rpl35-ps6ribosomal protein L35, pseudogene 687313147973133010Rat
1549718Mns1meiosis-specific nuclear structural 187314887773169570Rat
1304772Tex9testis expressed 987316851973213935Rat
7743740Ccnd3-ps1cyclin D3, pseudogene 187320523373206228Rat
9295730LOC103693140uncharacterized LOC10369314087321359673243325Rat
1308795Rfx7regulatory factor X, 787325405173339209Rat
3157Nedd4NEDD4 E3 ubiquitin protein ligase87338409573468951Rat
6503470LOC100909416uncharacterized LOC10090941687347203273480590Rat
1592006Nup35-ps1nucleoporin 35, pseudogene 187349529673496387Rat
1592005Rps7-ps9ribosomal protein S7, pseudogene 987350358673504605Rat
41397485LOC120094402U6 spliceosomal RNA87350529373505397Rat
1307157Prtgprotogenin87354844073657945Rat
41295147LOC120094206uncharacterized LOC12009420687360591973609924Rat
41030394LOC120094466small nucleolar RNA SNORA2/SNORA34 family87362301873623153Rat
1594620Pygo1pygopus family PHD finger 187366621073684873Rat
1549760Dnaaf4dynein axonemal assembly factor 487369639473711315Rat
41382517LOC120094409U6 spliceosomal RNA87370819773708302Rat
1594626Pierce2piercer of microtubule wall 287371538373719849Rat
1311261Ccpg1cell cycle progression 187371996073752437Rat
2325480Mir628microRNA 62887373984673739929Rat
1307251Pigbphosphatidylinositol glycan anchor biosynthesis, class B87375175673775679Rat
6502569Pigbos1PIGB opposite strand 187377573273780102Rat
620918Rab27aRAB27A, member RAS oncogene family87378273073836630Rat
1311617Khdc3KH domain containing 3, subcortical maternal complex member87384234473844248Rat
1309784Rsl24d1ribosomal L24 domain containing 187385299173861996Rat
7552397LOC102554551uncharacterized LOC10255455187393106674263837Rat
40979767LOC120094208eukaryotic translation initiation factor 1-like87405655674068979Rat
628592Unc13cunc-13 homolog C87424702674697629Rat
6489473LOC10091202760S ribosomal protein L27-like87470404674704469Rat
1563550Wdr72WD repeat domain 7287483833875020938Rat
41104669LOC120094209uncharacterized LOC12009420987493527074941494Rat
41045535Npm1-ps4nucleophosmin 1, pseudogene 487503672775037582Rat
11500987LOC108351747uncharacterized LOC10835174787535503675369526Rat
41024479LOC120094477small nucleolar RNA SNORA4887548632275486467Rat
7736108LOC102549203uncharacterized LOC10254920387558484375590148Rat
2811Onecut1one cut homeobox 187559943275633598Rat
1310552Atosaatos homolog A87569482875772565Rat
71054Arpp19cAMP-regulated phosphoprotein 1987577964075802474Rat
3143Myo5amyosin VA87581198575980049Rat
1309994Myo5cmyosin VC87598949776066485Rat
41342803LOC120094537small nucleolar RNA U387599768175997765Rat
620759Gnb5G protein subunit beta 587607612076105069Rat
621015Bcl2l10Bcl2-like 1087610732676113373Rat
62087Mapk6mitogen-activated protein kinase 687614665076169767Rat
7701876LOC102551227uncharacterized LOC10255122787617741376181522Rat
1549772Leo1LEO1 homolog, Paf1/RNA polymerase II complex component87619954776223983Rat
6487844LOC100912347RNA polymerase-associated protein LEO1-like87622459976242856Rat
1311030Tmod3tropomodulin 387624897876310855Rat
61948Tmod2tropomodulin 287631673676366003Rat
1304585Lysmd2LysM domain containing 287637898476394396Rat
621209Scg3secretogranin III87639977776442015Rat
41304021LOC120094210uncharacterized LOC12009421087647624076510654Rat
1305979Bmp5bone morphogenetic protein 587651716476639925Rat
1565090Hmgcll13-hydroxy-3-methylglutaryl-CoA lyase like 187675730176887300Rat
1565220GfralGDNF family receptor alpha like87691789476963258Rat
41282450LOC120094480small nucleolar RNA SNORA4887692356876923709Rat
2788Hcrtr2hypocretin receptor 287698983477105953Rat
1311988Fam83bfamily with sequence similarity 83, member B87728735177363795Rat
41289644LOC120094498small nucleolar RNA SNORA1787753279877532927Rat
1359482Tinagtubulointerstitial nephritis antigen87780003177885077Rat
41300456LOC120094535U2 spliceosomal RNA87783662177836773Rat
1590513Mlipmuscular LMNA-interacting protein87793508778204725Rat
1549773Lrrc1leucine rich repeat containing 187823989778407347Rat
41110620LOC120094211uncharacterized LOC12009421187843298178450185Rat
11378963LOC108351748uncharacterized LOC10835174887845769978515167Rat
1560540Klhl31kelch-like family member 3187851551478538873Rat
41316372Rpl27a-ps7ribosomal protein L27a, pseudogene 787861910978626011Rat
619868Gclcglutamate-cysteine ligase, catalytic subunit87862989978668547Rat
620583Elovl5ELOVL fatty acid elongase 587879084678857307Rat
41078549LOC120094500small nucleolar RNA SNORA1787888720378887330Rat
61852Gcm1glial cells missing transcription factor 187892568778938924Rat
40952924LOC120094539U4 spliceosomal RNA87893614678936293Rat
1593343Gapdh-ps10Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 1087893957878944018Rat
1310374Fbxo9f-box protein 987895848278984015Rat
71050Cilk1ciliogenesis associated kinase 187898407579042695Rat
1306318Rpl12-ps1ribosomal protein L12, pseudogene 187905946479060196Rat
1309970Gsta4glutathione S-transferase alpha 487906696779084193Rat
1593189Gsta5glutathione S-transferase alpha 587910556179117472Rat
41320357LOC120094562U6 spliceosomal RNA87917794879178051Rat
2754Gsta2glutathione S-transferase alpha 287918453579196827Rat
1305838Dppa5developmental pluripotency associated 587921534179217282Rat
1311103Ooepoocyte expressed protein87922338879224554Rat
1586947Ddx43DEAD-box helicase 4387925500179284468Rat
2321966Trappc14l1trafficking protein particle complex subunit 14 like 187929077079299825Rat
1586939Cgascyclic GMP-AMP synthase87929228279306998Rat
1308830Mto1mitochondrial tRNA translation optimization 187930968179335231Rat
67387Eef1a1eukaryotic translation elongation factor 1 alpha 187934155479344784Rat
1311388Slc17a5solute carrier family 17 member 587939441679429387Rat
1311287Cd109CD109 molecule87945448079569195Rat
41375214Myl6-ps2myosin light chain 6, pseudogene 287962273779623115Rat
1592002Ybx1-ps10Y box binding protein 1, pseudogene 1087986189179870816Rat
41205198LOC120094378uncharacterized LOC12009437888011436080118155Rat
2324749Dynll1l2dynein light chain LC8-type 1 like 288032178380322046Rat
41328102LOC120094401U6 spliceosomal RNA88048534080485445Rat
1585750Rps3a-ps10ribosomal protein S3a, pseudogene 1088051301780513751Rat
2374Col12a1collagen type XII alpha 1 chain88054759280665665Rat
9394113Sec61gl1Sec61 translocon subunit gamma like 188070102980710125Rat
68365Cox7a2cytochrome c oxidase subunit 7A288071682480720922Rat
1303315Tmem30atransmembrane protein 30A88072874980757197Rat
628597Filip1filamin A interacting protein 188076128380956556Rat
41029882LOC120094506small nucleolar RNA SNORA1788084796080848092Rat
9159669LOC1036904855'-nucleotidase domain-containing protein 2 pseudogene88094884780950737Rat
1304565Senp6SUMO specific peptidase 688098867581071606Rat
1560646Myo6myosin VI88108715781242022Rat
620499Impg1interphotoreceptor matrix proteoglycan 188124362481389722Rat
2846Htr1b5-hydroxytryptamine receptor 1B88251357282534670Rat
11422632LOC108351750uncharacterized LOC10835175088256881482571906Rat
1583682Mei4meiotic double-stranded break formation protein 488276566182939649Rat
7661831LOC102553441uncharacterized LOC10255344188285505282951281Rat
41267224LOC120094494small nucleolar RNA SNORA1788314323483143365Rat
1562068Tpt1-ps4tumor protein, translationally-controlled 1 pseudogene 488369079183691589Rat
1305012Irak1bp1interleukin-1 receptor-associated kinase 1 binding protein 188373151283748289Rat
1564964Phippleckstrin homology domain interacting protein88377680283891192Rat
11465908LOC108351752uncharacterized LOC10835175288389783283933298Rat
41087330LOC120094214uncharacterized LOC12009421488400250984013022Rat
1359106Hmgn3high mobility group nucleosomal binding domain 388402249384059329Rat
7638023LOC102554276uncharacterized LOC10255427688419319184195615Rat
7565272LOC102554337uncharacterized LOC10255433788420394784216610Rat
1308555Lca5lebercilin LCA588430769684375025Rat
40968517Rps18-ps9ribosomal protein S18, pseudogene 988440540484413636Rat
1591931Sh3bgrl2SH3 domain binding glutamate-rich protein like 288446101984553124Rat
41362891LOC120094469small nucleolar RNA SNORA3288461557284615693Rat
11519521LOC108351754uncharacterized LOC10835175488463421784651606Rat
1561808Rpl12l1ribosomal protein L12 like 188466886184669316Rat
1592001Psma3-ps2proteasome 20S subunit alpha 3, pseudogene 288468696984687667Rat
1561944Rpl32l4ribosomal protein L32 like 488469112884692042Rat
1305630Elovl4ELOVL fatty acid elongase 488470291684729466Rat
1305558TtkTtk protein kinase88475432984792653Rat
11402458LOC108351756uncharacterized LOC10835175688480554184813217Rat
7534926LOC102557516uncharacterized LOC10255751688483955284845198Rat
2197Bckdhbbranched chain keto acid dehydrogenase E1 subunit beta88484526485027812Rat
41324543LOC120094530U2 spliceosomal RNA88512457585124688Rat
1560917Mrpl41l1mitochondrial ribosomal protein L41 like 188519488885195617Rat
7628669LOC102557561uncharacterized LOC10255756188547517685499501Rat
41084891LOC12009439560S ribosomal protein L23a-like88586727985867746Rat
1311381Tent5aterminal nucleotidyltransferase 5A88622229486229045Rat
41338377LOC120094217uncharacterized LOC12009421788655284386619689Rat
1311697Ibtkinhibitor of Bruton tyrosine kinase88662559186698661Rat
2323631Rps20l4ribosomal protein S20 like 488674204486742448Rat
1592988Qprt-ps1quinolinate phosphoribosyltransferase, pseudogene 188674227686748571Rat
1592978Fam162a-ps1family with sequence similarity 162, member A, pseudogene 188674588586746409Rat
41222774LOC120094218uncharacterized LOC12009421888674920386760055Rat
1564645Rpl7l3ribosomal protein L7 like 388676725186768751Rat
41308721LOC120094219uncharacterized LOC12009421988678438886793593Rat
621453Tpbgtrophoblast glycoprotein88679395386797324Rat
1306773Ube3dubiquitin protein ligase E3D88724550387413104Rat
7697767LOC102551813stathmin-like88733700887342005Rat
1305534Dop1aDOP1 leucine zipper like protein A88741526687517935Rat
1305221Pgm3phosphoglucomutase 388751831787536021Rat
1306231Rwdd2aRWD domain containing 2A88753615387539301Rat
3074Me1malic enzyme 188754904387660251Rat
41057967LOC120094502small nucleolar RNA SNORA1788766926087669389Rat
1311282Prss35serine protease 3588771444987731009Rat
69276Snap91synaptosome associated protein 9188773805687852690Rat
1308746Ripply2ripply transcriptional repressor 288797444487979002Rat
621834Cyb5r4cytochrome b5 reductase 488797559688048356Rat
1309873Mrap2melanocortin 2 receptor accessory protein 288808829388144636Rat
1307365Cep162centrosomal protein 16288814972688208249Rat
40945090LOC120094515small nucleolar RNA SNORA1788834979688349900Rat
41073943LOC120094509small nucleolar RNA SNORA1788837892888379059Rat
1309856Tbx18T-box transcription factor 1888865205488680081Rat
6502768Tmem35a-ps1transmembrane protein 35A, pseudogene 188868682588726630Rat
40963998LOC120094495small nucleolar RNA SNORA1788883627888836408Rat
11372990LOC108351758uncharacterized LOC10835175888890253788928968Rat
41355029LOC120094499small nucleolar RNA SNORA1788895301488953135Rat
41061488LOC120094507small nucleolar RNA SNORA1788918676189186885Rat
41211208Rps15-ps11ribosomal protein S15, pseudogene 1188919550489198310Rat
2323108Gabarapl3GABA type A receptor associated protein like 388924617589247132Rat
61956Nt5e5' nucleotidase, ecto88927104689314918Rat
1310921Snx14sorting nexin 1488928367389390597Rat
1305683Syncripsynaptotagmin binding, cytoplasmic RNA interacting protein88940248789435517Rat
6500498Syncrip-ps2synaptotagmin binding, cytoplasmic RNA interacting protein, pseudogene 288946979889496534Rat
41182834LOC120094450small nucleolar RNA SNORD5088947028589470356Rat
2302581Zfp949zinc finger protein 94988952298189548015Rat
1561074Trim43atripartite motif-containing 43A88956256889568716Rat
41224969LOC120094451small nucleolar RNA SNORD5088957595789576028Rat
1560775RGD1560775similar to RIKEN cDNA 4930579C12 gene88960339389716767Rat
620621Bcl2a1BCL2-related protein A188971691489724998Rat
1306876Mthfsmethenyltetrahydrofolate synthetase88972949889801998Rat
7752226Rps16-ps7ribosomal protein S16, pseudogene 788973512489735589Rat
41399050LOC120094223uncharacterized LOC12009422388984564389877107Rat
41218560LOC120094478small nucleolar RNA SNORA4889002075390020894Rat
41382728Trnap-agg82transfer RNA proline (anticodon AGG) 8289003406090034140Rat
11358086LOC108351761uncharacterized LOC10835176189003474090038456Rat
1591930Minar1membrane integral NOTCH2 associated receptor 189013737490169152Rat
1303327Tmed3transmembrane p24 trafficking protein 389024151690249429Rat
1305403Ankrd34cankyrin repeat domain 34C89027126490281759Rat
2325559Mir184microRNA 18489034313490343210Rat
620395Rasgrf1RAS protein-specific guanine nucleotide-releasing factor 189044515490574274Rat
41095375LOC120094224uncharacterized LOC12009422489057670990583532Rat
7644553Rps24-ps11ribosomal protein S24, pseudogene 1189059280290593237Rat
41175925LOC120094225uncharacterized LOC12009422589060277390606208Rat
2447Ctshcathepsin H89060894190627824Rat
1307938Morf4l1mortality factor 4 like 189064298890664518Rat
41210805Trnak-cuu18transfer RNA lysine (anticodon CUU) 1889067387490673946Rat
1306713Adamts7ADAM metallopeptidase with thrombospondin type 1 motif, 789070472790744333Rat
1307436Tbc1d2bTBC1 domain family, member 2B89074622090814867Rat
6485805Tomm7-ps1translocase of outer mitochondrial membrane 7, pseudogene 189088964590890841Rat
620110Zic1Zic family member 189190854891918020Rat
1307298Zic4Zic family member 489191635691936525Rat
41196387Trnaa-agc58transfer RNA alanine (anticodon AGC) 5889201907692019150Rat
1584689Tada3-ps2transcriptional adaptor 3, pseudogene 289228788992291715Rat
1564500Plscr5phospholipid scramblase family, member 589271747992738843Rat
620521Plscr1phospholipid scramblase 189278427992804698Rat
41193674LOC120094226uncharacterized LOC12009422689278450392788684Rat
7503624LOC102550510uncharacterized LOC10255051089279782992809410Rat
1359107Plscr2phospholipid scramblase 289280942292845947Rat
7575278Plscr1l1phospholipid scramblase 1 like 189286046592903695Rat
1311693Plscr4phospholipid scramblase 489298729093026056Rat
41403003LOC120094505small nucleolar RNA SNORA1789306119193061321Rat
41295749Rpl39-ps5ribosomal protein L39, pseudogene 589307587493077017Rat
3353Plod2procollagen lysine, 2-oxoglutarate 5-dioxygenase 289308454893167255Rat
7751313LOC102551814uncharacterized LOC10255181489319373693205500Rat
1591998Hnrnpa1-ps8heterogeneous nuclear ribonucleoprotein A1, pseudogene 889320837693214852Rat
41308155LOC120094229uncharacterized LOC12009422989324345093250949Rat
1598029Akr1b8-ps4aldo-keto reductase family 1, member B8, pseudogene 489327745793311293Rat
1591997Rpsa-ps17ribosomal protein SA, pseudogene 1789331143993316261Rat
11471749LOC108351854glyceraldehyde-3-phosphate dehydrogenase pseudogene89336940193370460Rat
11434961LOC108351767uncharacterized LOC10835176789342899693472926Rat
41266392Rps24-ps5ribosomal protein S24, pseudogene 589372844393732999Rat
11364685LOC108351768uncharacterized LOC10835176889381359193839203Rat
1597977Nlrp4a-ps2NLR family, pyrin domain containing 4A, pseudogene 289385776593859240Rat
41120561LOC120094230uncharacterized LOC12009423089467964294691218Rat
1309079Dipk2adivergent protein kinase domain 2A89507069595089815Rat
7742486LOC102552709uncharacterized LOC10255270989511609195128967Rat
9189460LOC103690449uncharacterized LOC10369044989516298995166157Rat
41074420LOC120094425U6 spliceosomal RNA89520675995206858Rat
7608024LOC102552777uncharacterized LOC10255277789521307495231913Rat
1560736Slc9a9solute carrier family 9 member A989523288995797262Rat
7636607LOC102553663uncharacterized LOC10255366389580993895864911Rat
7591571LOC102553774uncharacterized LOC10255377489590977095926319Rat
1306988Chst2carbohydrate sulfotransferase 289596006795966312Rat
9120336Fcf1-ps1Fcf1 rRNA-processing protein, pseudogene 189597941995980001Rat
1307882U2surpU2 snRNP-associated SURP domain containing89601893296075795Rat
41137774LOC120094231uncharacterized LOC12009423189610152196102430Rat
1311515Paqr9progestin and adipoQ receptor family member 989611424996116546Rat
1595195PCOLCE2procollagen C-endopeptidase enhancer 289619346196251116Rat
41343926Itpa-ps1inosine triphosphatase, pseudogene 189623120296231933Rat
619783Trpc1transient receptor potential cation channel, subfamily C, member 189626332296314220Rat
1307142Pls1plastin 189631670396426592Rat
41150068LOC120094233uncharacterized LOC12009423389631837696320168Rat
41319771LOC120094232uncharacterized LOC12009423289639074396394821Rat
1305796AtrATR serine/threonine kinase89642670496524152Rat
7659838Bnip3-ps2BCL2 interacting protein 3, pseudogene 289646485896465381Rat
41015759LOC120094234uncharacterized LOC12009423489650656296511534Rat
1309713Xrn15'-3' exoribonuclease 189652787196637385Rat
1311223Gk5glycerol kinase 589668246996751407Rat
1305814Tfdp2transcription factor Dp-289676045996901466Rat
41108117LOC120094461small nucleolar RNA SNORA4489678999796790110Rat
7579406Atp5pb-ps1ATP synthase peripheral stalk-membrane subunit b, pseudogene 189683640696837758Rat
7748306LOC10255073460S ribosomal protein L31-like89687558996876088Rat
2172Atp1b3ATPase Na+/K+ transporting subunit beta 389691026596941592Rat
1597741Ube2v1-ps21ubiquitin conjugating enzyme E2 V1, pseudogene 2189697720796977880Rat
1311048Rnf7ring finger protein 789703884597048080Rat
7718778Lrrc78leucine rich repeat containing 7889705363797097529Rat
41163910LOC120094236uncharacterized LOC12009423689706750797073580Rat
41270716LOC120094237uncharacterized LOC12009423789709657797097660Rat
3538Rasa2RAS p21 protein activator 289711998397236687Rat
9420290LOC103690484peptidyl-prolyl cis-trans isomerase D pseudogene89717968997180610Rat
1310136Zbtb38zinc finger and BTB domain containing 3889728461797288518Rat
6502759LOC100909637uncharacterized LOC10090963789729606897308537Rat
1359617Pxylp12-phosphoxylose phosphatase 189741976697485163Rat
41163201LOC120094379uncharacterized LOC12009437989749130997494993Rat
1562307Spsb4splA/ryanodine receptor domain and SOCS box containing 489753651997609757Rat
1561847Bax-ps1BCL2 associated X, apoptosis regulator, pseudogene 189764651097647102Rat
1591928Slc25a36solute carrier family 25 member 3689765984897693735Rat
2318277LOC10036581040S ribosomal protein S17-like89778533897785745Rat
1359699Trim42tripartite motif-containing 4289790234997923268Rat
41055522LOC120094487small nucleolar RNA SNORA1789801567098015799Rat
621151Clstn2calsyntenin 289802040698637232Rat
41216811LOC120094406U6 spliceosomal RNA89819226898192358Rat
1309140Nmnat3nicotinamide nucleotide adenylyltransferase 389889216899003912Rat
3543Rbp1retinol binding protein 189902521899046740Rat
3544Rbp2retinol binding protein 289907929399104489Rat
1565403Nme2-ps8NME/NM23 nucleoside diphosphate kinase 2, pseudogene 889912333299123801Rat
628746Copb2COPI coat complex subunit beta 289916132499183452Rat
1585674Mrps22mitochondrial ribosomal protein S2289918411099197278Rat
1591440Prr23a1proline rich 23A, member 189942457499425362Rat
1591431Prr23a2proline rich 23A, member 289943846299439250Rat
1591417Prr23a3proline rich 23A, member 389944646199447356Rat
1592646Prr23d1proline rich 23 domain containing 189947258799473303Rat
7499445LOC102547261uncharacterized LOC10254726189950782299512467Rat
1310041Foxl2forkhead box L289951297199514500Rat
620572FaimFas apoptotic inhibitory molecule89954387799569499Rat
735201Cxadrl1coxsackie virus and adenovirus receptor-like 189956541799592658Rat
620917Pik3cbphosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta89959460099699772Rat
40929302LOC120094534U2 spliceosomal RNA89971027199710431Rat
2319586Ndufs4-ps1NADH:ubiquinone oxidoreductase subunit S4, pseudogene 189978179699784781Rat
1590301FaimlFas apoptotic inhibitory molecule like89979184999810206Rat
1561486Cep70centrosomal protein 7089981027099863279Rat
41103848Dnajc8-ps3DnaJ heat shock protein family (Hsp40) member C8, pseudogene 389983022999831087Rat
1561304Esyt3extended synaptotagmin 389987041899917298Rat
3111Mrasmuscle RAS oncogene homolog899944036100006771Rat
1564871Nme9NME/NM23 family member 98100013190100034511Rat
1310477Armc8armadillo repeat containing 88100036946100131544Rat
41067249LOC120094240uncharacterized LOC1200942408100133210100138944Rat
1598038Dbr1debranching RNA lariats 18100139039100150768Rat
1590210A4gntalpha-1,4-N-acetylglucosaminyltransferase8100172038100179218Rat
7555737LOC102547387uncharacterized LOC1025473878100179745100187331Rat
1311430Dzip1lDAZ interacting zinc finger protein 1-like8100188414100229077Rat
1359696Cldn18claudin 188100246499100265797Rat
41110049LOC120094486small nucleolar RNA SNORA178100298555100298686Rat
1309654Sox14SRY-box transcription factor 148100421982100423918Rat
40991928LOC120094517small nucleolar RNA SNORA178100473463100473596Rat
1564597Rps25-ps10ribosomal protein S25, pseudogene 108100574838100576990Rat
7595944LOC102548160uncharacterized LOC1025481608100802730100813286Rat
1591996Psmb4-ps1proteasome 20S subunit beta 4, pseudogene 18100922809100923699Rat
41187373LOC120094241uncharacterized LOC1200942418100974094100974966Rat
1566151Il20rbinterleukin 20 receptor subunit beta8100979085101010829Rat
1310688Nck1NCK adaptor protein 18101018610101079237Rat
1306109Slc35g2solute carrier family 35, member G28101085579101113339Rat
1310744Stag1STAG1 cohesin complex component8101179039101564684Rat
41334951LOC120094242uncharacterized LOC1200942428101332200101337752Rat
41317709Rpl19-ps8ribosomal protein L19, pseudogene 88101584172101590537Rat
3265Pccbpropionyl-CoA carboxylase subunit beta8101591218101641213Rat
1310355Msl2MSL complex subunit 28101676605101702818Rat
1306958Ppp2r3aprotein phosphatase 2, regulatory subunit B'', alpha8101703512101841530Rat
41380325LOC120094496small nucleolar RNA SNORA178101976979101977111Rat
11361279LOC108351773uncharacterized LOC1083517738101986234102002203Rat
1585494Eif4e1beukaryotic translation initiation factor 4E family member 1B1798313389856250Rat
70992Sncbsynuclein, beta1798468029855013Rat
1586834Btf3l9basic transcription factor 3 like 95146185726146186680Rat
1593518Rpl37al3ribosomal protein L37A like 35146187894146188407Rat
620649Hmgn2high mobility group nucleosomal binding domain 25146192126146195580Rat
1311560Dhddsdehydrodolichyl diphosphate synthase subunit5146198359146224479Rat
1566408Lin28alin-28 homolog A5146227119146244122Rat
2323855Zfp683zinc finger protein 6835146277972146285856Rat
1308621Crybg2crystallin beta-gamma domain containing 25146286406146318417Rat
620627Cd52CD52 molecule5146319789146321348Rat
2322860LOC100360087ferritin light chain 1-like5146322749146323666Rat
620769Ubxn11UBX domain protein 115146329666146353529Rat
1308118Sh3bgrl3SH3 domain binding glutamate-rich protein like 35146354152146355525Rat
1311520Cep85centrosomal protein 855146356571146404155Rat
1585597UmodlUromoduilin-like5146404028146421646Rat
1565213Catsper4cation channel, sperm associated 45146427682146447346Rat
1311879Cnksr1connector enhancer of kinase suppressor of Ras 15146447495146458332Rat
40986275LOC120103003uncharacterized LOC1201030035146447967146449456Rat
1310179Zfp593zinc finger protein 5935146462670146464998Rat
11378091C5h1orf232similar to human chromosome 1 open reading frame 2305146466411146469627Rat
1564994Fam110dfamily with sequence similarity 110, member D5146471048146474019Rat
1307476Pdik1lPDLIM1 interacting kinase 1 like5146495115146507363Rat
619964Trim63tripartite motif containing 635146533492146547332Rat
3707Slc30a2solute carrier family 30 member 25146559733146571957Rat
1309572Extl1exostosin-like glycosyltransferase 15146573911146589115Rat
41076724LOC120103006uncharacterized LOC1201030065146587011146600907Rat
631399Pafah2platelet-activating factor acetylhydrolase 25146607050146636203Rat
7574873LOC102546373uncharacterized LOC1025463735146643874146659857Rat
2992Stmn1stathmin 15146680757146687154Rat
7517157LOC102546455uncharacterized LOC1025464555146705497146708855Rat
1563621Paqr7progestin and adipoQ receptor family member 75146709159146720577Rat
1589922Aunipaurora kinase A and ninein interacting protein5146722329146734924Rat
1305453Mtfr1lmitochondrial fission regulator 1-like5146736927146746891Rat
1304574Selenonselenoprotein N5146748638146764656Rat
1309672Man1c1mannosidase, alpha, class 1C, member 15146774282146913257Rat
41035181Trnap-agg56transfer RNA proline (anticodon AGG) 565146832261146832333Rat
1563417Ldlrap1low density lipoprotein receptor adaptor protein 15146955607146978601Rat
41173447Ppia-ps9peptidylprolyl isomerase A, pseudogene 95146987474146988138Rat
1561685Maco1macoilin 15147012416147075265Rat
620451RhdRh blood group, D antigen5147087479147121716Rat
1305638Tmem50atransmembrane protein 50A5147123670147138859Rat
1359529Rsrp1arginine and serine rich protein 15147147774147151523Rat
621592Syf2SYF2 pre-mRNA-splicing factor5147156492147164416Rat
7663941LOC102551013uncharacterized LOC1025510135147289290147290615Rat
620082Runx3RUNX family transcription factor 35147360587147419161Rat
61857Clic4chloride intracellular channel 45147453702147513455Rat
41008082LOC120103007uncharacterized LOC1201030075147550251147563338Rat
1311258Srrm1serine and arginine repetitive matrix 15147559515147591895Rat
1587554Ncmapnoncompact myelin associated protein5147608042147623266Rat
1311826Rcan3RCAN family member 35147650935147671881Rat
1563439Nipal3NIPA-like domain containing 35147687310147725838Rat
1560169Stpg1sperm-tail PG-rich repeat containing 15147717084147769792Rat
7489045Mir6333microRNA 63335147725453147725563Rat
1308320Grhl3grainyhead-like transcription factor 35147774161147806291Rat
41112512LOC120103267small nucleolar RNA SNORD1045147790279147790348Rat
15660321700029M20RiklRIKEN cDNA 1700029M20 gene like5147857672147861173Rat
1562689Ifnlr1interferon, lambda receptor 15147919547147942328Rat
1559655Il22ra1interleukin 22 receptor subunit alpha 15147961496147986296Rat
1310060Myom3myomesin 35147992737148043282Rat
11384347LOC108351046uncharacterized LOC1083510465148064624148072253Rat
40978405LOC12010310460S acidic ribosomal protein P2-like5148078578148079869Rat
1311067Srsf10serine and arginine rich splicing factor 105148088759148102964Rat
1642418Pnrc2proline-rich nuclear receptor coactivator 25148103966148106950Rat
619713Cnr2cannabinoid receptor 25148125222148151548Rat
2636Fuca1alpha-L-fucosidase 15148152718148169972Rat
620554Hmgcl3-hydroxy-3-methylglutaryl-CoA lyase5148178203148192072Rat
621493GaleUDP-galactose-4-epimerase5148193886148198392Rat
620210Lypla2lysophospholipase 25148198466148203062Rat
1308048Pithd1PITH domain containing 15148205995148216490Rat
3827Eloaelongin A5148231600148246760Rat
1308681Rpl11ribosomal protein L115148274060148277708Rat
40970091LOC120103009uncharacterized LOC1201030095148311186148318268Rat
2860Id3inhibitor of DNA binding 35148372784148374353Rat
1593939E2f2E2F transcription factor 25148399193148422595Rat
1593929Asap3ArfGAP with SH3 domain, ankyrin repeat and PH domain 35148433382148476027Rat
1311369Tcea3transcription elongation factor A35148476941148509452Rat
1564482Igh-6l1immunoglobulin heavy chain 6 like 15148516031148517519Rat
1310584Zfp46zinc finger protein 465148519398148529903Rat
631348Hnrnprheterogeneous nuclear ribonucleoprotein R5148542999148574888Rat
40929551LOC120103181uncharacterized LOC1201031815148629572148633379Rat
2847Htr1d5-hydroxytryptamine receptor 1D5148656252148676532Rat
61839Luzp1leucine zipper protein 15148706094148781616Rat
1562975Kdm1alysine demethylase 1A5148782976148838319Rat
7515741Tex46testis expressed 465148849307148853742Rat
41335655LOC120103012uncharacterized LOC1201030125148862432148864196Rat
1561426Lactbl1lactamase beta like 15148862736148882108Rat
1564232Ephb2Eph receptor B25148889574149077027Rat
2229C1qbcomplement C1q B chain5149118843149124394Rat
1306828C1qccomplement C1q C chain5149127412149130757Rat
1306716C1qacomplement C1q A chain5149133635149136482Rat
708543Epha8Eph receptor A85149166107149193515Rat
1309866Zbtb40zinc finger and BTB domain containing 405149216496149283746Rat
40993789LOC120103324small nucleolar RNA SNORA175149261744149261873Rat
7523567LOC102552931uncharacterized LOC1025529315149304987149309952Rat
621348Wnt4Wnt family member 45149513573149535415Rat
71043Cdc42cell division cycle 425149555069149593239Rat
1307819Cela3bchymotrypsin like elastase 3B5149628773149636937Rat
15829021700013G24RiklRIKEN cDNA 1700013G24 gene like5149659136149662944Rat
621770Hspg2heparan sulfate proteoglycan 25149677437149778594Rat
1564888Ldlrad2low density lipoprotein receptor class A domain containing 25149778795149788335Rat
1582868Ifitm2-ps3interferon induced transmembrane protein 2, pseudogene 35149795885149796365Rat
735213Usp48ubiquitin specific peptidase 485149800189149867838Rat
1309908Rap1gapRap1 GTPase-activating protein5149873987149939254Rat
2100Alplalkaline phosphatase, biomineralization associated5149951397150006424Rat
41358971LOC120103369U4 spliceosomal RNA5150055348150055488Rat
620293Ece1endothelin converting enzyme 15150077679150179375Rat
1311370Eif4g3eukaryotic translation initiation factor 4 gamma, 35150197410150418862Rat
7577956LOC102553758uncharacterized LOC1025537585150254449150256398Rat
7710320Mif-ps5macrophage migration inhibitory factor, pseudogene 55150429739150435266Rat
735099Hp1bp3heterochromatin protein 1, binding protein 35150435781150463004Rat
1305952Sh2d5SH2 domain containing 55150469738150480615Rat
1562511Kif17kinesin family member 175150482288150521471Rat
1308970Ddostdolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit5150522297150529413Rat
1305769Pink1PTEN induced kinase 15150530523150542635Rat
1311101Cdacytidine deaminase5150556615150583231Rat
1560959Fam43bfamily with sequence similarity 43, member B5150610656150613054Rat
1309944Mul1mitochondrial E3 ubiquitin protein ligase 15150652812150661863Rat
708430Camk2n1calcium/calmodulin-dependent protein kinase II inhibitor 15150674819150676600Rat
41189039Rpl12-ps13ribosomal protein L12, pseudogene 135150695568150697827Rat
41097462LOC120103014uncharacterized LOC1201030145150731447150756572Rat
11410510LOC108351047uncharacterized LOC1083510475150782452150803056Rat
1308559Vwa5b1von Willebrand factor A domain containing 5B15150792959150864849Rat
11399691LOC108351048uncharacterized LOC1083510485150878366150941143Rat
1308335Ubxn10UBX domain protein 105150953772150959608Rat
3340Pla2g2cphospholipase A2, group IIC5150959365150981388Rat
1597305Pla2g2fphospholipase A2, group IIF5150986788150993175Rat
1309862Pla2g2dphospholipase A2, group IID5151016010151022531Rat
62051Pla2g5phospholipase A2, group V5151041339151109433Rat
620857Pla2g2aphospholipase A2 group IIA5151076442151079019Rat
1309611Pla2g2ephospholipase A2, group IIE5151121363151127147Rat
1560468Otud3OTU deubiquitinase 35151135826151162207Rat
1596075Rnf186ring finger protein 1865151210492151211716Rat
1566357Tmco4transmembrane and coiled-coil domains 45151216499151294726Rat
62044Htr65-hydroxytryptamine receptor 65151295269151312853Rat
40978356LOC120103015uncharacterized LOC1201030155151317157151325656Rat
3151Nbl1NBL1, DAN family BMP antagonist5151318752151329948Rat
1560187Micos10mitochondrial contact site and cristae organizing system subunit 105151341124151367403Rat
41362887LOC120103016uncharacterized LOC1201030165151366710151367798Rat
41043490Trnap-agg30transfer RNA proline (anticodon AGG) 305151400838151400918Rat
41327343LOC120103017uncharacterized LOC1201030175151406408151413716Rat
1359099Capzbcapping actin protein of muscle Z-line subunit beta5151435600151535409Rat
1311627Slc66a1solute carrier family 66 member 15151537870151552259Rat
620311Akr7a2aldo-keto reductase family 7, member A25151552375151560914Rat
11403420LOC10835104960S ribosomal protein L21 pseudogene5151557706151558692Rat
41081152Rpl9-ps6ribosomal protein L9, pseudogene 65151561590151564762Rat
41396958Rps21-ps9ribosomal protein S21, pseudogene 95151575060151575295Rat
628635Akr7a3aldo-keto reductase family 7 member A35151590968151601394Rat
1311709Mrto4MRT4 homolog, ribosome maturation factor5151601780151608533Rat
1310427Emc1ER membrane protein complex subunit 15151608557151633888Rat
1563121Ubr4ubiquitin protein ligase E3 component n-recognin 45151635825151743931Rat
11510646Trnav-aac3transfer RNA valine (anticodon AAC) 35151685931151686002Rat
1624207Iffo2intermediate filament family orphan 25151830900151876948Rat
7489030Mir6215microRNA 62155151850759151850825Rat
1624206Aldh4a1aldehyde dehydrogenase 4 family, member A15151880002151905491Rat
61894Tas1r2taste 1 receptor member 25151909617151925760Rat
1564360Pax7paired box 75151996368152098023Rat
1309439Klhdc7akelch domain containing 7A5152218604152224707Rat
41310584LOC120103106NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 3-like5152238538152242340Rat
1310117Igsf21immunoglobin superfamily, member 215152287834152512174Rat
40990336LOC120103019uncharacterized LOC1201030195152732403152760308Rat
1585585Arhgef10lRho guanine nucleotide exchange factor 10 like5152792247152935255Rat
41381585LOC120103021uncharacterized LOC1201030215152866852152870722Rat
41399912LOC120103020uncharacterized LOC1201030205152948438152954138Rat
41012019LOC120103022uncharacterized LOC1201030225152988982152994946Rat
1309986Rcc2regulator of chromosome condensation 25152994406153017223Rat
41224842LOC120103272small nucleolar RNA SNORA155153013761153013890Rat
1560424Padi6peptidyl arginine deiminase 65153021855153037443Rat
3290Padi4peptidyl arginine deiminase 45153041351153074412Rat
3289Padi3peptidyl arginine deiminase 35153089717153117146Rat
3287Padi1peptidyl arginine deiminase 15153119566153152034Rat
11392000Trnaa-ggc1transfer RNA alanine (anticodon GGC) 15153148357153148428Rat
7706312LOC102546642uncharacterized LOC1025466425153179682153185652Rat
3288Padi2peptidyl arginine deiminase 25153209053153251632Rat
1308598Sdhbsuccinate dehydrogenase complex iron sulfur subunit B5153264906153285570Rat
1307977Atp13a2ATPase cation transporting 13A25153292722153312143Rat
1306031Mfap2microfibril associated protein 25153312068153320266Rat
1305364Croccciliary rootlet coiled-coil, rootletin5153320962153363734Rat
40931018LOC120103023uncharacterized LOC1201030235153336474153344047Rat
735063Necap2NECAP endocytosis associated 25153370338153382753Rat
1591001Mien1-ps1migration and invasion enhancer 1, pseudogene 15153384604153386335Rat
2323583Rps21-ps1ribosomal protein S21, pseudogene 15153387133153387476Rat
41373048LOC120103386U6 spliceosomal RNA5153389988153390094Rat
1302954Spata21spermatogenesis associated 215153393309153419430Rat
1560286Szrd1SUZ RNA binding domain containing 15153418748153443286Rat
1304787Fbxo42F-box protein 425153451162153509564Rat
41150313LOC120103024ciliogenesis and planar polarity effector 2-like5153515263153522456Rat
1561421Cplane2ciliogenesis and planar polarity effector complex subunit 25153515507153516455Rat
11372222LOC108351054uncharacterized LOC1083510545153527374153541618Rat
1304766Arhgef19Rho guanine nucleotide exchange factor 195153536038153554203Rat
1307204Epha2Eph receptor A25153605644153634115Rat
2321550Rps27a-ps2ribosomal protein S27a, pseudogene 25153654975153655513Rat
1590955Fam131cfamily with sequence similarity 131, member C5153674459153690791Rat
68435Clcnkachloride voltage-gated channel Ka5153691208153706295Rat
628639Clcnkbchloride voltage-gated channel Kb5153710086153733162Rat
62021Hspb7heat shock protein family B (small) member 75153727782153731268Rat
1566083Srarpsteroid receptor associated and regulated protein5153740973153745077Rat
41131608Trnap-agg71transfer RNA proline (anticodon AGG) 715153742582153742654Rat
1307143Zbtb17zinc finger and BTB domain containing 175153753508153774613Rat
1589867Spenspen family transcriptional repressor5153775287153848677Rat
1359551Fblim1filamin binding LIM protein 15153883945153915524Rat
1566169Tmem82transmembrane protein 825153927486153931942Rat
1359157Slc25a34solute carrier family 25, member 345153932081153936854Rat
1307005Plekhm2pleckstrin homology and RUN domain containing M25153939582153978625Rat
1311815Ddi2DNA damage inducible 1 homolog 25153989591154035342Rat
1308424Agmatagmatinase5154043665154074278Rat
1359395Dnajc16DnaJ heat shock protein family (Hsp40) member C165154073372154106246Rat
61867Casp9caspase 95154108872154126628Rat
2548Cela2achymotrypsin like elastase 2A5154126879154136630Rat
1308379Ctrcchymotrypsin C5154147314154156540Rat
1307585Efhd2EF-hand domain family, member D25154160945154176980Rat
41372683LOC120103027uncharacterized LOC1201030275154166191154176642Rat
1563444Fhad1forkhead associated phosphopeptide binding domain 15154191593154310442Rat
1565452Tmem51transmembrane protein 515154325853154375882Rat
1359147Kaznkazrin, periplakin interacting protein5154392793155381567Rat
7556798LOC102556543uncharacterized LOC1025565435155086112155117875Rat
41390844LOC120103134uncharacterized LOC1201031345155094047155098985Rat
1594531Prdm2PR/SET domain 25155421066155531884Rat
9275519LOC103692503uncharacterized LOC1036925035155427014155438025Rat
41343775LOC120103347small nucleolar RNA SNORA175155523983155524131Rat
2324274Rps20-ps11ribosomal protein S20, pseudogene 115155541751155542269Rat
1587379Tuba1a-ps1tubulin, alpha 1A, pseudogene 15155578986155580721Rat
61819Pdpnpodoplanin5155601691155635656Rat
41178188Mrps18c-ps1mitochondrial ribosomal protein S18C, pseudogene 15155653808155654252Rat
11357843LOC108351056uncharacterized LOC1083510565155683180155686367Rat
1311416Lrrc38leucine rich repeat containing 385155685495155707578Rat
1588644Pramef27PRAME family member 275155752765155759663Rat
1564061Pramef8PRAME family member 85155778156155793935Rat
40956350LOC120103184uncharacterized LOC1201031845155836337155842393Rat
1565680Oog1oogenesin 15155841222155844210Rat
11425965Oog1l1oogenesin 1 like 15155872609155880103Rat
1587378Pramef5PRAME family member 55155905179155907727Rat
1588616Oog2l-ps1oogenesin 2 like, pseudogene 15155916280155919130Rat
1587479Klf4-ps1Kruppel like factor 4, pseudogene 15155920984155975266Rat
2324757Hspa8-ps14heat shock protein family A (Hsp70) member 8, pseudogene 145155934803155936915Rat
1565870Oog3oogenesin 35155941965155950037Rat
11422918Oog1-ps3oogenesin 1, pseudogene 35155975473155978753Rat
9144788LOC103692410uncharacterized LOC1036924105155998891156003422Rat
40938591LOC120103107PRAME family member 12-like5156009794156012390Rat
1306186Oog3l1oogenesin 3 like 15156075011156081595Rat
1587447Pramef17PRAME family member 175156138800156142916Rat
1561813Pramef25PRAME family member 255156157471156167485Rat
1587437Pramef20PRAME family member 205156171125156175601Rat
1587431Pramef12PRAME family member 125156193666156197199Rat
1587426Cfap107cilia and flagella associated protein 1075156212385156231481Rat
7240728LOC101241876ubiquitin-conjugating enzyme E2H pseudogene5156222650156224392Rat
1563257Aadacl3arylacetamide deacetylase-like 35156242182156252215Rat
1584908Pkm-ps9pyruvate kinase M1/2, pseudogene 95156327765156333340Rat
1593379Rps4x-ps4ribosomal protein S4, X-linked, pseudogene 45156331496156332390Rat
1308878Aadacl4fm1AADACL4 family member 15156356868156366479Rat
1563334Aadacl4fm2AADACL4 family member 25156426706156435333Rat
1565761Aadacl4arylacetamide deacetylase-like 45156514021156524567Rat
1559644AAdacl4fm3AADACL4 family member 35156562957156601387Rat
1587396AAdacl4fm3l1AADACL4 family member 3 like 15156616340156660184Rat
41325105Slc50a1-ps1solute carrier family 50 member 1, pseudogene 15156652637156654288Rat
40938168LOC120103322U2 spliceosomal RNA5156731160156731307Rat
41252684LOC120103202U1 spliceosomal RNA5156736935156737098Rat
7688236LOC102550246uncharacterized LOC1025502465156744643156747664Rat
1305584Dhrs3dehydrogenase/reductase 35156747939156782420Rat
1308403Vps13dvacuolar protein sorting 13 homolog D5156830509157055895Rat
7497539Rpl36-ps2ribosomal protein L36, pseudogene5157058147157063838Rat
621238Tnfrsf1bTNF receptor superfamily member 1B5157070642157104216Rat
3879Tnfrsf8TNF receptor superfamily member 85157123183157168421Rat
2319953Zfp54-ps1zinc finger protein 54, pseudogene 15157260727157263090Rat
9212267Rex2l5reduced expression 2 like 55157289647157297045Rat
41185038LOC120103190U6 spliceosomal RNA5157415839157415945Rat
7623967Rex2l4reduced expression 2 like 45157422388157447357Rat
7603077Csnk1g3-ps3casein kinase 1, gamma 3, pseudogene 35157457865157462163Rat
1586278Rex2l1-ps1reduced expression 2 like 1, pseudogene 15157462164157467683Rat
2319680Zfp34zinc finger protein 345157509762157513970Rat
9461644Rpl9l3ribosomal protein L9 like 35157529246157529919Rat
6484979Zfp715-ps3zinc finger protein 715, pseudogene 35157578907157600857Rat
6499833Csnk1g3-ps2casein kinase 1, gamma 3, pseudogene 25157602768157604408Rat
1586256Rex2reduced expression 25157624407157655095Rat
41309319LOC120103192U6 spliceosomal RNA5157661668157661774Rat
41208288Envl-ps9MLV-related proviral Env polyprotein-like, pseudogene 95157667260157668605Rat
41054755LOC120103207U6 spliceosomal RNA5157757303157757409Rat
41358647Csnk1g3-ps4casein kinase 1, gamma 3, pseudogene 45157777077157779988Rat
1598209Zfp534l1zinc finger protein 534 like 15157780156157799489Rat
41014938Rex2l6reduced expression 2 like 65157854013157869026Rat
41187377LOC120103211U6 spliceosomal RNA5157883496157883602Rat
1586249Rex2l2reduced expression 2 like 25157884460157919072Rat
41051487Gzfpx-ps1gastrula zinc finger protein XlCGF49.1-like, pseudogene 15157919226157928288Rat
1625998Vom2r-ps78vomeronasal 2 receptor, pseudogene 785157972263157972466Rat
41262442LOC120103205U6 spliceosomal RNA5157996975157997081Rat
41345120Csnk1g3-ps6casein kinase 1, gamma 3, pseudogene 65157998033158006335Rat
40962626Rex2l1reduced expression 2 like 15158006483158028876Rat
11425502Mzf1-ps1myeloid zinc finger 1, pseudogene 15158056614158075847Rat
1561413Zfp534l2zinc finger protein 534 like 25158083332158121374Rat
40937261LOC120103200U6 spliceosomal RNA5158193202158193308Rat
1565622Rex2l3reduced expression 2 like 35158197614158206543Rat
1586231Zfp933zinc finger protein 9335158264875158285036Rat
1587376Miipmigration and invasion inhibitory protein5158292510158299533Rat
628843Mfn2mitofusin 25158304285158335502Rat
621382Plod1procollagen-lysine, 2-oxoglutarate 5-dioxygenase 15158340674158367581Rat
13053502510039O18RiklRIKEN cDNA 2510039O18 gene like5158371925158378195Rat
3194Nppbnatriuretic peptide B5158416813158418175Rat
3193Nppanatriuretic peptide A5158429042158430351Rat
1305379Clcn6chloride voltage-gated channel 65158434299158465174Rat
1309952Mthfrmethylenetetrahydrofolate reductase5158465248158484999Rat
9312074LOC103692509NHP2-like protein 1 pseudogene5158486178158487351Rat
7658417C5h1orf167similar to human chromosome 1 open reading frame 1675158495514158505671Rat
1359346Agtrapangiotensin II receptor-associated protein5158507427158519036Rat
7646732LOC102551534uncharacterized LOC1025515345158519138158525313Rat
7635238LOC102551596uncharacterized LOC1025515965158527525158537091Rat
1585098Draxindorsal inhibitory axon guidance protein5158530149158563457Rat
11399174Rpl35a-ps7ribosomal protein L35A, pseudogene 75158543667158544122Rat
1307499Mad2l2mitotic arrest deficient 2 like 25158563545158576698Rat
620418Fbxo6F-box protein 65158576729158582520Rat
1562463Fbxo44F-box protein 445158583363158592510Rat
621751Fbxo2F-box protein 25158592926158598355Rat
11370875LOC108351059uncharacterized LOC1083510595158642708158648830Rat
1305820Disp3dispatched RND transporter family member 35158672015158720806Rat
7568401LOC102551951uncharacterized LOC1025519515158790419158814003Rat
1309588Ubiad1UbiA prenyltransferase domain containing 15158856582158880490Rat
68371Mtormechanistic target of rapamycin kinase5158884856158994311Rat
7553363Angptl7angiopoietin like 75158932096158937281Rat
41178027LOC120103237U6 spliceosomal RNA5158992110158992191Rat
1593248Exosc10exosome component 105158995313159018940Rat
620796Srmspermidine synthase5159025875159029076Rat
620214Masp2MBL associated serine protease 25159035892159049561Rat
1310906TardbpTAR DNA binding protein5159050518159062218Rat
1585063C5h1orf127similar to human chromosome 1 open reading frame 1275159075217159110642Rat
1583785Rpl14-ps2ribosomal protein L14, pseudogene 25159083415159084154Rat
9103835LOC103692510uncharacterized LOC1036925105159177068159182477Rat
1585054Rpl36-ps9ribosomal protein L36, pseudogene5159193171159193526Rat
1563533Casz1castor zinc finger 15159243965159393935Rat
40976780LOC120103035uncharacterized LOC1201030355159315651159317385Rat
41005014LOC120103036uncharacterized LOC1201030365159385958159387911Rat
68336Pex14peroxisomal biogenesis factor 145159399776159536260Rat
620334DffaDNA fragmentation factor subunit alpha5159540715159553639Rat
2383Cortcortistatin5159560591159562032Rat
5128728Cenpscentromere protein S5159563917159573534Rat
1583832Pgdphosphogluconate dehydrogenase5159582746159598945Rat
621520Kif1bkinesin family member 1B5159607697159742778Rat
7740951LOC102547502uncharacterized LOC1025475025159750135159753986Rat
1304738Ube4bubiquitination factor E4B5159766829159870509Rat
1562168Rbp7retinol binding protein 75159889723159894338Rat
1310996Nmnat1nicotinamide nucleotide adenylyltransferase 15159910242159928201Rat
1309253Lzicleucine zipper and CTNNBIP1 domain containing5159928260159941512Rat
1562749Ctnnbip1catenin, beta-interacting protein 15159961961160010942Rat
1306458Clstn1calsyntenin 15160031235160094585Rat
1310990Pik3cdphosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta5160094952160142962Rat
41104095LOC120103039uncharacterized LOC1201030395160121608160136130Rat
1583947Tmem201transmembrane protein 2015160166240160188874Rat
1583942Slc25a33solute carrier family 25 member 335160195040160219961Rat
7665827LOC102548220uncharacterized LOC1025482205160221868160230064Rat
11081182Rps2-ps44ribosomal protein S2, pseudogene 445160315121160316979Rat
40999891LOC120103040uncharacterized LOC1201030405160327597160335926Rat
7685779LOC102548366uncharacterized LOC1025483665160334477160342093Rat
1309319Spsb1splA/ryanodine receptor domain and SOCS box containing 15160358292160418541Rat
41076681LOC120103041uncharacterized LOC1201030415160363004160374305Rat
1306562H6pdhexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)5160434499160470203Rat
9106117LOC103692514uncharacterized LOC1036925145160492438160536093Rat
2325584Mir34amicroRNA 34a5160533002160533103Rat
1311096Gpr157G protein-coupled receptor 1575160550703160566432Rat
68328Slc2a5solute carrier family 2 member 55160583055160609994Rat
41108681Trnap-agg69transfer RNA proline (anticodon AGG) 695160593071160593143Rat
1583902Slc2a7solute carrier family 2 member 75160624793160643994Rat
70516Car6carbonic anhydrase 65160658104160676644Rat
40957798LOC120103042uncharacterized LOC1201030425160700913160702509Rat
2553Eno1enolase 15160719951160731337Rat
629475Rerearginine-glutamic acid dipeptide repeats5160765855161097678Rat
11484356LOC108351064small nuclear ribonucleoprotein G pseudogene5160808304160808653Rat
41403641LOC120103044uncharacterized LOC1201030445160819820160826047Rat
7489027Mir6332microRNA 63325160837304160837424Rat
11382308Lyrm1-ps1LYR motif containing 1, pseudogene 15160985501160990216Rat
708502Slc45a1solute carrier family 45, member 15161105137161129375Rat
41352911LOC120103185uncharacterized LOC1201031855161210596161213637Rat
11393480LOC108351065uncharacterized LOC1083510655161250833161259753Rat
41290417LOC120103045uncharacterized LOC1201030455161256550161271160Rat
7562865LOC102556220uncharacterized LOC1025562205161299020161308656Rat
1307599Errfi1ERBB receptor feedback inhibitor 15161323981161337289Rat
7515381LOC102556316uncharacterized LOC1025563165161338766161342775Rat
621808Park7Parkinsonism associated deglycase5161353718161376993Rat
1598208Tnfrsf9TNF receptor superfamily member 95161381662161408003Rat
41094677LOC120103213U1 spliceosomal RNA5161425753161425910Rat
7752004LOC102556501uncharacterized LOC1025565015161425916161432327Rat
3930Uts2urotensin 25161450846161456235Rat
621581Per3period circadian regulator 35161460228161495404Rat
61880Vamp3vesicle-associated membrane protein 35161498109161508704Rat
1562703Camta1calmodulin binding transcription activator 15161510283162356902Rat
41065227LOC120103136uncharacterized LOC1201031365161911199161914157Rat
41234809LOC120103137uncharacterized LOC1201031375162236317162237584Rat
2323948Rps7-ps23ribosomal protein S7, pseudogene 235162360919162361585Rat
1307731Dnajc11DnaJ heat shock protein family (Hsp40) member C115162442042162487966Rat
1308109Thap3THAP domain containing 35162488480162494149Rat
1308145Phf13PHD finger protein 135162494574162501350Rat
41032543Rps25-ps9ribosomal protein S25, pseudogene 95162512140162512644Rat
1305863Klhl21kelch-like family member 215162514888162523545Rat
1311581Zbtb48zinc finger and BTB domain containing 485162525234162533604Rat
61891Tas1r1taste 1 receptor member 15162533838162546408Rat
1566167Nol9nucleolar protein 95162546522162566625Rat
1303132Plekhg5pleckstrin homology and RhoGEF domain containing G55162577999162621518Rat
1598206Tnfrsf25TNF receptor superfamily member 255162621669162626341Rat
620652Espnespin5162626560162660439Rat
62082Hes2hes family bHLH transcription factor 25162667190162668235Rat
628856Acot7acyl-CoA thioesterase 75162686562162779309Rat
1564170Gpr153G protein-coupled receptor 1535162781587162792975Rat
621339Hes3hes family bHLH transcription factor 35162793611162799578Rat
621618Icmtisoprenylcysteine carboxyl methyltransferase5162804368162811129Rat
1586262Rnf207ring finger protein 2075162815351162828325Rat
621189Rpl22ribosomal protein L225162835241162843394Rat
1582725Chd5chromodomain helicase DNA binding protein 55162848273162898997Rat
41199189LOC120103139uncharacterized LOC1201031395162853752162869630Rat
61828Kcnab2potassium voltage-gated channel subfamily A regulatory beta subunit 25162899511162988057Rat
1560172Nphp4nephrocystin 45162986157163073708Rat
7592969LOC102549399uncharacterized LOC1025493995163254605163276115Rat
7559930LOC102549463uncharacterized LOC1025494635163372772163385090Rat
41139699LOC120102800uncharacterized LOC1201028005163412839163416456Rat
1583705Rps15l1ribosomal protein S15 like 15163534526163534957Rat
7567711LOC102550429uncharacterized LOC1025504295163882757163897322Rat
1590138Ajap1adherens junctions associated protein 15163907846164021004Rat
41074338LOC120102801uncharacterized LOC1201028015164197757164199030Rat
40995206LOC120103047uncharacterized LOC1201030475164309682164318401Rat
40962925LOC120103342small nucleolar RNA SNORA175164429616164429749Rat
7751891LOC102551503uncharacterized LOC1025515035164491814164502902Rat
1304567C5h1orf174similar to human chromosome 1 open reading frame 1745164515578164520022Rat
620335DffbDNA fragmentation factor subunit beta5164522446164534733Rat
708505Cep104centrosomal protein 1045164534773164567260Rat
1308599Lrrc47leucine rich repeat containing 475164570539164580174Rat
1564257Smim1small integral membrane protein 1 (Vel blood group)5164579327164584650Rat
41047818LOC120103048uncharacterized LOC1201030485164584783164587144Rat
1587099Ccdc27coiled-coil domain containing 275164585285164599391Rat
7631678LOC102551562uncharacterized LOC1025515625164599489164623337Rat
1307083Tp73tumor protein p735164621377164703958Rat
1359137Wrap73WD repeat containing, antisense to TP735164706112164721645Rat
1590079Tprg1ltumor protein p63 regulated 1-like5164722151164725358Rat
621188Megf6multiple EGF-like-domains 65164738272164839142Rat
1588981Arhgef16Rho guanine nucleotide exchange factor 165164843656164866212Rat
2324431Prdm16PR/SET domain 165164879864165203986Rat
7704566LOC102555433uncharacterized LOC1025554335165073392165074717Rat
41154709LOC120103049uncharacterized LOC1201030495165116308165119101Rat
1359657Actrt2actin-related protein T25165236092165237492Rat
7643067LOC102555491uncharacterized LOC1025554915165297127165312356Rat
1304840Ttc34tetratricopeptide repeat domain 345165411063165428864Rat
1309299Mmel1membrane metallo-endopeptidase-like 15165431278165461716Rat
1308251Prxl2bperoxiredoxin like 2B5165462610165465213Rat
1310115Tnfrsf14TNF receptor superfamily member 145165486069165494421Rat
621340Hes5hes family bHLH transcription factor 55165522138165523684Rat
628857Pank4pantothenate kinase 45165525340165542139Rat
1304675Plch2phospholipase C, eta 25165544209165613769Rat
1591776Pex10peroxisomal biogenesis factor 105165627799165632965Rat
1306324Rer1retention in endoplasmic reticulum sorting receptor 15165634567165646643Rat
1359433Morn1MORN repeat containing 15165646817165704892Rat
11448041LOC108351067uncharacterized LOC1083510675165677374165684465Rat
1565591SkiSki proto-oncogene5165713525165782134Rat
9262356LOC103692526uncharacterized LOC1036925265165789713165797688Rat
1308923Faap20FA core complex associated protein 205165808370165815291Rat
3399Prkczprotein kinase C, zeta5165817786165930386Rat
7499193Pigp-ps1phosphatidylinositol glycan anchor biosynthesis, class P, pseudogene 15165933641165934070Rat
1560519ThadaTHADA, armadillo repeat containing61018394210488007Rat
1308913Zfp36l2zinc finger protein 36, C3H type-like 261049003210494073Rat
11488608LOC108351166uncharacterized LOC10835116661052667810530961Rat
7609114Sypl1-ps2synaptophysin-like 1, pseudogene 261054549710548918Rat
41317467LOC120093193uncharacterized LOC12009319361061074610635328Rat
7612440LOC102548368uncharacterized LOC10254836861075002610768661Rat
7556929LOC102548459wiskott-Aldrich syndrome protein family member 1-like61082928010831419Rat
11501632Trnai-uau2transfer RNA isoleucine (anticodon UAU) 261083035410830446Rat
41013930LOC120093196uncharacterized LOC12009319661084041310846118Rat
71071Haao3-hydroxyanthranilate 3,4-dioxygenase61084523510864863Rat
1306803Mta3metastasis associated 1 family, member 361086702810987221Rat
628832Kcng3potassium voltage-gated channel modifier subfamily G member 361105131111099264Rat
41017011LOC120093197uncharacterized LOC12009319761117154911174023Rat
1306111Cox7a2lcytochrome c oxidase subunit 7A2 like61118406411198287Rat
1304690Eml4EMAP like 461121954511334824Rat
41086840Tpt1-ps10tumor protein, translationally-controlled 1 pseudogene 1061127659911281855Rat
7670283LOC102556624uncharacterized LOC10255662461137269211391056Rat
1584001H3f3a-ps3H3.3 histone A, pseudogene 361142150211422456Rat
1311939Pkdccprotein kinase domain containing, cytoplasmic61145568611465002Rat
40976299LOC120103472uncharacterized LOC12010347261150009711506294Rat
41369146LOC120103473uncharacterized LOC12010347361154293711571649Rat
6500550LOC100910081uncharacterized LOC10091008161159164611595180Rat
41061512LOC120093297U6 spliceosomal RNA61167129611671408Rat
1597030Psme3-ps3proteasome activator subunit 3, pseudogene 361171370711714533Rat
9236593LOC103692540phosphomannomutase 1 pseudogene61172600911726743Rat
7641948LOC102552412uncharacterized LOC10255241261208624212306215Rat
11472968Trnan-guu7transfer RNA asparagine (anticodon GUU) 761211289212112965Rat
41084834LOC120093453small nucleolar RNA SNORA1761259463112594762Rat
41343787LOC120103474uncharacterized LOC12010347461264155012651167Rat
6501902Set-ps7Set nuclear proto-oncogene, pseudogene 761290888912920762Rat
41135465LOC120103475uncharacterized LOC12010347561304145813055736Rat
3717Slc8a1solute carrier family 8 member A161319460913547369Rat
41176911LOC120093498U4 spliceosomal RNA61320151713201659Rat
1306878Thumpd2THUMP domain containing 261392474213976657Rat
1303057Tmem178atransmembrane protein 178A61400462914063677Rat
11506404LOC108351161uncharacterized LOC10835116161408466814150295Rat
41271659LOC120103476uncharacterized LOC12010347661411879214128563Rat
7726994LOC102551891uncharacterized LOC10255189161419089814203284Rat
621280Map4k3mitogen-activated protein kinase kinase kinase kinase 361427662314446321Rat
7610953LOC102551744eukaryotic translation initiation factor 1-like61434740114348136Rat
1583704Cdkl4cyclin-dependent kinase-like 461444982214492568Rat
1310949Sos1SOS Ras/Rac guanine nucleotide exchange factor 161453387014613348Rat
1560224Arhgef33Rho guanine nucleotide exchange factor 3361458292214715014Rat
1597031Eif4a2-ps2eukaryotic translation initiation factor 4A2, pseudogene 261471092714712015Rat
1563988Morn2MORN repeat containing 261471879914725281Rat
1310340Dhx57DExH-box helicase 5761472530514776321Rat
1311168Gemin6gem (nuclear organelle) associated protein 661478609014790617Rat
1311615Ttc39dtetratricopeptide repeat domain 39D61480275314811516Rat
1307425Srsf7serine and arginine rich splicing factor 761481177514818968Rat
1359459Galmgalactose mutarotase61483754014889484Rat
41194476LOC120093299U6 spliceosomal RNA61491725114917354Rat
1305861Hnrnpllheterogeneous nuclear ribonucleoprotein L-like61496995315000574Rat
41266585LOC120093309U6 spliceosomal RNA61499589114995987Rat
1305125Atl2atlastin GTPase 261513907115180421Rat
11514173LOC108351158uncharacterized LOC10835115861525788415259593Rat
7638001LOC102554703uncharacterized LOC10255470361526002815283578Rat
2460Cyp1b1cytochrome P450, family 1, subfamily b, polypeptide 161534231215350886Rat
1559836Rmdn2regulator of microtubule dynamics 261537256915443000Rat
1305858Cdc42ep3CDC42 effector protein 361571089415731366Rat
41359201LOC120093233uncharacterized LOC12009323361577979215782678Rat
9259827LOC103692532uncharacterized LOC10369253261579340315800448Rat
1585899Atp5mgl3ATP synthase membrane subunit G like 361594531515945626Rat
2324081Morf4l1-ps1mortality factor 4 like 1, pseudogene 161594752715948501Rat
1562284Qpctglutaminyl-peptide cyclotransferase61596465615996730Rat
6489794Rps17-ps9ribosomal protein S17, pseudogene 961602364216027014Rat
1310236Prkd3protein kinase D361603250716108444Rat
1311578Ndufaf7NADH:ubiquinone oxidoreductase complex assembly factor 761610863016119810Rat
1304994CebpzCCAAT/enhancer binding protein zeta61611987116137600Rat
9177508CebpzosCEBPZ opposite strand61613554616140143Rat
1585984Hnrnpf-ps4heterogeneous nuclear ribonucleoprotein F, pseudogene 461614421316146357Rat
1598187Sult6b1sulfotransferase family 6B member 161616238216187116Rat
3402Eif2ak2eukaryotic translation initiation factor 2-alpha kinase 261618900016224972Rat
41131139LOC120103477uncharacterized LOC12010347761621465816215105Rat
1311424Gpatch11G patch domain containing 1161622993316243305Rat
1359216Heatr5bHEAT repeat containing 5B61624342416323444Rat
3782Strnstriatin61633526516422159Rat
1564128Vitvitrin61644596616565644Rat
619709Fez2fasciculation and elongation protein zeta 261665457216694628Rat
40956779LOC120093475U2 spliceosomal RNA61667808216678256Rat
1308710Crim1cysteine rich transmembrane BMP regulator 161669586416870264Rat
41357253LOC120103478uncharacterized LOC12010347861681892116820617Rat
2323142Nsa2-ps2NSA2 ribosome biogenesis factor, pseudogene 261688941016892523Rat
1587169H3f3a-ps1H3.3 histone A, pseudogene 161697392316974753Rat
7711568LOC102553200uncharacterized LOC10255320061759201217596460Rat
1592088Hsp90ab1-ps3heat shock protein 90 alpha family class B member 1, pseudogene 361782661217828822Rat
41384706Ndufa12-ps1NADH:ubiquinone oxidoreductase subunit A12, pseudogene 161816135018161849Rat
11495481LOC108351326peptidyl-prolyl cis-trans isomerase D pseudogene61881549218816893Rat
41222005LOC120093295U6 spliceosomal RNA61904531919045424Rat
1583780Hspd1-ps11heat shock protein family D (Hsp60) member 1, pseudogene 1161927385119276050Rat
41200534LOC120093234uncharacterized LOC12009323461959860619614675Rat
1583779St13-ps3ST13, Hsp70 interacting protein, pseudogene 361973853019740177Rat
1583702Ldha-ps13lactate dehydrogenase A, pseudogene 1361977230219773267Rat
1305486Fam98afamily with sequence similarity 98, member A61987408219888744Rat
1304612Rasgrp3RAS guanyl releasing protein 361989536119993945Rat
7676249Rpl32-ps18ribosomal protein L32, pseudogene 1861994876019958584Rat
68379Ltbp1latent transforming growth factor beta binding protein 162002962920425339Rat
41098799LOC120103479uncharacterized LOC12010347962008854420109208Rat
11470604LOC10835135640S ribosomal protein S18 pseudogene62045050520450948Rat
41211263LOC120093429small nucleolar RNA SNORA4862053064520530788Rat
1305264Ttc27tetratricopeptide repeat domain 2762055875620702126Rat
11419109LOC108351178uncharacterized LOC10835117862061936220624156Rat
41392415LOC120093282U6 spliceosomal RNA62063098220631088Rat
1307247Birc6baculoviral IAP repeat-containing 662072292220916396Rat
1310157Yipf4Yip1 domain family, member 462095077420962195Rat
1309831Nlrc4NLR family, CARD domain containing 462099178521018254Rat
1309250Slc30a6solute carrier family 30 member 662102093121050785Rat
9086644LOC103692563uncharacterized LOC10369256362105087021070583Rat
1308494Spastspastin62105534921106586Rat
1591362Rpl18a-ps5ribosomal protein L18A, pseudogene 562110843121109299Rat
41372126LOC120103480uncharacterized LOC12010348062111770921120267Rat
708575Dpy30dpy-30 histone methyltransferase complex regulatory subunit62112094721141720Rat
1309929Memo1mediator of cell motility 162114452521234363Rat
41157183Hmgb2-ps4high mobility group box 2, pseudogene 462135447221356273Rat
1586183Pym1-ps1PYM homolog 1, exon junction complex associated factor, pseudogene 162139209421394047Rat
621480Srd5a2steroid 5 alpha-reductase 262142622521465727Rat
41120104LOC120093428small nucleolar RNA SNORA4862148057021480717Rat
2323407Sf3b4-ps1splicing factor 3B subunit 4, pseudogene 162151423021515489Rat
62043Xdhxanthine dehydrogenase62153046321592172Rat
621762Ehd3EH-domain containing 362164086121665601Rat
40933028LOC120103483uncharacterized LOC12010348362167718321701385Rat
1310068Galnt14polypeptide N-acetylgalactosaminyltransferase 1462175603921977533Rat
1562682Capn13calpain 1362207184522166864Rat
1589005Fam241b-ps1family with sequence similarity 241 member B, pseudogene 162218320122184227Rat
7531265LOC102547438uncharacterized LOC10254743862221412822219472Rat
1565906Lclat1lysocardiolipin acyltransferase 162222893322373246Rat
41195560LOC120093473small nucleolar RNA SNORA1762229186222291977Rat
1311183Vps13bvacuolar protein sorting 13 homolog B76655786267128429Rat
1309871Atl3atlastin GTPase 31204680958204727360Rat
1585448Cdca5l1cell division cycle associated 5 like 11204748183204749513Rat
1563402Cited1l1Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 like 11204760742204761351Rat
2829Plaat3phospholipase A and acyltransferase 31204782608204816397Rat
1306914Lgals12galectin 121204832065204842759Rat
1308376Plaat5phospholipase A and acyltransferase 51204847600204878456Rat
41277634Rpl7-ps13ribosomal protein L7, pseudogene 131204895815204898744Rat
41127557Rpl7a-ps4ribosomal protein L7a, pseudogene 41204898799204904044Rat
628885Slc22a24solute carrier family 22, member 241204910450204965538Rat
1583989Dnajb6-ps10DnaJ heat shock protein family (Hsp40) member B6, pseudogene 101204990626204992065Rat
1583981Slc22a27l-ps1solute carrier family 22, member 27 like, pseudogene 11205008429205015514Rat
620976UST4rintegral membrane transport protein UST4r1205072204205142718Rat
620985Ust5rintegral membrane transport protein UST5r1205210558205286868Rat
621104Slc22a25solute carrier family 22, member 251205338698205498486Rat
632286Slc22a8solute carrier family 22 member 81205496331205516378Rat
69338Slc22a6solute carrier family 22 member 61205522579205531179Rat
2342Chrm1cholinergic receptor, muscarinic 11205567226205583001Rat
3073Slc3a2solute carrier family 3 member 21205604468205618931Rat
6489539LOC100912041uncharacterized LOC1009120411205619202205622491Rat
40944949Snord26small nucleolar RNA, C/D box 261205619818205619892Rat
41049731Snord27small nucleolar RNA, C/D box 271205620094205620167Rat
41229892Snord28bsmall nucleolar RNA, C/D box 28B1205620424205620501Rat
41188559LOC120100227small nucleolar RNA SNORD291205621001205621064Rat
41373488Snord30small nucleolar RNA, C/D box 301205621234205621302Rat
41186103LOC120100232small nucleolar RNA SNORD311205621476205621542Rat
40941034LOC120100233small nucleolar RNA SNORD221205621734205621859Rat
1582860Senp5l1SUMO specific peptidase 5 like 11205625490205628352Rat
41322145LOC120100486U2 spliceosomal RNA1205629154205629354Rat
1582881Wdr74WD repeat domain 741205631769205636558Rat
41086944Tex54testis expressed 541205636636205637137Rat
68426Stx5syntaxin 51205637401205653563Rat
62014Nxf1nuclear RNA export factor 11205655442205668637Rat
1582829Tmem223transmembrane protein 2231205668716205670077Rat
1582850Tmem179btransmembrane protein 179B1205670126205672112Rat
1310123Taf6lTATA-box binding protein associated factor 6 like1205672147205684721Rat
621284Polr2gRNA polymerase II subunit G1205689160205692537Rat
1561140Zbtb3zinc finger and BTB domain containing 31205693906205703277Rat
1359253Ttc9ctetratricopeptide repeat domain 9C1205701768205712782Rat
1562784Hnrnpul2heterogeneous nuclear ribonucleoprotein U-like 21205713431205725553Rat
1308135Bscl2BSCL2 lipid droplet biogenesis associated, seipin1205731828205743430Rat
620805Gng3G protein subunit gamma 31205731837205733603Rat
1597359Lrrn4clLRRN4 C-terminal like1205743580205759879Rat
1309471Ubxn1UBX domain protein 11205765309205769234Rat
1597344Uqcc3ubiquinol-cytochrome c reductase complex assembly factor 31205773591205774369Rat
40973506LOC120100346small nucleolar RNA SNORA571205782250205782397Rat
1597339C1h11orf98similar to human chromosome 11 open reading frame 981205782612205784578Rat
7587874LOC102551607uncharacterized LOC1025516071205788523205789857Rat
1309370Ints5integrator complex subunit 51205788906205793685Rat
1309775Ganabglucosidase II alpha subunit1205793910205813704Rat
1311968B3gat3beta-1,3-glucuronyltransferase 31205817374205823928Rat
1306070Rom1retinal outer segment membrane protein 11205824050205826058Rat
7630023Eml3EMAP like 31205826354205837790Rat
1306743Mta2metastasis associated 1 family, member 21205838181205846903Rat
1561043Tut1terminal uridylyl transferase 1, U6 snRNA-specific1205848691205859767Rat
1302939Eef1geukaryotic translation elongation factor 1 gamma1205860713205871319Rat
619779AhnakAHNAK nucleoprotein1205882225205970934Rat
40982908Rpl7a-ps8ribosomal protein L7a, pseudogene 81205942455205943253Rat
41113145LOC120100111U4 spliceosomal RNA1205944227205944312Rat
3934Scgb1a1secretoglobin family 1A member 11205977060205980610Rat
708526Asrgl1asparaginase and isoaspartyl peptidase 11206006103206027115Rat
1566289Scgb1d2l1secretoglobin, family 1D, member 2 like 11206197290206201254Rat
1596054Ubtd2-ps1ubiquitin domain containing 2, pseudogene 11206219078206220329Rat
708459Scgb1d2secretoglobin, family 1D, member 21206228546206233587Rat
1596035Rps24-ps19ribosomal protein S24, pseudogene 191206293099206293621Rat
1302961Scgb1d4secretoglobin family 1D member 41206330454206333329Rat
41138586Gabarap-ps1GABA type A receptor-associated protein, pseudogene 11206379981206381094Rat
2324357Scgb1d2-ps1secretoglobin, family 1D, member 2, pseudogene 11206434271206438940Rat
735031Scgb2a1secretoglobin, family 2A, member 11206497848206501211Rat
1305292Incenpinner centromere protein1206520655206550575Rat
7587044LOC102552566uncharacterized LOC1025525661206555812206626882Rat
41140944Dnph1-ps12'-deoxynucleoside 5'-phosphate N-hydrolase 1, pseudogene 11206604937206609330Rat
2635Fth1ferritin heavy chain 11206627142206629430Rat
1311656Best1bestrophin 11206629340206646085Rat
7613394C2h4orf33-ps1similar to human chromosome 4 open reading frame 33, pseudogene 11206634127206635796Rat
619764Rab3il1RAB3A interacting protein-like 11206646168206682718Rat
628876Fads3fatty acid desaturase 31206685667206702538Rat
68339Fads2fatty acid desaturase 21206707384206747333Rat
621678Fads1fatty acid desaturase 11206827724206842734Rat
621821Fen1flap structure-specific endonuclease 11206845126206849821Rat
1560328Tmem258transmembrane protein 2581206849723206853623Rat
1306622Myrfmyelin regulatory factor1206854175206886276Rat
1359461Dagladiacylglycerol lipase, alpha1206890635206947332Rat
6495087Rpl10-ps9ribosomal protein L10, pseudogene 91206953517206954416Rat
11381356H3f3bl2H3.3 histone B like 21206954890206955445Rat
62013Syt7synaptotagmin 71207031359207093787Rat
1564983Lrrc10bleucine rich repeat containing 10B1207096471207097699Rat
708532Saxo4stabilizer of axonemal microtubules 41207113807207122378Rat
1309216Sdhaf2succinate dehydrogenase complex assembly factor 21207139070207167830Rat
1305441Cpsf7cleavage and polyadenylation specific factor 71207167690207191938Rat
1304607Tmem216transmembrane protein 2161207196454207201704Rat
41357259LOC1201004375S ribosomal RNA1207205662207205779Rat
41160949Rpl31-ps6ribosomal protein L31, pseudogene 61207212597207215638Rat
1304670Cyb561a3cytochrome b561 family, member A31207216185207237575Rat
735168Tmem138transmembrane protein 1381207219113207226159Rat
1311026Tkfctriokinase and FMN cyclase1207238230207253035Rat
621889Ddb1damage-specific DNA binding protein 11207252890207278685Rat
1309910Vwcevon Willebrand factor C and EGF domains1207280714207327215Rat
621573Pga5pepsinogen A51207317021207327156Rat
11384366Vps37cVPS37C subunit of ESCRT-I1207336694207362295Rat
2309Cd5Cd5 molecule1207365337207386313Rat
40952477LOC120099989uncharacterized LOC1200999891207388333207439161Rat
41303953Trnaa-agc22transfer RNA alanine (anticodon AGC) 221207408038207408112Rat
2312Cd6Cd6 molecule1207442873207481703Rat
628663Slc15a3solute carrier family 15 member 31207492365207507158Rat
727936Tmem132atransmembrane protein 132A1207507074207518756Rat
1359538Tmem109transmembrane protein 1091207519628207530245Rat
708496Prpf19pre-mRNA processing factor 191207541582207552664Rat
620604Zp1zona pellucida glycoprotein 11207560881207567261Rat
1311986Ptgdr2prostaglandin D2 receptor 21207585088207590275Rat
1359280Ccdc86coiled-coil domain containing 861207590167207596547Rat
1307478Ms4a10membrane spanning 4-domains A101207611312207624452Rat
1561158Ms4a15membrane spanning 4-domains A151207628305207641799Rat
2323808Ms4a18membrane spanning 4-domains A181207644858207662471Rat
6495605LOC100910973uncharacterized LOC1009109731207705447207708355Rat
1583864Snx5-ps1sorting nexin 5, pseudogene 11207711511207713865Rat
1309035Ms4a8membrane spanning 4-domains A81207730665207744260Rat
7639871Ms4a20membrane-spanning 4-domains, subfamily A, member 201207751598207798970Rat
6487805Ms4a19membrane-spanning 4-domains, subfamily A, member 191207807376207839548Rat
1564175Ms4a13-ps1membrane spanning 4-domains A13, pseudogene 11207843457207872137Rat
1307162Ms4a12membrane spanning 4-domains A121207881065207894633Rat
41344763LOC120093141uncharacterized LOC1200931411207882677207934603Rat
9088826LOC10369129260S ribosomal protein L6 pseudogene1207890844207893485Rat
1311999Ms4a1membrane spanning 4-domains A11207906370207927028Rat
1594968Ms4a5membrane spanning 4-domains A51207927057207934886Rat
727900Ms4a14membrane spanning 4-domains A141207949423207964937Rat
1305549Ms4a7membrane spanning 4-domains A71207969117207984743Rat
1307006Ms4a4amembrane spanning 4-domains A4A1208060507208085121Rat
41006787LOC120099990uncharacterized LOC1200999901208070936208079981Rat
2323335Hmgn1-ps2high mobility group nucleosome binding domain 1, pseudogene 21208088793208089355Rat
1583863Ms4a4cmembrane-spanning 4-domains, subfamily A, member 4C1208125063208146338Rat
1589849Ms4a6cmembrane-spanning 4-domains, subfamily A, member 6C1208153504208174721Rat
1590964Eif5-ps11eukaryotic translation initiation factor 5, pseudogene 111208169194208170649Rat
1590971Ms4a4cl1membrane-spanning 4-domains, subfamily A, member 4C like 11208217979208236368Rat
1359381Ms4a6bl1membrane-spanning 4-domains, subfamily A, member 6B-like 11208243561208255400Rat
1311761Ms4a6bmembrane-spanning 4-domains, subfamily A, member 6B1208281016208301771Rat
7598744LOC102551452uncharacterized LOC1025514521208318075208328601Rat
1590996Ms4a4c-ps1membrane-spanning 4-domains, subfamily A, member 4C, pseudogene 11208368380208387638Rat
2323952Ms4a6bl2membrane-spanning 4-domains, subfamily A, member 6B-like 21208398337208405671Rat
1305800Ms4a6amembrane spanning 4-domains A6A1208401465208414831Rat
41134996LOC120100458small nucleolar RNA SNORA171208417326208417423Rat
2598Ms4a2membrane spanning 4-domains A21208440179208448716Rat
1310598Ms4a3membrane spanning 4-domains A31208462300208480129Rat
1590948Oosp2oocyte secreted protein 21208480265208496843Rat
1590944Oosp1oocyte secreted protein 11208515497208547077Rat
40933068Oosp4aoocyte secreted protein family member 4A1208547232208561558Rat
62084Cblifcobalamin binding intrinsic factor1208605983208620231Rat
621005Stx3syntaxin 31208617018208686240Rat
735195Mrpl16mitochondrial ribosomal protein L161208633671208638483Rat
41136175LOC120100478U6atac minor spliceosomal RNA1208668771208668889Rat
1593675Or10v9olfactory receptor family 10 subfamily V member 91208715148208716094Rat
41210029Morf4l1-ps3mortality factor 4 like 1, pseudogene 31208717007208721488Rat
41307266LOC120100495U4 spliceosomal RNA1208755278208755468Rat
1334072Or10v9bolfactory receptor family 10 subfamily V member 9B1208755439208756395Rat
1333276Or10v1olfactory receptor family 10 subfamily V member 11208807725208808654Rat
1305514Patl1PAT1 homolog 1, processing body mRNA decay factor1208831115208862904Rat
41152658LOC120100442small nucleolar RNA SNORA171208851150208851280Rat
41364316LOC120100383small nucleolar RNA SNORA321208855804208855925Rat
41252360Scarna23l1small Cajal body-specific RNA 23 like 11208871701208871824Rat
9107141Rpl27al8ribosomal protein L27A like 81208875347208888586Rat
1308069Osbpoxysterol binding protein1208888697208918511Rat
11491306Trnaf-gaa1transfer RNA phenylalanine (anticodon GAA) 11208927953208928025Rat
11428976Trnak-uuu1transfer RNA lysine (anticodon UUU) 11208932808208932880Rat
11517460Trnaf-gaa2transfer RNA phenylalanine (anticodon GAA) 21208934775208934847Rat
11504103Trnak-uuu2transfer RNA lysine (anticodon UUU) 21208936079208936151Rat
11478896Trnal-uaa2transfer RNA leucine (anticodon UAA) 21208937593208937675Rat
11403555Trnar-ucu1transfer RNA arginine (anticodon UCU) 11208938095208938180Rat
11427576Trnav-uac1transfer RNA valine (anticodon UAC) 11208938423208938495Rat
11499330Trnav-uac2transfer RNA valine (anticodon UAC) 21208938763208938835Rat
2324714Polr2k-ps2RNA polymerase II, I and III subunit K, pseudogene 21208943604208944098Rat
1333895Or4z7-ps1olfactory receptor family 4 subfamily Z member 7, pseudogene 11208949896208950722Rat
1334346Or4d11olfactory receptor family 4 subfamily D member 111208967493208968425Rat
1332621Or4d10olfactory receptor family 4 subfamily D member 101208997300208998235Rat
1333126Or4d10colfactory receptor family 4 subfamily D member 10C1209016663209017598Rat
1333150Or4z4olfactory receptor family 4 subfamily Z member 41209030298209031233Rat
1333601Or4d6olfactory receptor family 4 subfamily D member 61209039073209040017Rat
1333796Or5a1olfactory receptor family 5 subfamily A member 11209050800209051753Rat
1333219Or5bb12olfactory receptor family 5 subfamily BB member 121209120577209121542Rat
1333108Olr328-psolfactory receptor pseudogene 3281209154636209155557Rat
1333987Or5an9olfactory receptor family 5 subfamily AN member 91209194949209195890Rat
1334070Or5an1olfactory receptor family 5 subfamily AN member 11209241571209242510Rat
1333238Or5an10olfactory receptor family 5 subfamily AN member 101209283277209284224Rat
1333407Olr387olfactory receptor 3871209298498209299436Rat
1333575Or5a21olfactory receptor family 5 subfamily A member 211209317575209318534Rat
1332879Or5q2-ps1olfactory receptor family 5 subfamily Q member 2, pseudogene 11209324679209325193Rat
40935990Rpl7a-ps9ribosomal protein L7a, pseudogene 91209328689209332025Rat
1334079Or5an1bolfactory receptor family 5 subfamily AN member 1B1209333761209334702Rat
1333889Or5an12-ps1olfactory receptor family 5 subfamily AN member 12, pseudogene 11209348536209349416Rat
1333328Or5an6olfactory receptor family 5 subfamily AN member 61209365511209366473Rat
1333015Or5a3olfactory receptor family 5 subfamily A member 31209406804209407760Rat
1564458Pfplpore forming protein-like1209412059209415339Rat
69275Mpeg1macrophage expressed 11209452176209456692Rat
1311767Dtx4deltex E3 ubiquitin ligase 41209457719209545163Rat
6499051Fam111a-ps1FAM111 trypsin like peptidase A, pseudogene 11209519449209552314Rat
1588627Fam111al1FAM111 trypsin like peptidase A like 11209593530209598151Rat
1560913Fam111aFAM111 trypsin like peptidase A1209640865209656551Rat
1564894Glyatl1glycine-N-acyltransferase-like 11209667315209692697Rat
1307163Glyatglycine-N-acyltransferase1209704213209724949Rat
1591254Or5b95l1olfactory receptor family 5 subfamily B member 95 like 11209744240209745232Rat
1334154Or5b95olfactory receptor family 5 subfamily B member 951209751453209752391Rat
621231Glyatl2glycine-N-acyltransferase-like 21209807488209840480Rat
2370Cntfciliary neurotrophic factor1209887854209889877Rat
628736Zfp91zinc finger protein 911209891344209928890Rat
1304981Lpxnleupaxin1209928297209963085Rat
41389006LOC120100482small nucleolar RNA U131210006728210006831Rat
1334091Or5b21olfactory receptor family 5 subfamily B member 211210009165210010127Rat
1333323Or5b96olfactory receptor family 5 subfamily B member 961210042474210052254Rat
1334063Or5b12bolfactory receptor family 5 subfamily B member 12B1210042752210043696Rat
1332989Or5b97-ps1olfactory receptor family 5 subfamily B member 97, pseudogene 11210070271210071391Rat
1334374Or5b12olfactory receptor family 5 subfamily B member 121210090773210091717Rat
1333125Or5b24olfactory receptor family 5 subfamily B member 241210111646210112581Rat
9464512Or5b2l-ps1olfactory receptor family 5 subfamily B member 2 like, pseudogene 11210122122210123095Rat
1333625Or5b99olfactory receptor family 5 subfamily B member 991210136841210137767Rat
1333760Or5b100olfactory receptor family 5 subfamily B member 1001210164505210165428Rat
1333475Or5b102olfactory receptor family 5 subfamily B member 1021210176716210177639Rat
1334406Or5b104olfactory receptor family 5 subfamily B member 1041210213962210214885Rat
1562884Cct7-ps1chaperonin containing Tcp1, subunit 7 (eta), pseudogene 11210224863210226732Rat
1332605Or5b126-ps1olfactory receptor family 5 subfamily B member 126, pseudogene 11210248193210249124Rat
1334131Or5b107b-ps1olfactory receptor family 5 subfamily B member 107B, pseudogene 11210278218210279182Rat
1332654Or5b105olfactory receptor family 5 subfamily B member 1051210298067210298990Rat
1333991Or5aa4-ps1olfactory receptor family 5 subfamily AA member 4, pseudogene 11210309417210309701Rat
1333250Or5b116bolfactory receptor family 5 subfamily B member 116B1210317860210318813Rat
1333071Or5b128-ps1olfactory receptor family 5 subfamily B member 128, pseudogene 11210322676210323557Rat
1332853Olr356-psolfactory receptor pseudogene 3561210329478210329672Rat
1333477Or5b123bolfactory receptor family 5 subfamily B member 123B1210343656210344603Rat
1333912Or5b104bolfactory receptor family 5 subfamily B member 104B1210366111210367043Rat
1333674Or5b127-ps1olfactory receptor family 5 subfamily B member 127, pseudogene 11210380597210381554Rat
1333366Or5b106olfactory receptor family 5 subfamily B member 1061210399256210402896Rat
1559854Rps8-ps11ribosomal protein S8, pseudogene 111210404228210404878Rat
1586288Tob2-ps1transducer of ERBB2, 2, pseudogene 11210421136210422282Rat
1333423Or5b107olfactory receptor family 5 subfamily B member 1071210445192210446124Rat
41017257Or5b3l-ps1olfactory receptor family 5 subfamily B member 3 like, pseudogene 11210454159210455356Rat
1332962Or5ay1-ps1olfactory receptor family 5 subfamily AY member 1, pseudogene 11210477436210478309Rat
9121299Or5b109olfactory receptor family 5 subfamily B member 1091210492296210493228Rat
1590081Or5b113olfactory receptor family 5 subfamily B member 1131210502224210503150Rat
1590077Or5b114olfactory receptor family 5 subfamily B member 1141210518245210519177Rat
1334416Or5b3olfactory receptor family 5 subfamily B member 31210550409210551347Rat
1590072Or5b17olfactory receptor family 5 subfamily B member 171210578656210579600Rat
1332812Or5b116olfactory receptor family 5 subfamily B member 1161210587347210588291Rat
41006009LOC120100118U4 spliceosomal RNA1210601525210601653Rat
1333508Or5b124b-ps1olfactory receptor family 5 subfamily B member 124B, pseudogene 11210633398210634338Rat
1333483Or5b123olfactory receptor family 5 subfamily B member 1231210658504210659439Rat
1333876Or5ax1-ps1olfactory receptor family 5 subfamily AX member 1, pseudogene 11210672669210673166Rat
1334125Or5b124c-ps1olfactory receptor family 5 subfamily B member 124C, pseudogene 11210696749210697691Rat
1333313Or5b130-ps1olfactory receptor family 5 subfamily B member 130, pseudogene 11210714536210715388Rat
1333922Or5b124olfactory receptor family 5 subfamily B member 1241210731957210732898Rat
1333289Or10w1olfactory receptor family 10 subfamily W member 11210806724210807674Rat
1334396Or10w3olfactory receptor family 10 subfamily W member 31210838552210839502Rat
1333050Or10q1olfactory receptor family 10 subfamily Q member 11210861364210862320Rat
1586243Fabp5-ps2fatty acid binding protein 5, pseudogene 21210862509210862900Rat
1333045Or10q12olfactory receptor family 10 subfamily Q member 121210889382210890341Rat
1333888Or1s2olfactory receptor family 1 subfamily S member 21210913992210914939Rat
2323522Cops8-ps5COP9 signalosome subunit 8, pseudogene 41210931289210931815Rat
1333595Or9q2olfactory receptor family 9 subfamily Q member 21210933992210934936Rat
1333303Or9i13olfactory receptor family 9 subfamily I member 131210949465210950427Rat
1334108Or9q1olfactory receptor family 9 subfamily Q member 11210959770210960705Rat
1333030Or9i16olfactory receptor family 9 subfamily I member 161210971204210972151Rat
1333317Or9i1-ps1olfactory receptor family 9 subfamily I member 1, pseudogene 11210988702210989649Rat
1333288Or9i14olfactory receptor family 9 subfamily I member 141211014005211014949Rat
1333181Or9i2olfactory receptor family 9 subfamily I member 21211050659211051606Rat
1333930Or9i1bolfactory receptor family 9 subfamily I member 1B1211096191211097141Rat
1626012Vom2r-ps69vomeronasal 2 receptor, pseudogene 691211119953211120294Rat
11423435LOC10834887060S ribosomal protein L21-like1211344371211344922Rat
1561986Pphln1-ps1periphilin 1, pseudogene 11211632345211633906Rat
3868Tle4TLE family member 4, transcriptional corepressor1211661738211798458Rat
41263002Rnu12-2lRNA, U12 small nuclear 2 like1212291792212291941Rat
40962449LOC120100345U2 spliceosomal RNA1212838445212838579Rat
735170Psat1phosphoserine aminotransferase 11213196709213218564Rat
620464Cep78centrosomal protein 781213246183213275275Rat
7736515LOC102553402uncharacterized LOC1025534021213301564213315826Rat
620770GnaqG protein subunit alpha q1213425631213671947Rat
1597112Pwp1-ps2PWP1 homolog, endonuclein, pseudogene 21213696135213698139Rat
1308122Gna14G protein subunit alpha 141213714993213900083Rat
41094357Eif2s2-ps1eukaryotic translation initiation factor 2 subunit beta, pseudogene 11213757453213758607Rat
1311340Vps13avacuolar protein sorting 13 homolog A1213901999214128638Rat
1585019Foxb2forkhead box B21214232731214234226Rat
1311350Prune2prune homolog 2 with BCH domain1214352586214624848Rat
621370Gcnt1glucosaminyl (N-acetyl) transferase 11214718344214755735Rat
41396975LOC120099997acyl-protein thioesterase 1-like1214772482214777313Rat
1549748Rfkriboflavin kinase1214799880214807440Rat
620326Pcsk5proprotein convertase subtilisin/kexin type 51214837847215267626Rat
41207476LOC120100483small nucleolar RNA U131215255621215255715Rat
41092905Rnu6-1267RNA, U6 small nuclear 12671215294117215294226Rat
41085563LOC120100429small nucleolar RNA SNORA171215798358215798482Rat
1597038Rnps1-ps3RNA binding protein with serine rich domain 1, pseudogene 31215867429215868901Rat
628849Ostf1osteoclast stimulating factor 11216002037216049226Rat
1564687Nmrk1nicotinamide riboside kinase 11216049350216076792Rat
40930941Rps15-ps7ribosomal protein S15, pseudogene 71216059427216061856Rat
1311863Carnmt1carnosine N-methyltransferase 11216093720216123360Rat
1563237C1h9orf40similar to human chromosome 9 open reading frame 401216128687216132896Rat
1309942Trpm6transient receptor potential cation channel, subfamily M, member 61216136407216320523Rat
7668904LOC102554711uncharacterized LOC1025547111216159777216162543Rat
1306778RorbRAR-related orphan receptor B1216363629216544390Rat
7658951LOC102554959uncharacterized LOC1025549591216520876216525016Rat
11474079Gapdhl2glyceraldehyde-3-phosphate dehydrogenase like 21216612021216613034Rat
41303320LOC120098081uncharacterized LOC1200980811216690552216691985Rat
41166240LOC120100427small nucleolar RNA SNORA171216711164216711298Rat
1586523Ahcy-ps4adenosylhomocysteinase, pseudogene 41217020367217021658Rat
6494111Aldoa-ps2aldolase, fructose-bisphosphate A, pseudogene 21217423560217425007Rat
2323439Npm1l1nucleophosmin 1 like 11217543373217544186Rat
1563931Btf3l7basic transcription factor 3 like 71217554312217557717Rat
2118Anxa1annexin A11217861175217877205Rat
2087Aldh1a1aldehyde dehydrogenase 1 family, member A11218000470218152962Rat
402093005Aldh1a7aldehyde dehydrogenase family 1, subfamily A71218201443218241410Rat
1308682Tmc1transmembrane channel-like 11218275249218446013Rat
7657219LOC102551351uncharacterized LOC1025513511218637961218681826Rat
11492063LOC108348874glyceraldehyde-3-phosphate dehydrogenase pseudogene1218714987218715999Rat
1310776Zfand5zinc finger AN1-type containing 51218765735218780391Rat
7618157LOC102551544uncharacterized LOC1025515441218792565218797618Rat
9142228LOC103691306uncharacterized LOC1036913061218797024218823843Rat
41061241LOC120100000uncharacterized LOC1201000001218891154218910823Rat
621617Gdaguanine deaminase1218903045218982360Rat
41111402LOC120100370small nucleolar RNA SNORA441218910326218910454Rat
6490675C1h9orf57similar to human chromosome 9 open reading frame 571219079683219084806Rat
41157562LOC120100414small nucleolar RNA SNORA171219114576219114705Rat
1359158C1h9orf85similar to human chromosome 9 open reading frame 851219136085219197723Rat
1305246Abhd17babhydrolase domain containing 17B, depalmitoylase1219198294219232733Rat
11381164LOC108348948uncharacterized LOC1083489481219237610219250592Rat
1307941Cemip2cell migration inducing hyaluronidase 21219330295219407760Rat
41370285Eif4a1-ps7eukaryotic translation initiation factor 4A1, pseudogene 71219386631219389372Rat
1304888Trpm3transient receptor potential cation channel, subfamily M, member 31219673200220557610Rat
41047541LOC120100459small nucleolar RNA SNORA171219771021219771145Rat
41332067LOC120100428small nucleolar RNA SNORA171219869292219869423Rat
6489406Timm23-ps3translocase of inner mitochondrial membrane 23, pseudogene 31219969156219980173Rat
11518304LOC108349823uncharacterized LOC1083498231220224951220261496Rat
7503291LOC102552001uncharacterized LOC1025520011220284052220295326Rat
2325551Mir204microRNA 2041220316931220317040Rat
41225190LOC12010000340S ribosomal protein S12-like1220574554220577707Rat
11445681LOC108349100uncharacterized LOC1083491001220591633220623488Rat
70934Klf9KLF transcription factor 91220700108220725110Rat
1307492Smc5structural maintenance of chromosomes 51220769366220839138Rat
41391465Rnu6-806RNA, U6 small nuclear 8061220856369220856475Rat
1305129Mamdc2MAM domain containing 21220863959221016493Rat
41287817LOC120100498U4 spliceosomal RNA1221085628221085775Rat
1560242Cfap95cilia and flagella associated protein 951221123786221242963Rat
41102373LOC120100401small nucleolar RNA SNORA481221141990221142132Rat
41219068LOC120100460small nucleolar RNA SNORA171221233213221233314Rat
40945859LOC120098082uncharacterized LOC1200980821221255188221260427Rat
708369Ptar1protein prenyltransferase alpha subunit repeat containing 11221283306221326861Rat
40955348Rnu6-65RNA, U6 small nuclear 651221343294221343397Rat
620844Apba1amyloid beta precursor protein binding family A member 11221363769221569496Rat
1307524Entrep1endosomal transmembrane epsin interactor 11221592500221646603Rat
41211547LOC120100127U6 spliceosomal RNA1221643603221643709Rat
41205153LOC120100004uncharacterized LOC1201000041221677917221703867Rat
619807Tjp2tight junction protein 21221709745221838291Rat
1565754Fxnfrataxin1221874007221897543Rat
1310914Pip5k1bphosphatidylinositol-4-phosphate 5-kinase type 1 beta1221907220222183672Rat
41200944LOC120100005uncharacterized LOC1201000051221956410221958663Rat
1310316Pabir1PP2A Aalpha (PPP2R1A) and B55A (PPP2R2A) interacting phosphatase regulator 11222114988222116294Rat
41304355Dynlt1-ps1dynein light chain Tctex-type 1, pseudogene11222125549222133864Rat
1359349Tmem252transmembrane protein 2521222316982222321946Rat
1307969Pgm5phosphoglucomutase 51222325638222513434Rat
621716Foxd4forkhead box D41222557494222559189Rat
708495Zng1aZn regulated GTPase metalloprotein activator 1A1222568278222612937Rat
7729455LOC102556915uncharacterized LOC1025569151222610724222638904Rat
1561588Dock8dedicator of cytokinesis 81222649309222842474Rat
41171153LOC120100363small nucleolar RNA SNORA241222808283222808414Rat
1307714Kank1KN motif and ankyrin repeat domains 11222877962223074514Rat
7600426LOC102554752uncharacterized LOC1025547521222973015222980840Rat
2323621Ran-ps1RAN, member RAS oncogene family, pseudogene 11223132286223132860Rat
621640Dmrt1doublesex and mab-3 related transcription factor 11223142859223241333Rat
1306043Dmrt3doublesex and mab-3 related transcription factor 31223244340223264254Rat
1309047Dmrt2doublesex and mab-3 related transcription factor 21223317543223324131Rat
41395459Trnap-agg60transfer RNA proline (anticodon AGG) 601223386056223386136Rat
11400155LOC108349212uncharacterized LOC1083492121223558078223568748Rat
41278963LOC120100006uncharacterized LOC1201000061223632579223634200Rat
9327776LOC103691315uncharacterized LOC1036913151223712697223723908Rat
7594231LOC102555110uncharacterized LOC1025551101223909032223923555Rat
9160927LOC103695057uncharacterized LOC1036950571223944725223966152Rat
1562774Psmb6-ps1proteasome 20S subunit beta 6, pseudogene 11224033071224034353Rat
9453920LOC103691317uncharacterized LOC1036913171224095049224105835Rat
1302988Smarca2SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 21224191125224358640Rat
11409422LOC108348917uncharacterized LOC1083489171224434444224436629Rat
41216261LOC120098083uncharacterized LOC1200980831224544345224550155Rat
41400972LOC120100007uncharacterized LOC1201000071224550777224558046Rat
6495932Rps17-ps1ribosomal protein S17, pseudogene 11224590238224590650Rat
7599954LOC102557104uncharacterized LOC1025571041224657115224660713Rat
41004520LOC120100010uncharacterized LOC1201000101224677005224690946Rat
3963Vldlrvery low density lipoprotein receptor1224813539224850400Rat
1309271Kcnv2potassium voltage-gated channel modifier subfamily V member 21224999552225014062Rat
1564753Pum3pumilio RNA-binding family member 31225074332225113995Rat
7700759LOC102555808uncharacterized LOC1025558081225114347225140414Rat
7566943LOC102555989uncharacterized LOC1025559891225289547225334401Rat
2325049Eif4e-ps2eukaryotic translation initiation factor 4E, pseudogene 21225371014225371531Rat
1307779Rfx3regulatory factor X31225449872225709622Rat
41377637LOC120100479U6atac minor spliceosomal RNA1225488774225488891Rat
41097335LOC120100391small nucleolar RNA SNORA511225495834225495966Rat
7517961Thoc3-ps1THO complex 3, pseudogene 11225665659225666454Rat
1589453Ppid-ps2peptidylprolyl isomerase D, pseudogene 21225740072225741290Rat
41401218Rnu6-613RNA, U6 small nuclear 6131225971183225971289Rat
1565505Glis3GLIS family zinc finger 31225976029226395849Rat
41142846LOC120098084uncharacterized LOC1200980841226451090226457544Rat
7715694LOC102546345uncharacterized LOC1025463451226521231226549807Rat
41277114Rnu6-525RNA, U6 small nuclear 5251226541765226541871Rat
3696Slc1a1solute carrier family 1 member 11226549932226631925Rat
1310039Spata6lspermatogenesis associated 6-like1226630470226682979Rat
1566000Plpp6phospholipid phosphatase 61226679100226681952Rat
1588239Phyh-ps1phytanoyl-CoA 2-hydroxylase, pseudogene 11226688444226689337Rat
1565057Tekt5l1tektin 5 like 11226689519226705125Rat
1309295Cdc37l1cell division cycle 37-like 11226705019226733994Rat
619885Ak3adenylate kinase 31226737472226764647Rat
41171347LOC120100015uncharacterized LOC1201000151226782511226787383Rat
1305320Rcl1RNA terminal phosphate cyclase-like 11226824561226869046Rat
2325609Mir101-2microRNA 101-21226860371226860467Rat
2939Jak2Janus kinase 21226995334227054381Rat
62061Insl6insulin-like 61227069958227073493Rat
7710008Phb1-ps9prohibitin 1, pseudogene 91227073574227075424Rat
3579Rln1relaxin 11227079960227082960Rat
1306839Plgrktplasminogen receptor with a C-terminal lysine1227099005227111277Rat
1566211Cd274CD274 molecule1227116674227137379Rat
1585881Nip7-ps2nucleolar pre-rRNA processing protein NIP7, pseudogene 21227152984227153506Rat
1306403Pdcd1lg2programmed cell death 1 ligand 21227158941227223938Rat
1310016Ric1RIC1 homolog, RAB6A GEF complex partner 11227285510227384553Rat
727831Ermp1endoplasmic reticulum metallopeptidase 11227383992227422120Rat
41025615LOC120100017uncharacterized LOC1201000171227432377227441119Rat
41273033LOC120100018uncharacterized LOC1201000181227451357227453734Rat
1306525Mlanamelan-A1227469537227483343Rat
1311595Brd10bromodomain containing 101227490983227572246Rat
11481274LOC10834943360S ribosomal protein L7a pseudogene1227542130227543021Rat
1305165Ranbp6RAN binding protein 61227572394227576915Rat
1597109Trmt6-ps1tRNA methyltransferase 6, pseudogene 11227636838227639063Rat
1311155Il33interleukin 331227701964227736374Rat
1564740Nr6a1nuclear receptor subfamily 6, group A, member 132249510922683132Rat
2325335Mir181a2microRNA 181a-232261584522615961Rat
2325454Mir181b2microRNA 181b-232261694822617035Rat
41296457LOC120101539uncharacterized LOC12010153932261895022632367Rat
1311651Olfml2aolfactomedin-like 2A32268859022717917Rat
7749459Golga2l2golgin A2 like 232271624422731175Rat
41157828LOC120102092small nucleolar RNA SNORA7932273807222738216Rat
1562587Wdr38WD repeat domain 3832275015022753260Rat
1303007Rpl35ribosomal protein L3532275325522756217Rat
1308867Arpc5lactin related protein 2/3 complex, subunit 5-like32275871022767520Rat
1311305Golga1golgin A132276569022812637Rat
7707315Scail1suppressor of cancer cell invasion like 132281271922819111Rat
1594720Scaisuppressor of cancer cell invasion32281328322925337Rat
708460Ppp6cprotein phosphatase 6, catalytic subunit32292981622962123Rat
1589697Rpl10-ps2ribosomal protein L10, pseudogene 232303352923034161Rat
41241606LOC120102026small nucleolar RNA SNORA4832304743523047574Rat
7741314N4bp1-ps1Nedd4 binding protein 1, pseudogene 132315047223151651Rat
1589739Vdac2-ps3voltage-dependent anion channel 2, pseudogene 332321552623222603Rat
2323145Sp3-ps1Sp3 transcription factor, pseudogene 132360318123604872Rat
41256826LOC120101994U7 small nuclear RNA32362397123624033Rat
40992520LOC120101997U7 small nuclear RNA32362404923624108Rat
9093487LOC10369180540S ribosomal protein S14 pseudogene32371140923711911Rat
41337682LOC120102038small nucleolar RNA SNORA4832392516823925311Rat
2318320LOC10036236640S ribosomal protein S17-like32401982024020305Rat
11496785LOC10835055160S ribosomal protein L12 pseudogene32424981424250522Rat
41069797LOC120102003small nucleolar RNA SNORA7032455500324555138Rat
1561736Rpl10l3ribosomal protein L10A like 332455508024555585Rat
1306160Lrp1bLDL receptor related protein 1B32459430226715037Rat
41034676Actg1-ps7actin, gamma 1, pseudogene 732528326925290132Rat
41092566LOC120101541uncharacterized LOC12010154132689036826909301Rat
41393928LOC120102048small nucleolar RNA SNORA1732689649926896629Rat
41260220LOC120101542MLV-related proviral Env polyprotein-like32733382827335839Rat
71061Kynukynureninase32777864627929470Rat
1359304Arhgap15Rho GTPase activating protein 1532798936828592722Rat
41176684LOC120102081small nucleolar RNA SNORA4032830634528306467Rat
41066404LOC120102110U2 spliceosomal RNA32855995628560093Rat
1563393Gtdc1glycosyltransferase-like domain containing 132876664029161668Rat
41007407Rnu2-18RNA, U2 small nuclear 1832881327728813416Rat
11498418LOC108350367uncharacterized LOC10835036732887037328882513Rat
1307272Zeb2zinc finger E-box binding homeobox 232921458129344890Rat
9273023Zeb2-as1ZEB2 antisense RNA 132934307829345943Rat
7498952LOC102548671uncharacterized LOC10254867132943454929491656Rat
9075793LOC103690391uncharacterized LOC10369039132957970029583753Rat
11373432LOC108350369uncharacterized LOC10835036932962628029676672Rat
41353600LOC120101545uncharacterized LOC12010154532974202229786773Rat
7622113LOC102548934uncharacterized LOC10254893432999381829998722Rat
41041303LOC120102076small nucleolar RNA SNORA1733052038230520498Rat
2322483Traf7-ps2TNF receptor associated factor 7, pseudogene 233076880130770318Rat
41087157LOC120102072small nucleolar RNA SNORA1733081550330815603Rat
2323086Ddx18-ps2DEAD-box helicase 18, pseudogene 233120713731210520Rat
11429489LOC108350370uncharacterized LOC10835037033121664431228107Rat
9265290Elobl8elongin B like 833125526531255970Rat
41126518LOC120101546uncharacterized LOC12010154633134491731365067Rat
41040480LOC120102009small nucleolar RNA SNORA433136654831366647Rat
11383937LOC108350593uncharacterized LOC10835059333136701831374155Rat
41304536LOC120101992U7 small nuclear RNA33142960831429669Rat
41080470LOC120102080small nucleolar RNA SNORA4033152792831528053Rat
1590993Rpl37l4ribosomal protein L37 like 433209113732091463Rat
1334145Or6c247-ps1olfactory receptor family 6 subfamily C member 247, pseudogene 133210782932108276Rat
1589738Max-ps1MYC associated factor X, pseudogene 133252095032521403Rat
7597606R3hdm2-ps1R3H domain containing 2, pseudogene 133264742532683617Rat
11507559LOC108350372uncharacterized LOC10835037233297332732986885Rat
70911Acvr2aactivin A receptor type 2A33320496133292673Rat
735212Orc4origin recognition complex, subunit 433329084433334022Rat
1562961Mbd5methyl-CpG binding domain protein 533358885433738730Rat
41358771LOC120101434uncharacterized LOC12010143433378665333790312Rat
1307271Epc2enhancer of polycomb homolog 233386721933967908Rat
1308539Kif5ckinesin family member 5C33403208234185597Rat
7502848LOC102556679uncharacterized LOC10255667933413506434137136Rat
1562767Lypd6bLy6/Plaur domain containing 6B33419910134360770Rat
1303202Ns5atp4-ps3NS5A transactivated protein 4, pseudogene 333446571534466470Rat
1587119Lypd6Ly6/Plaur domain containing 633448742534632887Rat
11444381Trnav-aac2transfer RNA valine (anticodon AAC) 233455988934559961Rat
41239310LOC120101547fatty acid-binding protein 5-like33458594934586393Rat
1587102Hnrnpa1-ps20heterogeneous nuclear ribonucleoprotein A1, pseudogene 2033467336934674656Rat
1303272Mmadhcmetabolism of cobalamin associated D33470864934726554Rat
7691310LOC102555425uncharacterized LOC10255542533472651434736258Rat
41020350Cep19-ps1centrosomal protein 19, pseudogene 133489813134898840Rat
1359690Rnd3Rho family GTPase 333557192935589283Rat
1359393Tas2r134taste receptor, type 2, member 13433607765236078641Rat
41177880LOC120101491ubiquitin-40S ribosomal protein S27a-like33625497536261863Rat
41102312Rpl29-ps11ribosomal protein L29, pseudogene 1133631504736315697Rat
41165151Rpl28-ps9ribosomal protein L28, pseudogene 933636699136367397Rat
1306676Rbm43RNA binding motif protein 4333639443136404757Rat
4109660Cct8-ps2chaperonin containing Tcp1, subunit 8 (theta), pseudogene 233640919636410212Rat
41340043Cct8-ps3chaperonin containing Tcp1, subunit 8 (theta), pseudogene 333640952636410608Rat
1311721NmiN-myc (and STAT) interactor33641560736439716Rat
1588377Ldha-ps11lactate dehydrogenase A, pseudogene 1133646040936461527Rat
621359Tnfaip6TNF alpha induced protein 633650225036521652Rat
1562474Rif1replication timing regulatory factor 133655468936607961Rat
1311134Nebnebulin33661367736811618Rat
41372376Trnaa-agc59transfer RNA alanine (anticodon AGC) 5933664813836648210Rat
40942202LOC120101548uncharacterized LOC12010154833681641136831129Rat
1563584Myl6-ps6myosin light chain 6, pseudogene 633683138836831996Rat
41374742Cdk4-ps3cyclin-dependent kinase 4, pseudogene 333683868736839389Rat
621327Arl5aADP-ribosylation factor like GTPase 5A33687846136903362Rat
68385Cacnb4calcium voltage-gated channel auxiliary subunit beta 433690677137169165Rat
41067155LOC120102058small nucleolar RNA SNORA1733699430236994428Rat
1311497Stam2signal transducing adaptor molecule 233718614537234810Rat
40956857Trnas-aga35transfer RNA serine (anticodon AGA) 3533725558437255658Rat
40998676Ndufa2-ps1NADH:ubiquinone oxidoreductase subunit A2, pseudogene 133726176337262065Rat
1564306Dppa5al1developmental pluripotency associated 5A like 133731594237316483Rat
1560248Fmnl2formin-like 233734879137624746Rat
1311401Prpf40apre-mRNA processing factor 40 homolog A33762558537689859Rat
1564819Arl6ip6ADP ribosylation factor like GTPase 6 interacting protein 633768999437720358Rat
40961022Ndufb1-ps2NADH:ubiquinone oxidoreductase subunit B1, pseudogene 233774469037745060Rat
40992840LOC120101962U6 spliceosomal RNA33776843537768539Rat
9428172Rps27a-ps7ribosomal protein S27a, pseudogene 733780272737803281Rat
9854659Rps27a-ps31ribosomal protein S27a, pseudogene 3133781397937814699Rat
2320490Micos10-ps2mitochondrial contact site and cristae organizing system subunit 10, pseudogene 233789684237897073Rat
1592097Hnrnpa1-ps7heterogeneous nuclear ribonucleoprotein A1, pseudogene 733801837538025764Rat
41117082LOC120102079small nucleolar RNA SNORA4033815393638154056Rat
11472940LOC108350373uncharacterized LOC10835037333825885938310242Rat
1595512Rprmreprimo, TP53 dependent G2 arrest mediator homolog33853958138540998Rat
41261021LOC120102131U6 spliceosomal RNA33858576838585874Rat
1595484Dkc1-ps2dyskerin pseudouridine synthase 1, pseudogene 233875218938753825Rat
735044Galnt13polypeptide N-acetylgalactosaminyltransferase 1333890369539560683Rat
40933123LOC120102077small nucleolar RNA SNORA1733902117039021277Rat
40977097LOC120102015small nucleolar RNA SNORA2/SNORA34 family33935167439351809Rat
41385392Mrps21-ps2mitochondrial ribosomal protein S21, pseudogene 233945908339459334Rat
1598165Hsp90ab1-ps23heat shock protein 90 alpha family class B member 1, pseudogene 2333953186339534065Rat
41256231LOC120102130U6 spliceosomal RNA33962913339629239Rat
11502263LOC108350374uncharacterized LOC10835037433993432739943737Rat
2958Kcnj3potassium inwardly-rectifying channel, subfamily J, member 333994489640106646Rat
2324286Ofd1-ps1Ofd1 centriole and centriolar satellite protein, pseudogene 134051788940522835Rat
7571468Gapdh-ps94Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 9434070575640706713Rat
41270589LOC120101439uncharacterized LOC12010143934108407641091751Rat
41386871LOC1201020405S ribosomal RNA34127416641274284Rat
7624465LOC102552656uncharacterized LOC10255265634140397441420166Rat
41194913Rnu6-641RNA, U6 small nuclear 64134166480541664911Rat
3202Nr4a2nuclear receptor subfamily 4, group A, member 234168984741707036Rat
11471288Trnaa-cgc1transfer RNA alanine (anticodon CGC) 134176222741762298Rat
11377829Trnag-gcc1transfer RNA glycine (anticodon GCC) 134176254441762614Rat
2726Gpd2glycerol-3-phosphate dehydrogenase 234180055241937729Rat
1589694Gapdh-ps4Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 434196962741994850Rat
41263037LOC120101440uncharacterized LOC12010144034209700342112153Rat
6487629Zfp532-ps1zinc finger protein 532, pseudogene 134253559342539695Rat
620361Galnt5polypeptide N-acetylgalactosaminyltransferase 534257362242619881Rat
1308367Ermnermin34262816042633816Rat
1307990Cytipcytohesin 1 interacting protein34269805842774955Rat
7739841LOC102555754uncharacterized LOC10255575434273588542743489Rat
621789Acvr1cactivin A receptor type 1C34281549042892423Rat
620200Acvr1activin A receptor type 134297855843097892Rat
7554908LOC102555913uncharacterized LOC10255591334309817143101848Rat
1589693Gapdh-ps1glyceraldehyde-3-phosphate dehydrogenase, pseudogene 134321236343214261Rat
7671946LOC102556145uncharacterized LOC10255614534325161443259310Rat
1308188Upp2uridine phosphorylase 234327304843317417Rat
1561169Ccdc148coiled-coil domain containing 14834335688543631999Rat
41258230LOC120101550basic proline-rich protein-like34363026743632662Rat
1307840Pkp4plakophilin 434363236443835834Rat
41094759Rps14-ps3ribosomal protein S14, pseudogene 334387634543876799Rat
9190663LOC103691811dynein light chain roadblock-type 1 pseudogene34388464343885168Rat
1309610Dapl1death associated protein-like 134396099343980940Rat
41255996LOC120101955U6 spliceosomal RNA34404418944044292Rat
1302949Tanc1tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 134409938744335478Rat
1359296Wdsub1WD repeat, sterile alpha motif and U-box domain containing 134434041544370890Rat
11422397LOC108350580uncharacterized LOC10835058034437592444379414Rat
1309801Baz2bbromodomain adjacent to zinc finger domain, 2B34438428244681619Rat
7716591Arf4-ps1ADP-ribosylation factor 4, pseudogene 134462585044630139Rat
41047996Rnu6-22RNA, U6 small nuclear 2234466084744660953Rat
1308993Marchf7membrane associated ring-CH-type finger 734468022944720172Rat
41254171LOC120101908uncharacterized LOC12010190834470164544705078Rat
1307606Cd302CD302 molecule34472232444756045Rat
7489036Mir6216microRNA 621634475686144756938Rat
41332538LOC120101907uncharacterized LOC12010190734476111544773503Rat
1565962Ly75lymphocyte antigen 7534476470244852219Rat
1309777Pla2r1phospholipase A2 receptor 134488394345013793Rat
1303119Itgb6integrin subunit beta 634504629545170532Rat
41106923LOC120102123U4 spliceosomal RNA34513767345137755Rat
11446749LOC108350379uncharacterized LOC10835037934514411645149094Rat
1307777Rbms1RNA binding motif, single stranded interacting protein 134519582845420406Rat
1594533Psmd8-ps1proteasome 26S subunit, non-ATPase 8, pseudogene 134545612445469819Rat
11391174LOC108352564uncharacterized LOC10835256434566369645700941Rat
11401909LOC108352563uncharacterized LOC10835256334571752245752406Rat
41258419LOC120102049small nucleolar RNA SNORA1734579319345793322Rat
41124612LOC120101552uncharacterized LOC12010155234605991446066272Rat
628859TankTRAF family member-associated NFKB activator34611423046190270Rat
1594532Psmd14proteasome 26S subunit, non-ATPase 1434625433846347076Rat
9112027LOC103691831cation-dependent mannose-6-phosphate receptor pseudogene34627299746287040Rat
1591773Tbr1T-box brain transcription factor 134635023746368397Rat
41179729Rnu6-249RNA, U6 small nuclear 24934643474946434854Rat
41018897Rpl9-ps12ribosomal protein L9, pseudogene 1234647779646480228Rat
631407Slc4a10solute carrier family 4 member 1034666507646959088Rat
2515Dpp4dipeptidylpeptidase 434696223347043870Rat
41063319LOC120101554uncharacterized LOC12010155434707772347101724Rat
9363799LOC103691814uncharacterized LOC10369181434709350047096631Rat
2668Gcgglucagon34711391447122958Rat
621253Fapfibroblast activation protein, alpha34713882347207671Rat
1560496Ifih1interferon induced with helicase C domain 134722898047275403Rat
1306589Gcagrancalcin34729732047329913Rat
7530968Shoc2-ps1SHOC2 leucine-rich repeat scaffold protein, pseudogene 134730189447305302Rat
621112Kcnh7potassium voltage-gated channel subfamily H member 734732933847822122Rat
41098018LOC120102053small nucleolar RNA SNORA1734744325747443380Rat
11432617LOC108350383uncharacterized LOC10835038334782143847837682Rat
1308174Fignfidgetin, microtubule severing factor34863751048760772Rat
41217695LOC120101556uncharacterized LOC12010155634911070749143091Rat
1598030Gatd1-ps1glutamine amidotransferase class 1 domain containing 1, pseudogene 134926662949267219Rat
61869Grb14growth factor receptor bound protein 1434956821049683805Rat
41043121LOC120102125U4 spliceosomal RNA34966123749661394Rat
6492288LOC100911508uncharacterized LOC10091150834973789049746043Rat
1308954Cobll1cordon-bleu WH2 repeat protein-like 134975326049915168Rat
41113803LOC120101557uncharacterized LOC12010155734978621349795843Rat
41083239LOC120101991U7 small nuclear RNA34982031849820381Rat
41244250Rps11-ps10ribosomal protein S11, pseudogene 1034987113849907924Rat
1306005Slc38a11solute carrier family 38, member 1134998711950033615Rat
41403016LOC120102041small nucleolar RNA SNORA1735005387150054023Rat
41148402LOC120102035small nucleolar RNA SNORA4835009309950093233Rat
3635Scn3asodium voltage-gated channel alpha subunit 335014641150258119Rat
3632Scn2asodium voltage-gated channel alpha subunit 235030278150437504Rat
41070396LOC120102075small nucleolar RNA SNORA1735049016850490295Rat
1306214Csrnp3cysteine and serine rich nuclear protein 335049837950695598Rat
1306443Galnt3polypeptide N-acetylgalactosaminyltransferase 335074250050779266Rat
1565122Ttc21btetratricopeptide repeat domain 21B35086136750935880Rat
41242060Rpl7a-ps19ribosomal protein L7a, pseudogene 1935089553250896545Rat
69364Scn1asodium voltage-gated channel alpha subunit 135095279051071804Rat
69368Scn9asodium voltage-gated channel alpha subunit 935114514851293342Rat
61922Scn7asodium voltage-gated channel alpha subunit 735133584151438308Rat
1560831Rps3l1ribosomal protein S3 like 135155968351560522Rat
41233961Rpl9-ps11ribosomal protein L9, pseudogene 1135177822951778790Rat
1583266Rps7-ps5ribosomal protein S7, pseudogene 535192430851925946Rat
7676304LOC102553976uncharacterized LOC10255397635200823752112424Rat
41307402LOC120102067small nucleolar RNA SNORA1735209327752093408Rat
1302980Xirp2xin actin-binding repeat containing 235212621352213094Rat
1311898B3galt1Beta-1,3-galactosyltransferase 135225341352826508Rat
41057891LOC120102112U2 spliceosomal RNA35269669952696861Rat
621643Stk39serine threonine kinase 3935291358353179060Rat
6491326LOC100911723uncharacterized LOC10091172335292801152929487Rat
15976994932414N04RiklRIKEN cDNA 4932414N04 gene like35328445453518848Rat
1564400Eif5-ps1eukaryotic translation initiation factor 5, pseudogene 135356636553569726Rat
1561599Cers6ceramide synthase 635363063753879692Rat
1589692Ybx1-ps9Y box binding protein 1, pseudogene 935389125953892680Rat
727920Nostrinnitric oxide synthase trafficking35390474653970995Rat
1307811Spc25SPC25 component of NDC80 kinetochore complex35393001353988940Rat
69398G6pc2glucose-6-phosphatase catalytic subunit 235399982154005539Rat
619930Abcb11ATP binding cassette subfamily B member 1135401685454112797Rat
620655Dhrs9dehydrogenase/reductase 935414783454170052Rat
68407Lrp2LDL receptor related protein 235418930554346769Rat
40992206Cfl1-ps10cofilin 1, pseudogene 1035435215454376010Rat
11408567LOC108350390uncharacterized LOC10835039035439624654402640Rat
1310718Bbs5Bardet-Biedl syndrome 535441042954431831Rat
620852Klhl41kelch-like family member 4135443429154447415Rat
1563531Fastkd1FAST kinase domains 135444971054475624Rat
620315Ppigpeptidylprolyl isomerase G35448402354512929Rat
1308818Cfap210cilia and flagella associated protein 21035452045554554677Rat
1359274Phospho2phosphatase, orphan 235455482954561990Rat
1307166Klhl23kelch-like family member 2335458078854594530Rat
620804Ssbsmall RNA binding exonuclease protection factor La35461661654626203Rat
41097145LOC120102101small nucleolar RNA U1335462478454624882Rat
1566062Mettl5methyltransferase 5, N6-adenosine35462579054638066Rat
1565257Ubr3ubiquitin protein ligase E3 component n-recognin 335464980354806779Rat
41266482Hnrnpc-ps5heterogeneous nuclear ribonucleoprotein C, pseudogene 535472476254732130Rat
1560313Myo3bmyosin IIIB35482022555228518Rat
1308499Sp5Sp5 transcription factor35527493155277733Rat
41323100LOC120101561uncharacterized LOC12010156135529262955311439Rat
1563852Erich2glutamate-rich 235531099355347701Rat
2652Gad1glutamate decarboxylase 135536970455410335Rat
619911Gorasp2golgi reassembly stacking protein 235547444855503570Rat
41065835LOC120101562uncharacterized LOC12010156235550325255505088Rat
1310370Tlk1tousled-like kinase 135552055955627580Rat
1589691Fau-ps1FAU ubiquitin like and ribosomal protein S30 fusion, pseudogene 135563059055631800Rat
1565767Rpl15l2ribosomal protein L15 like 235569919155700292Rat
1561059Mettl8methyltransferase 8, tRNA N3-cytidine35573145355863652Rat
1565551Dcaf17DDB1 and CUL4 associated factor 1735586377655895601Rat
1305740Cybrd1cytochrome b reductase 135593487455962132Rat
11429097LOC108350392glyceraldehyde-3-phosphate dehydrogenase pseudogene35598325055993524Rat
41074405Gapdh-ps28Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 2835598717755988204Rat
620174Dync1i2dynein cytoplasmic 1 intermediate chain 235603388256085080Rat
1305181Slc25a12solute carrier family 25 member 1235609716656191841Rat
1305716Hat1histone acetyltransferase 135621734456265021Rat
40932845LOC120102107U2 spliceosomal RNA35625625256256439Rat
7498194LOC102549016uncharacterized LOC10254901635626546556279458Rat
1307413Metap1dmethionyl aminopeptidase type 1D (mitochondrial)35627947156354518Rat
11426631LOC108350393uncharacterized LOC10835039335634059956364901Rat
1309593Dlx1distal-less homeobox 135635619056360780Rat
1304853Dlx2distal-less homeobox 235637023856373581Rat
7549589LOC102555148uncharacterized LOC10255514835646139656468036Rat
9400923LOC103691816uncharacterized LOC10369181635648552256490015Rat
2320728Mrps36-ps2mitochondrial ribosomal protein S36, pseudogene 235655290656553216Rat
621633Itga6integrin subunit alpha 635660451256689428Rat
69427Pdk1pyruvate dehydrogenase kinase 135670582456733040Rat
621886Rapgef4Rap guanine nucleotide exchange factor 435680938857101332Rat
41102588LOC120102074small nucleolar RNA SNORA1735682530756825429Rat
41371499LOC120102014small nucleolar RNA SNORA42/SNORA80 family35696432756964460Rat
9078858LOC103695171uncharacterized LOC10369517135704225157066815Rat
41168553LOC120101564uncharacterized LOC12010156435712938257132860Rat
1561394Map3k20mitogen-activated protein kinase kinase kinase 2035713053957289943Rat
1309363Cdca7cell division cycle associated 735732271857333353Rat
41345808Rps13-ps7ribosomal protein S13, pseudogene 735738340157393461Rat
11478808LOC108350396uncharacterized LOC10835039635743095657470280Rat
2323302Dctd-ps1dCMP deaminase, pseudogene 135751697257520591Rat
40939229LOC120101566uncharacterized LOC12010156635755767357573426Rat
1587670Eno1-ps1enolase 1, pseudogene 135757664357578321Rat
41347799LOC120101442uncharacterized LOC12010144235759414057602949Rat
41134704LOC120101567NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7-like35768210557684325Rat
7704882LOC102555817dynein heavy chain 17, axonemal-like35769212657699221Rat
9224218LOC103691818uncharacterized LOC10369181835771057357714304Rat
11437224LOC108350397uncharacterized LOC10835039735772031357788490Rat
1583765Sp3Sp3 transcription factor35781185557857150Rat
9183373LOC103691820uncharacterized LOC10369182035791270257917164Rat
7612019LOC102546819uncharacterized LOC10254681935794069557992557Rat
1307982Ola1Obg-like ATPase 135796689658085955Rat
40949761Trnav-aac24transfer RNA valine (anticodon AAC) 2435807388858073969Rat
9330172LOC10369182160S ribosomal protein L27 pseudogene35808095058081356Rat
1559457Sp9Sp9 transcription factor35814682658149357Rat
1309199Cir1corepressor interacting with RBPJ, 135815892358188799Rat
1305064Scrn3secernin 335818882058213623Rat
1309162Gpr155G protein-coupled receptor 15535821642258270350Rat
620887Wipf1WAS/WASL interacting protein family, member 135831452158416668Rat
41387376Rbx1-ps2ring-box 1, pseudogene 235843219458432513Rat
11362073LOC108350398uncharacterized LOC10835039835844657458448992Rat
69277Chrna1cholinergic receptor nicotinic alpha 1 subunit35845476358469832Rat
7606520Serpinb8l1serpin family B member 8 like 135848645558510222Rat
620139Chn1chimerin 135850982258676462Rat
41236206LOC120101570uncharacterized LOC12010157035867828058682493Rat
41098957Rnu6-1136RNA, U6 small nuclear 113635868956358689673Rat
11486579Ube2s-ps4ubiquitin-conjugating enzyme E2S, pseudogene 435869707358699024Rat
621862Atf2activating transcription factor 235871832358795280Rat
41192492Rpl19-ps5ribosomal protein L19, pseudogene 535872247458723687Rat
41165060LOC120101572uncharacterized LOC12010157235879525758799419Rat
620052Atp5mc3ATP synthase membrane subunit c locus 335881053558813185Rat
9345818LOC103691823NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1 pseudogene35887360558873938Rat
7527047LOC102552809uncharacterized LOC10255280935912311259135627Rat
1584075G3bp2-ps1G3BP stress granule assembly factor 2, pseudogene 135936089259362560Rat
41300198LOC120102034U1 spliceosomal RNA35940764159407795Rat
40928829LOC120102032small nucleolar RNA SNORA4835940862159408764Rat
7554897Rps7-ps11ribosomal protein S7, pseudogene 1135941704159418716Rat
1312042Lnpklunapark, ER junction formation factor35941887259487029Rat
41300438LOC120101944U6 spliceosomal RNA35949095159491051Rat
2320625Rps26-ps2ribosomal protein S26, pseudogene 235949876459538211Rat
41245427LOC120101965U6 spliceosomal RNA35952174659521846Rat
1588374Ptma-ps8prothymosin alpha, pseudogene 835954774359548317Rat
1305594Evx2even-skipped homeobox 235955819759562267Rat
1308417Hoxd13homeo box D1335957064759573963Rat
1309797Hoxd12homeo box D1235957767759578798Rat
7730597Hoxd11homeobox D1135958484059587257Rat
1306511Hoxd10homeo box D1035959451659597725Rat
1582908Hoxd9homeo box D935960057559602755Rat
6489440Hoxd8homeobox D835960779359610359Rat
40944736LOC120101573uncharacterized LOC12010157335961270659615030Rat
1309690Hoxd4homeo box D435961446459634042Rat
2325397Mir10bmicroRNA 10b35962843859628546Rat
1588601Hoxd3homeo box D335963870859650282Rat
41399479LOC120101574uncharacterized LOC12010157435965499259656589Rat
1309179Hoxd1homeo box D135966562959667769Rat
1306473Mtx2metaxin 235973020659792202Rat
41329305Snrpc-ps11small nuclear ribonucleoprotein polypeptide C, pseudogene 1136014329360143801Rat
41301375LOC120101575uncharacterized LOC12010157536019413760201089Rat
41246102LOC120101576uncharacterized LOC12010157636020335160208211Rat
11498171LOC108350401uncharacterized LOC10835040136027047060298941Rat
7733574LOC102554395uncharacterized LOC10255439536037104660401138Rat
41048592LOC120101577uncharacterized LOC12010157736038444460422413Rat
7566091LOC102554564uncharacterized LOC10255456436054150060544208Rat
727807Hnrnpa3heterogeneous nuclear ribonucleoprotein A336057857460588755Rat
620360Nfe2l2NFE2 like bZIP transcription factor 236059423960621712Rat
7560679Rpl10-ps3ribosomal protein L10, pseudogene 336062407960634739Rat
620364Agpsalkylglycerone phosphate synthase36074732360845831Rat
41031811Trnap-ggg5transfer RNA proline (anticodon GGG) 536075870560758779Rat
1590784Ift70bintraflagellar transport 70B36085580960858380Rat
1560121Ift70a2intraflagellar transport 70A236089919360901634Rat
2318157Ift70a1intraflagellar transport 70A136090189660905350Rat
621793Pde11aphosphodiesterase 11A36091356261297154Rat
41138727LOC120101579uncharacterized LOC12010157936096379660980819Rat
41199509LOC120101580uncharacterized LOC12010158036126693661268645Rat
2452Cyctcytochrome c, testis36129009061297158Rat
1596954Anp32a-ps1acidic nuclear phosphoprotein 32 family member A, pseudogene 136129134161293039Rat
628862Rbm45RNA binding motif protein 4536130597361320950Rat
1308887Osbpl6oxysterol binding protein-like 636134377661541170Rat
1306707Prkraprotein activator of interferon induced protein kinase EIF2AK236157544761594393Rat
1587131Pjvkpejvakin36159464461605051Rat
1305293Fkbp7FKBP prolyl isomerase 736160938461623710Rat
1305244Plekha3pleckstrin homology domain containing A336162343461644649Rat
621114Ttntitin36165243261924912Rat
41120841LOC120101583uncharacterized LOC12010158336170468761819104Rat
1593250Ccdc141coiled-coil domain containing 14136194861462109968Rat
1562244Sestd1SEC14 and spectrin domain containing 136212359062220759Rat
41312347Rnu6-480RNA, U6 small nuclear 48036216149362161596Rat
6500051Nsa2-ps20NSA2 ribosome biogenesis factor, pseudogene 2036227736762278418Rat
1311181Zfp385bzinc finger protein 385B36235518262640417Rat
41237371LOC120102119small nucleolar RNA U336259913262599217Rat
41353490LOC120101584uncharacterized LOC12010158436260438162611643Rat
1565385Cwc22CWC22 spliceosome associated protein36281523062864269Rat
41362468LOC120102114U2 spliceosomal RNA36292034662920495Rat
1584801Paics-ps1phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase, pseudogene 136305576063061070Rat
1589690Hspa8-ps15heat shock protein family A (Hsp70) member 8, pseudogene 1536306810263070159Rat
1564319Pdcd5l1programmed cell death 5 like 136364461563646013Rat
40954226LOC120101585uncharacterized LOC12010158536378325263786957Rat
1308894Ube2e3ubiquitin-conjugating enzyme E2E 336378697663851400Rat
7729778LOC102552685uncharacterized LOC10255268536403516264045120Rat
1593249Itga4integrin subunit alpha 436416276464235010Rat
1561057Cerklceramide kinase-like36423871464344695Rat
41032087LOC120101977U6 spliceosomal RNA36425514664255247Rat
3165Neurod1neuronal differentiation 136435955464363526Rat
7645726LOC102553121uncharacterized LOC10255312136441340964422066Rat
9124575LOC103691830uncharacterized LOC10369183036453035764536487Rat
1310767Itprid2ITPR interacting domain containing 236453670764573978Rat
1562095Ppp1r1cprotein phosphatase 1, regulatory (inhibitor) subunit 1C36461670064719696Rat
68329Pde1aphosphodiesterase 1A36474514065025178Rat
9254480LOC103691836uncharacterized LOC10369183636510945665118974Rat
1307813Dnajc10DnaJ heat shock protein family (Hsp40) member C1036523203165272732Rat
1311315Frzbfrizzled-related protein36533227465365208Rat
61939Nckap1NCK-associated protein 136541745065491769Rat
1307457Dusp19dual specificity phosphatase 1936553842465554465Rat
41378879LOC120102120small nucleolar RNA U336555215365552258Rat
1303069Nup35nucleoporin 3536555520365594488Rat
41366090LOC120102070small nucleolar RNA SNORA1736563224465632364Rat
7704830Tor1aip2l1torsin 1A interacting protein 2 like 136610772666108582Rat
41298278LOC120101446uncharacterized LOC12010144636642803366438630Rat
41086516LOC120101586uncharacterized LOC12010158636661037566633821Rat
2323737Rpl18-ps5ribosomal protein L18, pseudogene 536669966266700235Rat
1305239Zfp804azinc finger protein 804A36703348167267769Rat
11509734Pole4l1DNA polymerase epsilon 4, accessory subunit like 136732437767324995Rat
9176020LOC103691841uncharacterized LOC10369184136791358067918933Rat
1593013Fsip2fibrous sheath-interacting protein 236796234568032866Rat
1592093Hspa8-ps34heat shock protein family A (Hsp70) member 8, pseudogene 3436835268868354443Rat
41075467Rnu6-738RNA, U6 small nuclear 73836839178168391887Rat
1592950Rpl32-ps13ribosomal protein L32, pseudogene 1336851736168518050Rat
41120623LOC120102065small nucleolar RNA SNORA1736855210568552234Rat
6495960Eno1-ps12enolase 1, pseudogene 1236861797868618933Rat
11418915Nop10l1NOP10 ribonucleoprotein like 136865617268656369Rat
1359234Zc3h15zinc finger CCCH-type containing 1536874459168764335Rat
7598318LOC102548277uncharacterized LOC10254827736880925568837978Rat
1310613Itgavintegrin subunit alpha V36883851468926653Rat
40962046LOC120101588uncharacterized LOC12010158836887129668874358Rat
1562526Fam171bfamily with sequence similarity 171, member B36893075568986113Rat
1311373Zswim2zinc finger, SWIM-type containing 236899342269015441Rat
11478124Trnap-agg5transfer RNA proline (anticodon AGG) 536902568269025755Rat
6486084Gapdh-ps61Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 6136919803269199409Rat
6503504Slc25a6-ps1solute carrier family 25 member 6, pseudogene 136922427469225221Rat
1590646Rhog-ps2ras homolog family member G, pseudogene 236933052269331862Rat
41180258LOC120101447uncharacterized LOC12010144736934391569346980Rat
2255Calcrlcalcitonin receptor like receptor36942834869525910Rat
61914Tfpitissue factor pathway inhibitor36953315669582547Rat
11380967LOC108350412uncharacterized LOC10835041236962496769633729Rat
1305643Ctnnd1catenin delta 136968332869734550Rat
2323370Btbd18BTB domain containing 1836974305769751096Rat
1563348Selenohselenoprotein H36975185069753417Rat
1359456Tmx2thioredoxin-related transmembrane protein 236975493769762587Rat
1311926Med19mediator complex subunit 1936976213869772661Rat
1589737Zdhhc5zinc finger DHHC-type palmitoyltransferase 536977203769800142Rat
40970579LOC120101590uncharacterized LOC12010159036980056269809661Rat
1307679Clp1cleavage factor polyribonucleotide kinase subunit 136980677469818633Rat
1560142Ypel4yippee-like 436981537369820708Rat
2325385Mir130amicroRNA 130a36982254269822629Rat
4888574Mir3590microRNA 359036982254969822622Rat
41021208LOC120101953U6 spliceosomal RNA36983862569838731Rat
735225Serping1serpin family G member 136984272669852583Rat
1307960Ube2l6ubiquitin-conjugating enzyme E2L 636987302569888042Rat
1311701Smtnl1smoothelin-like 136988901069901096Rat
41003309LOC120101592uncharacterized LOC12010159236990297369907309Rat
621741Timm10translocase of inner mitochondrial membrane 1036990839769911943Rat
1308229Slc43a1solute carrier family 43 member 136992058669946768Rat
727797Rtn4rl2reticulon 4 receptor-like 236995455769971108Rat
7593039LOC102554396uncharacterized LOC10255439636995561469957212Rat
1312016Slc43a3solute carrier family 43, member 337000816070030324Rat
1589686Slc25a39-ps1solute carrier family 25 member 39, pseudogene 137004606570047832Rat
69336Prg2proteoglycan 2, pro eosinophil major basic protein37006253570066102Rat
1309904Prg3proteoglycan 3, pro eosinophil major basic protein 237007197070078103Rat
620253P2rx3purinergic receptor P2X 337008085070124664Rat
621143Ssrp1structure specific recognition protein 137012437170134481Rat
1312021Tnks1bp1tankyrase 1 binding protein 137013533570160071Rat
621645Aplnrapelin receptor37021740770221052Rat
1561726Lrrc55leucine rich repeat containing 5537026990870280651Rat
41075492LOC120102027small nucleolar RNA SNORA4837030782370307964Rat
41309304Rpl30-ps15ribosomal protein L30, pseudogene 1537035037270350850Rat
1332907Or5ak4olfactory receptor family 5 subfamily AK member 437041889870419827Rat
1332831Or5ai2-ps1olfactory receptor family 5 subfamily AI member 2, pseudogene 137043099370431653Rat
1333159Or5ak26-ps1olfactory receptor family 5 subfamily AK member 26, pseudogene 137044035970441273Rat
1333498Or5ak22olfactory receptor family 5 subfamily AK member 2237044869270449621Rat
1334273Olr440olfactory receptor 44037046603970466986Rat
1333144Or5ak24olfactory receptor family 5 subfamily AK member 2437048713670488080Rat
1332704Or5ak25olfactory receptor family 5 subfamily AK member 2537049755070498497Rat
1587010Nelfa-ps1negative elongation factor complex member A, pseudogene 137052263470525853Rat
1311224Fads2bfatty acid desaturase 2B37053573570575163Rat
41189848LOC120102020small nucleolar RNA SNORA5537056510270565233Rat
1332940Or5g27olfactory receptor family 5 subfamily G member 2737065392870654872Rat
1333598Or5g27bolfactory receptor family 5 subfamily G member 27B37067001370670957Rat
1333550Or5g28olfactory receptor family 5 subfamily G member 2837067746070678404Rat
1333624Or5g29olfactory receptor family 5 subfamily G member 2937068276170683705Rat
1333128Or5g24olfactory receptor family 5 subfamily G member 2437069043970691383Rat
1333343Or5g25olfactory receptor family 5 subfamily G member 2537071874170719697Rat
1332739Or9f1-ps1olfactory receptor family 9 subfamily F member 1, pseudogene 137072516570726066Rat
1334313Or9g4olfactory receptor family 9 subfamily G member 437072796370728901Rat
1589146Or8k16olfactory receptor family 8 subfamily K member 1637074374670744687Rat
1332821Or5bi1-ps1olfactory receptor family 5 subfamily BI member 1, pseudogene 137075714870757580Rat
1333910Or5g9olfactory receptor family 5 subfamily G member 937076891970769863Rat
1333692Or9g10olfactory receptor family 9 subfamily G member 1037079470670795641Rat
1334426Or9g3olfactory receptor family 9 subfamily G member 337080336370804298Rat
1333552Or9g19olfactory receptor family 9 subfamily G member 1937081788370818797Rat
1333558Or9g8-ps1olfactory receptor family 9 subfamily G member 8, pseudogene 137082563770826563Rat
1333797Or9g4bolfactory receptor family 9 subfamily G member 4B37084332170844259Rat
1332820Or9g20olfactory receptor family 9 subfamily G member 2037085934570860274Rat
1333709Olr460-psolfactory receptor pseudogene 46037086908970869691Rat
1333928Or2ah1olfactory receptor family 2 subfamily AH member 137088634370887278Rat
1333623Or5ar1olfactory receptor family 5 subfamily AR member 137090759270908524Rat
1333086Or5ap2olfactory receptor family 5 subfamily AP member 237091749170918444Rat
1332819Or5ap2bolfactory receptor family 5 subfamily AP member 2B37093188170932834Rat
1333556Or5m10bolfactory receptor family 5 subfamily M member 10B37093671770937664Rat
1332636Or5m10olfactory receptor family 5 subfamily M member 1037095665770957592Rat
1334169Or5m12b-ps1olfactory receptor family 5 subfamily M member 12B, pseudogene 137096616070967121Rat
1333815Or5m13olfactory receptor family 5 subfamily M member 1337098502370985961Rat
1333537Or5m13bolfactory receptor family 5 subfamily M member 13B37099035470991277Rat
41112624LOC120101593uncharacterized LOC12010159337100253871014287Rat
1332745Or5m11olfactory receptor family 5 subfamily M member 1137101756471018538Rat
1333102Or5m5olfactory receptor family 5 subfamily M member 537102686271027800Rat
1333400Or5m8olfactory receptor family 5 subfamily M member 837103476771035750Rat
1332991Or5m3olfactory receptor family 5 subfamily M member 337104857071049502Rat
9390404LOC103691839olfactory receptor 5M3-like37106604471066988Rat
1332647Or5m9olfactory receptor family 5 subfamily M member 937107264771073579Rat
1332926Or8u10olfactory receptor family 8 subfamily U member 1037108197671082941Rat
1332967Or8u3olfactory receptor family 8 subfamily U member 337110738771108346Rat
1332616Or5al5-ps1olfactory receptor family 5 subfamily AL member 5, pseudogene 137111945771120415Rat
1334269Or5al5bolfactory receptor family 5 subfamily AL member 5B37113756171138502Rat
1333774Or5al1olfactory receptor family 5 subfamily AL member 137115720771158148Rat
1332770Or5al7olfactory receptor family 5 subfamily AL member 737116627471167218Rat
1333859Or8u9olfactory receptor family 8 subfamily U member 937117538971176333Rat
1334276Or8u8olfactory receptor family 8 subfamily U member 837122830571229264Rat
1333455Or8j3olfactory receptor family 8 subfamily J member 337124134571242292Rat
1333365Or8k1olfactory receptor family 8 subfamily K member 1637125693971257889Rat
1332674Or8k3olfactory receptor family 8 subfamily K member 337127546371276422Rat
1334414Or8k17-ps1olfactory receptor family 8 subfamily K member 17, pseudogene 137128248971283427Rat
1333129Or8k20olfactory receptor family 8 subfamily K member 2037129446771295393Rat
1333986Or8j10-ps1olfactory receptor family 8 subfamily J member 10, pseudogene 137130792671308820Rat
1333472Or8k16bolfactory receptor family 8 subfamily K member 16B37133837571339316Rat
1334227Or8k22olfactory receptor family 8 subfamily K member 2237135040271351340Rat
1333540Or8k53b-ps1olfactory receptor family 8 subfamily K member 53B, pseudogene 137135931071360233Rat
1332829Or8k23olfactory receptor family 8 subfamily K member 2337136744071370914Rat
1334308Or8ah1-ps1olfactory receptor family 8 subfamily AH member 1, pseudogene 137137787171378591Rat
1333916Or8j3bolfactory receptor family 8 subfamily J member 3B37138285471383801Rat
1334187Or8k24olfactory receptor family 8 subfamily K member 2437139126571392206Rat
1333154Or8ag1-ps1olfactory receptor family 8 subfamily AG member 1, pseudogene 137139611971396764Rat
1333401Or8k43-ps1olfactory receptor family 8 subfamily K member 43, pseudogene 137141386771414658Rat
1332795Or8k27olfactory receptor family 8 subfamily K member 2737143154871432489Rat
1334278Or8k25olfactory receptor family 8 subfamily K member 2537145006671451019Rat
1333233Or8k30-ps1olfactory receptor family 8 subfamily K member 30, pseudogene 137145769571458634Rat
1332911Or8k30bolfactory receptor family 8 subfamily K member 30B37146931771470258Rat
1333685Olr503-psolfactory receptor pseudogene 50337147755671478153Rat
1332619Or8k31olfactory receptor family 8 subfamily K member 3137149379171494732Rat
1333454Or8ai1-ps1olfactory receptor family 8 subfamily AI member 1, pseudogene 137149861471499252Rat
2323539Ranbp3-ps1RAN binding protein 3, pseudogene 137149909571505092Rat
1333663Or8k32olfactory receptor family 8 subfamily K member 3237151528071516221Rat
1334025Or8k33olfactory receptor family 8 subfamily K member 3337155361971559885Rat
1333830Or8k38-ps1olfactory receptor family 8 subfamily K member 38, pseudogene 137156869871569499Rat
1333222Or5t7olfactory receptor family 5 subfamily T member 737159375371594685Rat
1332611Or8k3b-ps1olfactory receptor family 8 subfamily K member 3B, pseudogene 137161123271612172Rat
1332738Or5n2-ps1olfactory receptor family 5 subfamily N member 2, pseudogene 137162746471628353Rat
1333066Or8k39olfactory receptor family 8 subfamily K member 3937164829671649231Rat
1333259Or8k40olfactory receptor family 8 subfamily K member 4037166467671665617Rat
1333988Or5t5olfactory receptor family 5 subfamily T member 537170396971704934Rat
1333823Or5t18olfactory receptor family 5 subfamily T member 1837172888271729817Rat
1333653Or5t9olfactory receptor family 5 subfamily T member 937176790871774271Rat
1333437Or5t9bolfactory receptor family 5 subfamily T member 9B37180971871810668Rat
41005833LOC120102134U6 spliceosomal RNA37183475771834863Rat
1334112Or5t5bolfactory receptor family 5 subfamily T member 5B37183985371840821Rat
2323331Hspa9-ps1heat shock protein family A (Hsp70) member 9, pseudogene 137185894871862626Rat
1333471Or8h6b-ps1olfactory receptor family 8 subfamily H member 6B, pseudogene 137187810271879049Rat
1334114Or5t15-ps1olfactory receptor family 5 subfamily T member 15, pseudogene 137189882671899752Rat
1334333Olr520olfactory receptor 52037189882671899752Rat
1333007Olr525-psolfactory receptor pseudogene 52537192872571929021Rat
1333246Or8h10olfactory receptor family 8 subfamily H member 1037193413571935100Rat
1334405Or8h6olfactory receptor family 8 subfamily H member 637197071071971657Rat
1333410Or8h7olfactory receptor family 8 subfamily H member 737199756071998501Rat
1333349Or8h9olfactory receptor family 8 subfamily H member 937202516572026109Rat
1332695Or8h10colfactory receptor family 8 subfamily H member 10C37204670672047671Rat
1332657Or10ag59olfactory receptor family 10 subfamily AG member 5937206730572068249Rat
1333655Or8h10bolfactory receptor family 8 subfamily H member 10B37208962672090591Rat
1334282Or5t16olfactory receptor family 5 subfamily T member 1637209698172097916Rat
1334035Or5t17-ps1olfactory receptor family 5 subfamily T member 17, pseudogene 137210804472108995Rat
1334115Or8h11olfactory receptor family 8 subfamily H member 1137211242472113365Rat
1334050Or8i2olfactory receptor family 8 subfamily I member 237211936772120299Rat
1332650Or5be3olfactory receptor family 5 subfamily BE member 337212899872129936Rat
1333572Or5j12-ps1olfactory receptor family 5 subfamily J member 12, pseudogene 137214731272148231Rat
1333285Or5j1olfactory receptor family 5 subfamily J member 137215365972154597Rat
1333789Or5aq1olfactory receptor family 5 subfamily AQ member 1B37219659972197537Rat
1332637Or5aq6olfactory receptor family 5 subfamily AQ member 637222792372228861Rat
41346969Rnu6-1089RNA, U6 small nuclear 108937223844172238547Rat
1333836Or5aq7olfactory receptor family 5 subfamily AQ member 737228839272289330Rat
1334350Olr543-psolfactory receptor pseudogene 54337231110372311420Rat
41083699LOC120101961U6 spliceosomal RNA37231755172317654Rat
1333932Or5as1olfactory receptor family 5 subfamily AS member 137232404372324981Rat
1332604Or10ag52bolfactory receptor family 10 subfamily AG member 52B37236242872363393Rat
1333346Or5aq1dolfactory receptor family 5 subfamily AQ member 1D37237599472383570Rat
1333275Or5aq6b-ps1olfactory receptor family 5 subfamily AQ member 6B, pseudogene 137240158072402517Rat
1333887Olr548-psolfactory receptor pseudogene 54837243323072433790Rat
41288477Rnu6-107RNA, U6 small nuclear 10737243977872439879Rat
1332866Or5as2-ps1olfactory receptor family 5 subfamily AS member 2, pseudogene 137244611572446798Rat
11504008LOC108350601uncharacterized LOC10835060137249395372507941Rat
1332922Or5aq1bolfactory receptor family 5 subfamily AQ member 1B37250376272504700Rat
1334311Olr551olfactory receptor 55137252600572526943Rat
1333948Or5aq7bolfactory receptor family 5 subfamily AQ member 7B37255658472562298Rat
1333587Olr553-psolfactory receptor pseudogene 55337257903172579321Rat
1333825Or12e1olfactory receptor family 12 subfamily E member 137258863972589589Rat
1333038Or10ag52olfactory receptor family 10 subfamily AG member 5237262453372625513Rat
1334309Or10ag54olfactory receptor family 10 subfamily AG member 5437264813472649057Rat
1333935Or10ag54bolfactory receptor family 10 subfamily AG member 54B37267910172680468Rat
1333235Or12e8olfactory receptor family 12 subfamily E member 837270465872705578Rat
1333703Or12e9olfactory receptor family 12 subfamily E member 937271524172716185Rat
1590225Spindoc-ps1spindlin interactor and repressor of chromatin binding, pseudogene 137272522572729783Rat
1333686Or10ag57olfactory receptor family 10 subfamily AG member 5737273758872738568Rat
1590196St13-ps7ST13, Hsp70 interacting protein, pseudogene 737274006372741653Rat
1333264Or10ag2olfactory receptor family 10 subfamily AG member 237276375072764721Rat
1334121Or10ag58olfactory receptor family 10 subfamily AG member 5837279131972792275Rat
1332777Or10ag59bolfactory receptor family 10 subfamily AG member 59B37280375572804699Rat
1333729Or12e7b-ps1olfactory receptor family 12 subfamily E member 7B, pseudogene 137281432172815092Rat
11414657LOC108350559alpha-enolase pseudogene37281684372817685Rat
1333160Olr565-psolfactory receptor pseudogene 56537282908772829973Rat
1333224Or12e7olfactory receptor family 12 subfamily E member 737284304272843986Rat
1565990Pramel7preferentially expressed antigen in melanoma-like 737287076372873735Rat
1565946Pramel6preferentially expressed antigen in melanoma-like 637288501872888490Rat
1333049Or8w1bolfactory receptor family 8 subfamily W member 1B37290049972901425Rat
1334285Or5w22olfactory receptor family 5 subfamily W member 2237290756372908492Rat
1334084Or8w5-ps1olfactory receptor family 8 subfamily W member 5, pseudogene 137291437172915132Rat
1333586Or5w1d-ps1olfactory receptor family 5 subfamily W member 1D, pseudogene 137292845372929390Rat
1333805Or5w1c-ps1olfactory receptor family 5 subfamily W member 1C, pseudogene 137297296072973896Rat
2320108Actg1l1actin, gamma 1 like 137297776772979691Rat
2322673Tfdp1-ps1transcription factor Dp-1, pseudogene 137299230272994057Rat
1333533Or5w22b-ps1olfactory receptor family 5 subfamily W member 22B, pseudogene 137299278672993439Rat
1332935Or5w1e-ps1olfactory receptor family 5 subfamily W member 1E, pseudogene 137301769873018635Rat
1334372Or5w11olfactory receptor family 5 subfamily W member 1137304824573049174Rat
1333225Or8w1olfactory receptor family 8 subfamily W member 137305513573056061Rat
41295610Rpl9-ps5ribosomal protein L9, pseudogene 537305870673059260Rat
1334360Or5w1olfactory receptor family 5 subfamily W member 137306879673069734Rat
1333165Or5w12olfactory receptor family 5 subfamily W member 1237308733773088269Rat
1333807Or5w14b-ps1olfactory receptor family 5 subfamily W member 14B, pseudogene 137312433673125261Rat
1333690Or5w23-ps1olfactory receptor family 5 subfamily W member 23, pseudogene 137312637173127283Rat
1333069Or5w14olfactory receptor family 5 subfamily W member 1437314047973141417Rat
1333782Or5w13bolfactory receptor family 5 subfamily W member 13B37315708173166736Rat
1332942Or5w13olfactory receptor family 5 subfamily W member 1337317972373180655Rat
1333237Or5w15olfactory receptor family 5 subfamily W member 1537320959873210536Rat
1333945Olr585-psolfactory receptor pseudogene 58537323657173236759Rat
1333092Or5w16olfactory receptor family 5 subfamily W member 1637323776673238701Rat
1588372Rad21-ps1RAD21 cohesin complex component, pseudogene 137324366573247680Rat
1334356Or5w17olfactory receptor family 5 subfamily W member 1737325368373254618Rat
1333671Or5i1olfactory receptor family 5 subfamily I member 137326761673268560Rat
1333330Olr589-psolfactory receptor pseudogene 58937327391773274388Rat
1333758Or5w18olfactory receptor family 5 subfamily W member 1837328841773289349Rat
1333114Olr591-psolfactory receptor pseudogene 59137329952673300139Rat
1334027Or12e10olfactory receptor family 12 subfamily E member 1037330141873302353Rat
1333099Or12e13-ps1olfactory receptor family 12 subfamily E member 13, pseudogene 137331095473311855Rat
1333019Or12e13bolfactory receptor family 12 subfamily E member 13B37331860573319540Rat
1333944Or12e14olfactory receptor family 12 subfamily E member 1437332679973331195Rat
1333606Or5w8olfactory receptor family 5 subfamily W member 837336600573366931Rat
1333538Or5w19olfactory receptor family 5 subfamily W member 1937337530273376234Rat
1332937Or5w20olfactory receptor family 5 subfamily W member 2037338303773383969Rat
1595007Or9m1l1olfactory receptor family 9 subfamily M member 1 like 137339172173392674Rat
1333244Or5d16-ps1olfactory receptor family 5 subfamily D member 16, pseudogene 137341028073411227Rat
1333310Or5l13olfactory receptor family 5 subfamily L member 1337341584973416802Rat
1333645Or5l14bolfactory receptor family 5 subfamily L member 14B37343267773433615Rat
7579074LOC102555599olfactory receptor 5L1-like37344479973445737Rat
1333765Or5l14-ps1olfactory receptor family 5 subfamily L member 14, pseudogene 137344556973445837Rat
1333473Or5d47olfactory receptor family 5 subfamily D member 4737346535073466307Rat
1332658Or9m1-ps1olfactory receptor family 9 subfamily M member 1, pseudogene 137348570873486641Rat
1594971Or5d35olfactory receptor family 5 subfamily D member 3537351026673511198Rat
1594965Or5d18olfactory receptor family 5 subfamily D member 1837351652273517463Rat
2318201Or5d14l1olfactory receptor family 5 subfamily D member 14 like 137352753873528482Rat
1333682Or9m1bolfactory receptor family 9 subfamily M member 1B37356548073566421Rat
1332951Or5d14olfactory receptor family 5 subfamily D member 1437357743973578389Rat
1332892Or5d37olfactory receptor family 5 subfamily D member 3737360013373601113Rat
1334192Or5d20olfactory receptor family 5 subfamily D member 2037361066273611612Rat
1333420Or5d41olfactory receptor family 5 subfamily D member 4137363691473637864Rat
1333687Or5d41bolfactory receptor family 5 subfamily D member 41B37364831973649275Rat
1332963Or5bo1-ps1olfactory receptor family 5 subfamily BO member 1, pseudogene 137366298573663686Rat
1332686Or5w8bolfactory receptor family 5 subfamily W member 8B37366730073668232Rat
1332979Or5d40olfactory receptor family 5 subfamily D member 4037367839273679342Rat
1586443Or5d45olfactory receptor family 5 subfamily D member 4537369729973700236Rat
1333883Or5d45-ps1olfactory receptor family 5 subfamily D member 45, pseudogene 137371019373711117Rat
1333646Olr617-psolfactory receptor pseudogene 61737372875173729698Rat
1586409Or5d3olfactory receptor family 5 subfamily D member 337373409173759208Rat
1334429Or4p7olfactory receptor family 4 subfamily P member 737378030673781277Rat
1334383Or4p19b-ps1olfactory receptor family 4 subfamily P member 19B, pseudogene 137379700073797929Rat
1334422Olr621olfactory receptor 62137382438673825297Rat
1333304Or4p24-ps1olfactory receptor family 4 subfamily P member 24, pseudogene 137383586773836743Rat
1334023Olr623olfactory receptor 62337385017773851112Rat
41166556LOC120102097U6atac minor spliceosomal RNA37387989073880015Rat
1333417Or4c99olfactory receptor family 4 subfamily C member 9937389475873897788Rat
1332692Or4p20olfactory receptor family 4 subfamily P member 2037392984973930784Rat
1333573Olr626-psolfactory receptor pseudogene 62637395630473957250Rat
1334095Or4c31f-ps1olfactory receptor family 4 subfamily C member 31F, pseudogene 137396579973966710Rat
1333355Or8i7-ps1olfactory receptor family 8 subfamily I member 7, pseudogene 137398687373987754Rat
1333063Or4p18olfactory receptor family 4 subfamily P member 1837400022474001174Rat
1333510Or4p19olfactory receptor family 4 subfamily P member 1937401209374013031Rat
1332640Or4p20bolfactory receptor family 4 subfamily P member 20B37402216974023089Rat
1334085Or4p25-ps1olfactory receptor family 4 subfamily P member 25, pseudogene 137403868274039256Rat
1333052Or4c31olfactory receptor family 4 subfamily C member 3137405594774056858Rat
1333053Or4p22dolfactory receptor family 4 subfamily P member 22D37407239574073336Rat
1334280Or4c31bolfactory receptor family 4 subfamily C member 31B37409453374095462Rat
1333305Or4p22eolfactory receptor family 4 subfamily P member 22E37414724574148186Rat
1332956Or4c31colfactory receptor family 4 subfamily C member 31C37416666974167598Rat
1333267Or4c130-ps1olfactory receptor family 4 subfamily C member 130, pseudogene 137417433574175243Rat
1333746Or4p22olfactory receptor family 4 subfamily P member 2237419514374196084Rat
1332952Or4c31eolfactory receptor family 4 subfamily C member 31E37422200774222936Rat
1333978Or4c129olfactory receptor family 4 subfamily C member 12937422953174230439Rat
1333143Or4j1-ps1olfactory receptor family 4 subfamily J member 1, pseudogene 137426444074265208Rat
1333087Or4c133-ps1olfactory receptor family 4 subfamily C member 133, pseudogene 137427393574274872Rat
1334261Or4c101-ps1olfactory receptor family 4 subfamily C member 101, pseudogene 137428105674282171Rat
1333642Or4c135-ps1olfactory receptor family 4 subfamily C member 135, pseudogene 137430444474305364Rat
1333370Or4c102olfactory receptor family 4 subfamily C member 10237432327274324192Rat
1332802Or4c134-ps1olfactory receptor family 4 subfamily C member 134, pseudogene 137434313974344050Rat
1333456Or4p4olfactory receptor family 4 subfamily P member 437435255074353485Rat
1333439Or4s2olfactory receptor family 4 subfamily S member 237437749274378427Rat
1333354Or4c103bolfactory receptor family 4 subfamily C member 103B37440063274401558Rat
1333415Or4c103olfactory receptor family 4 subfamily C member 10337441582874416754Rat
1334434Or4a66colfactory receptor family 4 subfamily A member 66C37443211874433047Rat
1334412Or4c105bolfactory receptor family 4 subfamily C member 105B37445828074459209Rat
1334116Or4a66olfactory receptor family 4 subfamily A member 6637447501374475942Rat
1334339Olr655olfactory receptor 65537450192174502850Rat
41367619Rnu6-383RNA, U6 small nuclear 38337450439974504503Rat
1591313Or4p23olfactory receptor family 4 subfamily P member 2337453238974533315Rat
1332707Or4c104olfactory receptor family 4 subfamily C member 10437455601774556949Rat
1332849Or4a66bolfactory receptor family 4 subfamily A member 66B37456906874569997Rat
1334176Or4c105olfactory receptor family 4 subfamily C member 10537458241774583346Rat
1332834Or4c11olfactory receptor family 4 subfamily C member 1137459880974599732Rat
1332993Or4p8olfactory receptor family 4 subfamily P member 837464981874650744Rat
1334046Or4c29olfactory receptor family 4 subfamily C member 2937466059874661530Rat
1333985Or4c15olfactory receptor family 4 subfamily C member 1537469200674694901Rat
1333650Or4c107olfactory receptor family 4 subfamily C member 10737475100874751943Rat
1594334Bex4-ps1brain expressed X-linked 4, pseudogene 137476402874764725Rat
1333773Or4c108olfactory receptor family 4 subfamily C member 10837477041474771984Rat
1333643Or4c109bolfactory receptor family 4 subfamily C member 109B37478360574784540Rat
1334185Or4c107b-ps1olfactory receptor family 4 subfamily C member 107B, pseudogene 137481959174820221Rat
1332842Or4c108bolfactory receptor family 4 subfamily C member 108B37482694974827884Rat
1334218Or4c109olfactory receptor family 4 subfamily C member 10937484150774842442Rat
1333817Or4c110olfactory receptor family 4 subfamily C member 11037486027974861214Rat
1594833Serpinb1a-ps1serpin family B member 1A, pseudogene 137486199474862665Rat
1334252Or4c111olfactory receptor family 4 subfamily C member 11137487377374874708Rat
1333913Or4c112olfactory receptor family 4 subfamily C member 11237488967474890588Rat
1333808Olr673olfactory receptor 67337495581974956754Rat
1333042Or4c114olfactory receptor family 4 subfamily C member 11437496394274964877Rat
1332723Or4c112bolfactory receptor family 4 subfamily C member 112B37499263574993570Rat
1333762Or4c114b-ps1olfactory receptor family 4 subfamily C member 114B, pseudogene 137501398475014915Rat
1334151Or4c115olfactory receptor family 4 subfamily C member 11537504919675050128Rat
1333756Or4c116olfactory receptor family 4 subfamily C member 11637505977375060708Rat
1332811Or4c117olfactory receptor family 4 subfamily C member 11737507768775078622Rat
1333364Or4c128-ps1olfactory receptor family 4 subfamily C member 128, pseudogene 137508876675089617Rat
1332600Or4c117bolfactory receptor family 4 subfamily C member 117B37509435475095289Rat
11409438Cpne8l1copine 8 like 137512316575124523Rat
1332627Or4c119-ps1olfactory receptor family 4 subfamily C member 119, pseudogene 137512801475129149Rat
1333542Olr683-psolfactory receptor pseudogene 68337514541775145825Rat
1332635Or4a71olfactory receptor family 4 subfamily A member 7137515202875152945Rat
1332859Olr685-psolfactory receptor pseudogene 68537516466875165130Rat
1334069Or4c120olfactory receptor family 4 subfamily C member 12037517655575177490Rat
1333660Or4c121olfactory receptor family 4 subfamily C member 12137518303175183963Rat
1333430Or4c122olfactory receptor family 4 subfamily C member 12237521150475212439Rat
1333693Or4c15bolfactory receptor family 4 subfamily C member 15B37523224875233183Rat
1332941Or4p18bolfactory receptor family 4 subfamily P member 18B37525400375254953Rat
1332656Or8i14-ps1olfactory receptor family 8 subfamily I member 14, pseudogene 137526061575261459Rat
1333562Or4c123olfactory receptor family 4 subfamily C member 12337527247575273392Rat
1333350Or4c1olfactory receptor family 4 subfamily C member 137527890875279834Rat
1590104Or4c124olfactory receptor family 4 subfamily C member 12437530108875302047Rat
1332799Or4c124bolfactory receptor family 4 subfamily C member 124B37532084175321776Rat
1333999Or4c125olfactory receptor family 4 subfamily C member 12537535855475360555Rat
1333480Or4a15olfactory receptor family 4 subfamily A member 1537538249375383416Rat
1332822Or4a15bolfactory receptor family 4 subfamily A member 15B37540188975402836Rat
1332864Or4o1-ps1olfactory receptor family 4 subfamily O member 1, pseudogene 137541013375410569Rat
1332987Or4a39-ps1olfactory receptor family 4 subfamily A member 39, pseudogene 137543000675430958Rat
1333172Or4a2olfactory receptor family 4 subfamily A member 237543803475438951Rat
41401869LOC120101681olfactory receptor 4A16-like37544536175446344Rat
1332977Olr703olfactory receptor 70337547957375480520Rat
40966033LOC120101452olfactory receptor 4A15-like37549099175491908Rat
1334144Or4a68olfactory receptor family 4 subfamily A member 6837550259475503583Rat
1333603Or4a69olfactory receptor family 4 subfamily A member 6937552691775529004Rat
1333747Or4a70olfactory receptor family 4 subfamily A member 7037554826575549185Rat
1334170Or4af1-ps1olfactory receptor family 4 subfamily AF member 1, pseudogene 137555549775556072Rat
1334341Or4a72olfactory receptor family 4 subfamily A member 7237561332875614251Rat
1333831Or4a72b-ps1olfactory receptor family 4 subfamily A member 72B, pseudogene 137562798275628906Rat
1333105Or4a73olfactory receptor family 4 subfamily A member 7337564469275645636Rat
1333594Or4a77eolfactory receptor family 4 subfamily A member 77E37566397375664917Rat
1332696Or4a77bolfactory receptor family 4 subfamily A member 77B37567436875675312Rat
1333189Or4a78olfactory receptor family 4 subfamily A member 7837569054675691499Rat
1332997Or4a77colfactory receptor family 4 subfamily A member 77C37570851175709455Rat
1333089Or4a80olfactory receptor family 4 subfamily A member 8037572988075730833Rat
1333119Or4a77olfactory receptor family 4 subfamily A member 7737575270975753632Rat
1332720Olr716olfactory receptor 71637577785875778811Rat
1334286Or4a77dolfactory receptor family 4 subfamily A member 77D37579681575797765Rat
1334377Or4a81olfactory receptor family 4 subfamily A member 8137582016475839914Rat
1333286Or4c12b-ps1olfactory receptor family 4 subfamily C member 12B, pseudogene 137585430075855420Rat
1333140Or4a47olfactory receptor family 4 subfamily A member 4737587397175874900Rat
1332655Or4c58olfactory receptor family 4 subfamily C member 5837588253775883448Rat
1333833Or4c10bolfactory receptor family 4 subfamily C member 10B37590550175906430Rat
6500739Or4c10olfactory receptor family 4 subfamily C member 1037592887275930939Rat
1333962Or4c12olfactory receptor family 4 subfamily C member 1237594726675948186Rat
1334210Or4c35olfactory receptor family 4 subfamily C member 3537599342675994358Rat
1334281Olr726olfactory receptor 72637600808576012081Rat
1333254Or4c127olfactory receptor family 4 subfamily C member 12737601959176020520Rat
1333993Or4c52olfactory receptor family 4 subfamily C member 5237603410076035029Rat
1333798Or4c3olfactory receptor family 4 subfamily C member 337604265876043584Rat
1333220Or4x11b-ps1olfactory receptor family 4 subfamily X member 11B, pseudogene 137609197076092807Rat
1332947Or4c3eolfactory receptor family 4 subfamily C member 3E37609911976100027Rat
1333607Olr732-psolfactory receptor pseudogene 73237612524576125428Rat
1333493Or4x11olfactory receptor family 4 subfamily X member 1137613119676132125Rat
1333748Or4x11colfactory receptor family 4 subfamily X member 11C37614045576141384Rat
1332801Or4x5olfactory receptor family 4 subfamily X member 537616715276168081Rat
1332783Or4x6olfactory receptor family 4 subfamily X member 637617527876176207Rat
1334287Or4b1dolfactory receptor family 4 subfamily B member 1D37620784376208769Rat
6492495Pias2-ps1protein inhibitor of activated STAT, 2, pseudogene 137621631976229747Rat
1334005Olr738-psolfactory receptor pseudogene 73837621968776220208Rat
41299235Rnu6-886RNA, U6 small nuclear 88637622041576220521Rat
1332798Olr739-psolfactory receptor pseudogene 73937622859276228684Rat
1332719Or4b13-ps1olfactory receptor family 4 subfamily B member 13, pseudogene 137624982776250944Rat
1333754Or4b1olfactory receptor family 4 subfamily B member 137627454376275469Rat
1334323Or4b13bolfactory receptor family 4 subfamily B member 13B37628657376287490Rat
1333515Or4b1b-ps1olfactory receptor family 4 subfamily B member 1B, pseudogene 137630450576305430Rat
1334071Or4b1colfactory receptor family 4 subfamily B member 1C37631806676318989Rat
1333461Or4x13olfactory receptor family 4 subfamily X member 1337634087476341803Rat
3454Ptprjprotein tyrosine phosphatase, receptor type, J37640591776561842Rat
7694271LOC102555600uncharacterized LOC10255560037664321876665885Rat
9261493LOC103691844uncharacterized LOC10369184437664746776650894Rat
1311052Nup160nucleoporin 16037666578676729296Rat
41212619LOC120102013small nucleolar RNA SNORA4437672882376728928Rat
1309238Fnbp4formin binding protein 437673301276763077Rat
1306827Agbl2AGBL carboxypeptidase 237676489376800071Rat
11455941Rps26-ps9ribosomal protein S26, pseudogene 937677321576773918Rat
1308080Mtch2mitochondrial carrier 237683054976850189Rat
1311006C1qtnf4C1q and TNF related 437685436876872991Rat
1309406Ndufs3NADH:ubiquinone oxidoreductase core subunit S337687664676883824Rat
1310234Kbtbd4kelch repeat and BTB domain containing 437688367176889769Rat
1589783Ptpmt1protein tyrosine phosphatase, mitochondrial 137688992276899427Rat
1585192Eef1g-ps17eukaryotic translation elongation factor 1 gamma, pseudogene 1737691534676916860Rat
1307721Celf1CUGBP, Elav-like family member 137692459176999429Rat
1311592Rapsnreceptor-associated protein of the synapse37701507377024378Rat
61905Psmc3proteasome 26S subunit, ATPase 337703182577037207Rat
1304695Slc39a13solute carrier family 39 member 1337703941177047528Rat
1359607Spi1Spi-1 proto-oncogene37705974477093730Rat
40963061LOC120101909uncharacterized LOC12010190937706457177091751Rat
1305950Mybpc3myosin binding protein C337709516577113406Rat
619922MaddMAP-kinase activating death domain37711433077157865Rat
61909Nr1h3nuclear receptor subfamily 1, group H, member 337715880877168907Rat
40959111Trnaa-agc34transfer RNA alanine (anticodon AGC) 3437716137077161444Rat
41255595LOC120101973U6 spliceosomal RNA37717341177173516Rat
2021Acp2acid phosphatase 2, lysosomal37717502277185180Rat
1310164Ddb2damage specific DNA binding protein 237718511477207650Rat
1307327Pacsin3protein kinase C and casein kinase substrate in neurons 337722718777235820Rat
1306177Arfgap2ADP-ribosylation factor GTPase activating protein 237723630577248445Rat
1309540Cstpp1centriolar satellite-associated tubulin polyglutamylase complex regulator 137724739377416307Rat
41305975LOC120101910uncharacterized LOC12010191037734257777357711Rat
41135936LOC120102116U2 spliceosomal RNA37736323077363387Rat
619731Lrp4LDL receptor related protein 437742960077483593Rat
41160367LOC120101912uncharacterized LOC12010191237747311277476085Rat
1563596Ckap5cytoskeleton associated protein 537749119577593300Rat
11477246LOC108350415low molecular weight phosphotyrosine protein phosphatase pseudogene37755665177560912Rat
41225679Snord67small nucleolar RNA, C/D box 6737757338077573489Rat
41110845Trnaa-agc76transfer RNA alanine (anticodon AGC) 7637758347877583559Rat
61996F2coagulation factor II, thrombin37759619677609486Rat
2318583Znf408zinc finger protein 40837761559577621325Rat
1306068Arhgap1Rho GTPase activating protein 137762137777643400Rat
1310685Atg13autophagy related 1337764706977681028Rat
1584007Harbi1harbinger transposase derived 137768143177689749Rat
621330Ambra1autophagy and beclin 1 regulator 137770093677890221Rat
2344Chrm4cholinergic receptor, muscarinic 437789342577901166Rat
69073Mdkmidkine37790113477903997Rat
70929Dgkzdiacylglycerol kinase zeta37790414977946114Rat
7662975Atp5mc1-ps1ATP synthase membrane subunit c locus 1, pseudogene 137792215677933684Rat
1359613Creb3l1cAMP responsive element binding protein 3-like 137795258977993513Rat
9209512LOC103691847uncharacterized LOC10369184737801233878013177Rat
41071997LOC120101597uncharacterized LOC12010159737813429878153037Rat
1560612Phf21aPHD finger protein 21A37815876078331903Rat
41381402LOC120102016small nucleolar RNA SNORA2137820850478208636Rat
735214Large2LARGE xylosyl- and glucuronyltransferase 237833462778347167Rat
1311372Pex16peroxisomal biogenesis factor 1637834721278352603Rat
1563263Frey1Frey regulator of sperm-oocyte fusion 137835430378355055Rat
70937Mapk8ip1mitogen-activated protein kinase 8 interacting protein 137835505178372946Rat
620935Cry2cryptochrome circadian regulator 237837499578405001Rat
7738850LOC102546693uncharacterized LOC10254669337839610678414091Rat
1309463Slc35c1solute carrier family 35 member C137842192578429603Rat
41184129LOC120101599uncharacterized LOC12010159937845666578462854Rat
11445349LOC108350417uncharacterized LOC10835041737846585678494535Rat
1308142Chst1carbohydrate sulfotransferase 137855205978574740Rat
41148559LOC120101598uncharacterized LOC12010159837855911578561802Rat
41195488LOC120101600uncharacterized LOC12010160037874042878767369Rat
7625660LOC102546895uncharacterized LOC10254689537876463778790315Rat
621877Syt13synaptotagmin 1337887711478917527Rat
1597330Prdm11PR/SET domain 1137892565479005495Rat
1588371Riox2-ps5ribosomal oxygenase 2, pseudogene 537911599679118672Rat
1308395Tp53i11tumor protein p53 inducible protein 1137914482479160056Rat
1560411Tspan18tetraspanin 1837916006079299907Rat
41246379LOC120101602uncharacterized LOC12010160237933748679342517Rat
69070Cd82Cd82 molecule37938736179431847Rat
1310201Alx4ALX homeobox 437961168279648260Rat
1307707Ext2exostosin glycosyltransferase 237966541479798077Rat
41200055LOC120101603uncharacterized LOC12010160337972968479741304Rat
1309314Accs1-aminocyclopropane-1-carboxylate synthase37980525479820830Rat
1596039Accsl1-aminocyclopropane-1-carboxylate synthase-like37982646479841163Rat
6500810Atp5mc1-ps3ATP synthase membrane subunit c locus 1, pseudogene 337990528579908374Rat
1564664C3h11orf96similar to human chromosome 11 open reading frame 9637992012579921368Rat
1359731Alkbh3alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase37993951579972820Rat
708367Hsd17b12hydroxysteroid (17-beta) dehydrogenase 1237999004880113556Rat
2318156Timm23-ps8translocase of inner mitochondrial membrane 23, pseudogene 838003605180037343Rat
2325612Mir129-2microRNA 129-238020204480202140Rat
1305410Ttc17tetratricopeptide repeat domain 1738026348880374137Rat
1309772Api5apoptosis inhibitor 538037809680403259Rat
41338255LOC120102043small nucleolar RNA SNORA1738061644080616571Rat
40985490LOC120102004small nucleolar RNA SNORA64/SNORA10 family38065855380658689Rat
7539539LOC102549766uncharacterized LOC10254976638113790181152786Rat
41156540Rnu6-841RNA, U6 small nuclear 84138133842281338524Rat
1565066Rpl38l2ribosomal protein L38 like 238177463881774955Rat
1311013Lrrc4cleucine rich repeat containing 4C38230549583684039Rat
2319534Rrp8-ps1ribosomal RNA processing 8, pseudogene 138308598883099873Rat
1588505Vps26c-ps1VPS26 endosomal protein sorting factor C, pseudogene 138310296783141840Rat
2319335C1h9orf85-ps1similar to human chromosome 9 open reading frame 85, pseudogene 138433888884339352Rat
40984830LOC120101993U7 small nuclear RNA38449983684499900Rat
1590781Hsp90ab1-ps19heat shock protein 90 alpha family class B member 1, pseudogene 1938483409484836215Rat
1588504Myl12b-ps1myosin light chain 12B, pseudogene 138487283384873338Rat
1592252Necap1-ps1NECAP endocytosis associated 1, pseudogene 138544977285453693Rat
41368639LOC120101605uncharacterized LOC12010160538550759585531319Rat
41339341LOC120102127U4 spliceosomal RNA38551434785514473Rat
1592240Hsp90ab1-ps24heat shock protein 90 alpha family class B member 1, pseudogene 2438591628385918458Rat
1561224Ptbp1-ps6polypyrimidine tract binding protein 1, pseudogene 638632246986323963Rat
1560961Rfk-ps3riboflavin kinase, pseudogene 338651072986512353Rat
40977179Eno1-ps31enolase 1, pseudogene 3138676747386768066Rat
1592203Aldoa-ps9aldolase, fructose-bisphosphate A, pseudogene 938677064886804751Rat
9354787LOC103691849uncharacterized LOC10369184938769980387711037Rat
1309730Iftapintraflagellar transport associated protein38781206887906517Rat
1305588Rag2recombination activating 238790237387910227Rat
619790Rag1recombination activating 138791706187928158Rat
1306853Traf6TNF receptor associated factor 638796351787988316Rat
1309969Prr5lproline rich 5 like38800195188173532Rat
1307706Commd9COMM domain containing 938817590988190427Rat
1307846Ldlrad3low density lipoprotein receptor class A domain containing 338823952988481340Rat
41206601LOC120101606uncharacterized LOC12010160638840142488413464Rat
1304877Trim44tripartite motif-containing 4438859361988729085Rat
41096965LOC120101996U7 small nuclear RNA38862063088620693Rat
11392957LOC108350422uncharacterized LOC10835042238872774188733580Rat
1306113Fjx1four-jointed box kinase 138877422088776321Rat
1308745Pamr1peptidase domain containing associated with muscle regeneration 138888906188988615Rat
3697Slc1a2solute carrier family 1 member 238900512989135469Rat
2307Cd44CD44 molecule38915585089244615Rat
1588503Rps8-ps15ribosomal protein S8, pseudogene 1538925028289255154Rat
41114246LOC120101453uncharacterized LOC12010145338926395089270379Rat
1566332Pdhxpyruvate dehydrogenase complex, component X38937224889431779Rat
1564562ApipAPAF1 interacting protein38943196489458000Rat
41105165Rnu6-434RNA, U6 small nuclear 43438946836889468474Rat
1310282Ehfets homologous factor38963984589680061Rat
1305859Elf5E74 like ETS transcription factor 538980883789836977Rat
7743163LOC102548892uncharacterized LOC10254889238981242089824719Rat
2279Catcatalase38984239389874577Rat
41329094LOC120101609uncharacterized LOC12010160938987468189900390Rat
41395566Rps10-ps19ribosomal protein S10, pseudogene 1938991129689911949Rat
41372959LOC120101613uncharacterized LOC12010161338995319089954869Rat
620724Abtb2ankyrin repeat and BTB domain containing 238995472690108549Rat
41291997LOC120101612uncharacterized LOC12010161239002848490060741Rat
1306717Nat10N-acetyltransferase 1039011164390149891Rat
1305707Caprin1cell cycle associated protein 139015230590230447Rat
41381369LOC120101611uncharacterized LOC12010161139018278190188854Rat
7632234LOC102549184uncharacterized LOC10254918439019021790263371Rat
41358242Cox4i1-ps1cytochrome c oxidase subunit 4i1, pseudogene 139027532090276023Rat
40965212LOC120101615uncharacterized LOC12010161539033404890337821Rat
7531281LOC102551977uncharacterized LOC10255197739034334690350105Rat
1307101Lmo2LIM domain only 239035523490377970Rat
7525020LOC102552075uncharacterized LOC10255207539036239190366122Rat
11448031LOC108350426uncharacterized LOC10835042639041443190417376Rat
1593433Fbxo3F-box protein 339041726290449557Rat
40962922LOC120102093small Cajal body-specific RNA 2139042836690428504Rat
2311Cd59bCD59b molecule39045908590477571Rat
1563222C3h11orf91similar to human chromosome 11 open reading frame 9139047919690486592Rat
2323964D430041D05RiklRIKEN cDNA D430041D05 gene like39050655990782427Rat
619884Hipk3homeodomain interacting protein kinase 339079698090866701Rat
41261678LOC120102051small nucleolar RNA SNORA1739095445990954588Rat
1305901Cstf3cleavage stimulation factor subunit 339096641591037669Rat
1562313Tcp11l1t-complex 11 like 139104700691092687Rat
1309720Depdc7DEP domain containing 739109911191121152Rat
1311804Qser1glutamine and serine rich 139113751691202426Rat
1560542Prrg4proline rich and Gla domain 439121464691243347Rat
1560017Rpl17-ps17ribosomal protein L17, pseudogene 1739126717791267803Rat
1563448Ccdc73coiled-coil domain containing 7339128291991424269Rat
1565840Eif3meukaryotic translation initiation factor 3, subunit M39142475491442358Rat
9165094LOC103691852gamma-aminobutyric acid receptor-associated protein-like 2 pseudogene39152789891540529Rat
3974Wt1WT1 transcription factor39156654091613653Rat
1588621Them7thioesterase superfamily member 739166614491834783Rat
1588501Rpl6-ps11ribosomal protein L6, pseudogene 1139173947691741626Rat
1311292Rcn1reticulocalbin 139184105291855295Rat
3258Pax6paired box 639212877292157022Rat
1566052Elp4elongator acetyltransferase complex subunit 439216227192385251Rat
11430655Rpl35al6ribosomal protein L35A like 639236974192370081Rat
1587441Immp1linner mitochondrial membrane peptidase subunit 139238532992449559Rat
41105213LOC120102106U2 spliceosomal RNA39242263292422822Rat
41139969LOC120101618uncharacterized LOC12010161839242265192441625Rat
1564710Dnajc24DnaJ heat shock protein family (Hsp40) member C2439245063192486004Rat
11484255LOC108350428uncharacterized LOC10835042839248601992546067Rat
1562221Dcdc1-ps1doublecortin domain containing 1, pseudogene 139248605492896696Rat
735060Mpped2metallophosphoesterase domain containing 239318089593355605Rat
1586299Hint1-ps4histidine triad nucleotide binding protein 1, pseudogene 439341464893415233Rat
1311463Arl14epADP-ribosylation factor like GTPase 14 effector protein39344195293454282Rat
2630Fshbfollicle stimulating hormone subunit beta39354856093552370Rat
2952Kcna4potassium voltage-gated channel subfamily A member 439375639993778004Rat
41343713LOC120102061small nucleolar RNA SNORA1739402097194021100Rat
40941813LOC120102064small nucleolar RNA SNORA1739434073894340864Rat
41095689LOC120102045small nucleolar RNA SNORA1739452680394526933Rat
41044559LOC120102025small nucleolar RNA SNORA4839473313494733277Rat
40980031Hnrnph1-ps1heterogeneous nuclear ribonucleoprotein H1, pseudogene 139476387394768031Rat
1332711Or8g56-ps1olfactory receptor family 8 subfamily G member 56, pseudogene 139484500094845914Rat
9388772LOC103691856uncharacterized LOC10369185639491833294929236Rat
6497629Srsf3-ps4serine and arginine rich splicing factor 3, pseudogene 439506089495145150Rat
1586250Rpl7-ps2ribosomal protein L7, pseudogene 239543723395437977Rat
1586246Rps6-ps12ribosomal protein S6, pseudogene 1239551722895517667Rat
1304978Mettl15methyltransferase 15, mitochondrial 12S rRNA N4-cytidine39558685595764392Rat
41204131Grb7-ps1growth factor receptor bound protein 7, pseudogene 139567454195676044Rat
1561740Kif18akinesin family member 18A39576438895824756Rat
41260013Trnaa-ggc3transfer RNA alanine (anticodon GGC) 339587068095870752Rat
1588500Ahcy-ps7adenosylhomocysteinase, pseudogene 739600873296009992Rat
2202Bdnfbrain-derived neurotrophic factor39616504296215621Rat
621164Lin7clin-7 homolog C, crumbs cell polarity complex component39640680096417779Rat
628615Lgr4leucine-rich repeat-containing G protein-coupled receptor 439644738596550006Rat
1560583Ccdc34coiled-coil domain containing 3439655307496588310Rat
40957643LOC120101621uncharacterized LOC12010162139655833696598221Rat
1585105Slc25a5-ps9solute carrier family 25 member 5, pseudogene 939665614596657368Rat
619756Bbox1gamma-butyrobetaine hydroxylase 139682265496871786Rat
41229593LOC120101622uncharacterized LOC12010162239683402496859796Rat
1563711Fibinfin bud initiation factor homolog39694240596944676Rat
1311652Slc5a12solute carrier family 5 member 1239717932697228405Rat
1308873Ano3anoctamin 339723567197550090Rat
1589864Muc15mucin 15, cell surface associated39729472897308641Rat
6487743Rpl19-ps1ribosomal protein L19, pseudogene 139731648097318945Rat
9106594LOC103691857prohibitin-2 pseudogene39744309897444431Rat
1309783Potefam1POTE ankyrin domain family member 139764125897826965Rat
1332919Or4f52olfactory receptor family 4 subfamily F member 5239782819497829132Rat
1334379Or4f53olfactory receptor family 4 subfamily F member 5339785359197854529Rat
1333136Or4f53bolfactory receptor family 4 subfamily F member 53B39786790297868840Rat
1333604Or4k35olfactory receptor family 4 subfamily K member 3539788026197881172Rat
1585049Or4f54olfactory receptor family 4 subfamily F member 5439790700497907942Rat
1333744Or4g16olfactory receptor family 4 subfamily G member 1639792584997926781Rat
1333980Or4k36olfactory receptor family 4 subfamily K member 3639794998297950899Rat
1333545Or4k37olfactory receptor family 4 subfamily K member 3739797611097977027Rat
1334118Or4k38-ps1olfactory receptor family 4 subfamily K member 38, pseudogene 139798488997985362Rat
1562507Rps8-ps16ribosomal protein S8, pseudogene 1639799909497999712Rat
1332749Or4k77olfactory receptor family 4 subfamily K member 7739801633898017255Rat
1334334Or4g17olfactory receptor family 4 subfamily G member 1739802668798027622Rat
1332964Or4g7olfactory receptor family 4 subfamily G member 739805524198056179Rat
1561276Or4f4bolfactory receptor family 4 subfamily F member 4B39805806198061955Rat
1333521Or4k42bolfactory receptor family 4 subfamily K member 42B39806802498068962Rat
1566059Or4f5olfactory receptor family 4 subfamily F member 539807644098080996Rat
1333291Or4k42c-ps1olfactory receptor family 4 subfamily K member 42C, pseudogene 139808702098087956Rat
1333654Or4f4aolfactory receptor family 4 subfamily F member 4A39809690698101076Rat
1333925Or4k42-ps1olfactory receptor family 4 subfamily K member 42, pseudogene 139810532598106262Rat
1334032Olr765olfactory receptor 76539811874498121011Rat
1333795Or4k44olfactory receptor family 4 subfamily K member 4439813755298138490Rat
1332626Or4k45olfactory receptor family 4 subfamily K member 4539816793598168873Rat
1334047Or4k46olfactory receptor family 4 subfamily K member 4639819646698197404Rat
1333526Or4k48olfactory receptor family 4 subfamily K member 4839822052098221458Rat
1332807Or4k49olfactory receptor family 4 subfamily K member 4939823669298237630Rat
1333904Or4k50olfactory receptor family 4 subfamily K member 5039825489098255834Rat
1332860Or4k51olfactory receptor family 4 subfamily K member 5139831899998319937Rat
1332850Or4k52olfactory receptor family 4 subfamily K member 5239834126098342198Rat
1587382Gapdh-ps97Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 9739834580998346810Rat
1334162Or4f7bolfactory receptor family 4 subfamily F member 7B39838881598394276Rat
11448890LOC10835060640S ribosomal protein S28 pseudogene39843050798430716Rat
1333829Or4k48bolfactory receptor family 4 subfamily K member 48B39843624298437180Rat
1333335Or4f7colfactory receptor family 4 subfamily F member 7C39845888998459827Rat
41355606LOC120102069small nucleolar RNA SNORA1739846812998468259Rat
1334011Or4f7olfactory receptor family 4 subfamily F member 739848289598483833Rat
40939342LOC120102063small nucleolar RNA SNORA1739849302998493156Rat
2323045Cbx3-ps2chromobox 3, pseudogene 239849921098499603Rat
1333821Or4f56olfactory receptor family 4 subfamily F member 5639850331798505239Rat
1333499Or4f14olfactory receptor family 4 subfamily F member 1439852074998521687Rat
1333588Or4f14folfactory receptor family 4 subfamily F member 14F39853347698534414Rat
1334408Or4f57olfactory receptor family 4 subfamily F member 5739854460298545564Rat
1333867Or4f15olfactory receptor family 4 subfamily F member 1539855666798566115Rat
2322993Rps8-ps17ribosomal protein S8, pseudogene 1739858610998586784Rat
1332734Or4f6olfactory receptor family 4 subfamily F member 639859580298596740Rat
1333326Or4f58olfactory receptor family 4 subfamily F member 5839861003198610969Rat
1332868Or4f59olfactory receptor family 4 subfamily F member 5939861710398618065Rat
1334249Or4f60bolfactory receptor family 4 subfamily F member 60B39864183798642772Rat
1332602Or4f61bolfactory receptor family 4 subfamily F member 61B39865753298658602Rat
1332602Or4f61bolfactory receptor family 4 subfamily F member 61B39865756498658502Rat
1333067Or4f14eolfactory receptor family 4 subfamily F member 14E39869389398694831Rat
1332772Or4f61dolfactory receptor family 4 subfamily F member 61D39880426898805206Rat
40939791Brcc3-ps3BRCA1/BRCA2-containing complex, subunit 3, pseudogene 339882057498821258Rat
1334294Or4f14dolfactory receptor family 4 subfamily F member 14D39883942998840367Rat
1333491Or4f47olfactory receptor family 4 subfamily F member 4739886885598869805Rat
1588370Or4f62olfactory receptor family 4 subfamily F member 6239891296298913924Rat
1332896Or4f58c-ps1olfactory receptor family 4 subfamily F member 58C, pseudogene 139893305398933777Rat
1333641Or4f6bolfactory receptor family 4 subfamily F member 6B39895608198957019Rat
1333951Or4f60olfactory receptor family 4 subfamily F member 6039897573098976665Rat
2323858Cstf3-ps1cleavage stimulation factor subunit 3, pseudogene 139901004299010499Rat
2323669Prelid1-ps1PRELI domain containing 1, pseudogene 139901965499024330Rat
1311177Lpcat4lysophosphatidylcholine acyltransferase 439904472999052963Rat
1564529Nutm1NUT midline carcinoma, family member 139905351099064311Rat
1582780Nop10NOP10 ribonucleoprotein39906685799067942Rat
1311335Slc12a6solute carrier family 12, member 639907157799170266Rat
1310905Emc4ER membrane protein complex subunit 439916971199174730Rat
7684934LOC10255119760S ribosomal protein L19-like39918359799198224Rat
1582771Katnbl1katanin regulatory subunit B1 like 139918374899225789Rat
1305045Emc7ER membrane protein complex subunit 739926393399274365Rat
620027Chrm5cholinergic receptor, muscarinic 539928484699337252Rat
1309928Avenapoptosis and caspase activation inhibitor39929900999431635Rat
41126259LOC120102095small nucleolar RNA SNORA1139930499799305125Rat
68952Ryr3ryanodine receptor 339943175599979125Rat
40976983LOC120101913uncharacterized LOC12010191339955234199560547Rat
11436885LOC108350585uncharacterized LOC10835058539968916699690876Rat
40974503LOC120102033small nucleolar RNA SNORA4839995498199955113Rat
41274074LOC120101454uncharacterized LOC12010145439998760999989479Rat
2323648Hmgn2-ps3high mobility group nucleosomal binding domain 2, pseudogene 339999074399991003Rat
1561237Tmco5btransmembrane and coiled-coil domains 5B3100055744100083303Rat
7631560Wdr12-ps1WD repeat domain 12, pseudogene 13100073403100074186Rat
41015933LOC120101626uncharacterized LOC1201016263100090853100100922Rat
1306349Fmn1formin 13100101103100485652Rat
40960957Mrto4-ps4mRNA turnover 4, ribosome maturation factor, pseudogene 43100458801100476903Rat
1588523Sord-ps5sorbitol dehydrogenase, pseudogene 53100487786100491340Rat
2359Grem1gremlin 1, DAN family BMP antagonist3100512317100524001Rat
3669Scg5secretogranin V3100544101100588558Rat
1309107Arhgap11aRho GTPase activating protein 11A3100590865100607146Rat
9277103LOC103691860uncharacterized LOC1036918603100607628100667327Rat
2694Gjd2gap junction protein, delta 23100771450100776134Rat
41053904LOC120101628uncharacterized LOC1201016283100775166100787590Rat
2026Actc1actin, alpha, cardiac muscle 13100811987100817523Rat
1306223Aqraquarius intron-binding spliceosomal factor3100874987100945026Rat
1597283Zfp770zinc finger protein 7703100963430100971663Rat
41380011LOC120101629uncharacterized LOC1201016293101212971101241464Rat
1310006Dph6diphthamine biosynthesis 63101307229101437463Rat
7718425LOC102552721uncharacterized LOC1025527213101344132101516024Rat
41272986LOC120102042small nucleolar RNA SNORA173102077660102077791Rat
7536035LOC102552950uncharacterized LOC1025529503102223143102232648Rat
7547984LOC102553090uncharacterized LOC1025530903102232706102238710Rat
1563680Cdin1CDAN1 interacting nuclease 13102441553102646935Rat
1305198Meis2Meis homeobox 23102742904102944833Rat
9432037LOC103691864uncharacterized LOC1036918643102953525102954651Rat
7544371LOC102555456uncharacterized LOC1025554563102959088102971208Rat
41298797LOC120102030small nucleolar RNA SNORA483103045835103045977Rat
1565206Tmco5atransmembrane and coiled-coil domains 5A3103732936103746242Rat
40998754LOC120102099small nucleolar RNA U133103775219103775328Rat
1308735Spred1sprouty-related, EVH1 domain containing 13103983120104050321Rat
41079124Eno1-ps25enolase 1, pseudogene 253104028008104029277Rat
2325492Mir674microRNA 6743104053133104053209Rat
1564603Fam98bfamily with sequence similarity 98, member B3104134803104164249Rat
3539Rasgrp1RAS guanyl releasing protein 13104168549104230107Rat
41377247LOC120101634uncharacterized LOC1201016343104739185104768591Rat
7678100Cks2-ps1CDC28 protein kinase regulatory subunit 2, pseudogene 13104998500105012016Rat
41001010LOC120102023U1 spliceosomal RNA3105017369105017530Rat
41348066LOC120101636uncharacterized LOC1201016363105049041105052980Rat
1588455Thbs1thrombospondin 13105056293105071445Rat
1306874Fsip1fibrous sheath interacting protein 13105074584105217180Rat
41238482LOC120102132U6 spliceosomal RNA3105111125105111231Rat
41141334LOC120101637uncharacterized LOC1201016373105220427105224274Rat
621718Gpr176G protein-coupled receptor 1763105236794105337664Rat
1311439Eif2ak4eukaryotic translation initiation factor 2 alpha kinase 43105356261105441630Rat
1308506Srp14signal recognition particle 143105442184105445875Rat
41165495Akr1b1-ps6aldo-keto reductase family 1 member B, pseudogene 63105453204105456990Rat
41209037LOC120101638uncharacterized LOC1201016383105479444105487982Rat
628658BmfBcl2 modifying factor3105499534105520159Rat
41109379H2az2-ps1H2A.Z variant histone 2, pseudogene 13105553551105557545Rat
619791Bub1bBUB1 mitotic checkpoint serine/threonine kinase B3105563089105615547Rat
41222800LOC120101639uncharacterized LOC1201016393105625378105634875Rat
1306213Pak6p21 (RAC1) activated kinase 63105638248105674399Rat
1595953Ankrd63ankyrin repeat domain 633105675148105679970Rat
621004Plcb2phospholipase C, beta 23105683676105704384Rat
7562764LOC102548045uncharacterized LOC1025480453105704400105714041Rat
11361547Inafm2InaF motif containing 23105728208105733766Rat
1565536Ccdc9bcoiled-coil domain containing 9B3105736120105745039Rat
1566202Phgr1proline, histidine and glycine rich 13105742822105760835Rat
1309569Disp2dispatched RND transporter family member 23105762303105777826Rat
1303240Knstrnkinetochore-localized astrin/SPAG5 binding protein3105800762105820555Rat
2936Ivdisovaleryl-CoA dehydrogenase3105851710105872144Rat
1563127Bahd1bromo adjacent homology domain containing 13105891207105914414Rat
1585023Chst14carbohydrate sulfotransferase 143105916481105918538Rat
1307516Ccdc32coiled-coil domain containing 323105998429106010985Rat
1306147Rpusd2RNA pseudouridine synthase domain containing 23106017759106023010Rat
11378802Trnas-gcu4transfer RNA serine (anticodon GCU) 43106029258106029339Rat
1307498Knl1kinetochore scaffold 13106029627106091915Rat
41114726LOC120102037small nucleolar RNA SNORA483106034295106034427Rat
1563603Rad51RAD51 recombinase3106099753106125038Rat
1308697Rmdn3regulator of microtubule dynamics 33106125961106146568Rat
11429098LOC108350564glycine cleavage system H protein, mitochondrial pseudogene3106154314106157906Rat
621746GchfrGTP cyclohydrolase I feedback regulator3106158046106162080Rat
1308015Dnajc17DnaJ heat shock protein family (Hsp40) member C173106162197106195771Rat
1583955C3h15orf62similar to human chromosome 15 open reading frame 623106164179106167404Rat
1561576Zfyve19zinc finger FYVE-type containing 193106195779106203969Rat
628891Ppp1r14dprotein phosphatase 1, regulatory (inhibitor) subunit 14D3106205043106219290Rat
1303138Spint1serine peptidase inhibitor, Kunitz type 13106231082106244121Rat
628824Rhovras homolog family member V3106260774106270009Rat
40927741Rnu6-603RNA, U6 small nuclear 6033106276929106277024Rat
1311556Vps18VPS18 core subunit of CORVET and HOPS complexes3106279444106290298Rat
9076375Dll4l1delta like canonical Notch ligand 4 like 13106311472106317974Rat
1309740Dll4delta like canonical Notch ligand 43106317114106327004Rat
1307153Chac1ChaC glutathione-specific gamma-glutamylcyclotransferase 13106342302106345526Rat
1310969Ino80INO80 complex ATPase subunit3106368455106465716Rat
1566233Dppa3-ps1developmental pluripotency-associated 3, pseudogene 13106480217106482060Rat
1561009Exd1exonuclease 3'-5' domain containing 13106507839106535922Rat
620447Chp1calcineurin-like EF-hand protein 13106536009106571255Rat
6496122Oip5-as1OIP5 antisense RNA 13106578309106591845Rat
1564263Oip5Opa interacting protein 53106593746106603281Rat
1305764Nusap1nucleolar and spindle associated protein 13106603273106633428Rat
11490080LOC10835044440S ribosomal protein S20 pseudogene3106636402106639571Rat
1306202Ndufaf1NADH:ubiquinone oxidoreductase complex assembly factor 13106639025106650549Rat
1310654Rtf1Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)3106659363106718956Rat
619950Itpkainositol-trisphosphate 3-kinase A3106726036106734601Rat
1309323Ltkleukocyte receptor tyrosine kinase3106734675106741552Rat
1590891Rpap1RNA polymerase II associated protein 13106746642106768182Rat
3923Tyro3TYRO3 protein tyrosine kinase3106777686106797154Rat
1594601Gabarap-ps2GABA type A receptor-associated protein, pseudogene 23106839998106840386Rat
1561597MgaMAX dimerization protein MGA3106851216106942908Rat
1307578Mapkbp1mitogen activated protein kinase binding protein 13106947342106998368Rat
2290039Jmjd7jumonji domain containing 73106998454107004538Rat
1308658Pla2g4bphospholipase A2 group IVB3107004238107013853Rat
1311047Sptbn5spectrin, beta, non-erythrocytic 53107013783107054878Rat
628883Ehd4EH-domain containing 43107058191107121985Rat
1310595Pla2g4ephospholipase A2, group IVE3107132540107198609Rat
1593372Pla2g4dphospholipase A2 group IVD3107220973107242224Rat
1593370Pla2g4fphospholipase A2, group IVF3107249053107266201Rat
1304858Vps39VPS39 subunit of HOPS complex3107266846107304884Rat
1582782Rps25-ps11ribosomal protein S25, pseudogene 113107278950107280025Rat
1309417Tmem87atransmembrane protein 87A3107307726107353571Rat
2660Gancglucosidase, alpha; neutral C3107353369107406104Rat
11518089LOC108350445uncharacterized LOC1083504453107380534107408993Rat
2269Capn3calpain 33107407518107457858Rat
41290327LOC120102010small nucleolar RNA SNORA153107415211107415319Rat
1593644Zfp106zinc finger protein 1063107459232107510507Rat
620221Snap23synaptosome associated protein 233107514088107546177Rat
1307128Lrrc57leucine rich repeat containing 573107544786107553256Rat
9250626Haus2HAUS augmin like complex subunit 23107553146107565982Rat
1593360Stard9StAR-related lipid transfer domain containing 93107581097107672746Rat
1306771Cdan1codanin 13107675147107689811Rat
1311661Ttbk2tau tubulin kinase 23107691123107802911Rat
41193039LOC120101914uncharacterized LOC1201019143107696606107714056Rat
1562326Ubr1ubiquitin protein ligase E3 component n-recognin 13107813721107921701Rat
1305647Tmem62transmembrane protein 623107921940107961830Rat
1304669Ccndbp1cyclin D1 binding protein 13107962402107974234Rat
1305306Epb42erythrocyte membrane protein band 4.23107979709107997932Rat
1593350Tgm5transglutaminase 53108008087108044013Rat
41157710LOC120093166protein-glutamine gamma-glutamyltransferase 5-like3108028742108048946Rat
7615199Tgm7transglutaminase 73108051890108068116Rat
1305829Lcmt2leucine carboxyl methyltransferase 23108099960108102084Rat
1359517Adaladenosine deaminase-like3108101857108119557Rat
41187367Zscan29-ps1zinc finger and SCAN domain containing 29, pseudogene 13108136468108140431Rat
1306924Tubgcp4tubulin gamma complex component 43108141081108172207Rat
1308039Tp53bp1tumor protein p53 binding protein 13108166574108270229Rat
3042Map1amicrotubule-associated protein 1A3108263217108283936Rat
1311552Ppip5k1diphosphoinositol pentakisphosphate kinase 13108284120108327683Rat
61976Ckmt1creatine kinase, mitochondrial 13108329859108335760Rat
1593345Strcstereocilin3108335920108355114Rat
1307620Catsper2cation channel, sperm associated 23108368654108389380Rat
68430Pdia3protein disulfide isomerase family A, member 33108388189108412013Rat
41284704Rnu105cRNA, U105C small nucleolar3108399872108400075Rat
41206203LOC120101948U6 spliceosomal RNA3108403290108403396Rat
1309917Ell3elongation factor for RNA polymerase II 33108413035108417181Rat
1588368Serf2small EDRK-rich factor 23108426960108430736Rat
1566077Serinc4serine incorporator 43108428896108434778Rat
1311457HypkHuntingtin interacting protein K3108434997108436370Rat
1562232Mfap1amicrofibrillar-associated protein 1A3108440163108456744Rat
1309616Wdr76WD repeat domain 763108456784108491528Rat
1561554Frmd5FERM domain containing 53108492099108763715Rat
40967222LOC120101916uncharacterized LOC1201019163108610335108612905Rat
7536034Rps4x-ps2ribosomal protein S4, X-linked, pseudogene 23108672163108673023Rat
40961474LOC120101915barrier-to-autointegration factor-like3108698917108699164Rat
1305985Golm2golgi membrane protein 23108827017108896207Rat
7499004Phb2-ps2prohibitin 2, pseudogene 23108841197108843373Rat
1309219Ctdspl2CTD small phosphatase like 23108915263108970620Rat
1593338Eif3jeukaryotic translation initiation factor 3, subunit J3108985103109007341Rat
1562529Spg11SPG11 vesicle trafficking associated, spatacsin3109007658109072904Rat
1307887Patl2PAT1 homolog 23109072958109087425Rat
2189B2mbeta-2 microglobulin3109095740109101764Rat
1305074Trim69tripartite motif-containing 693109111468109135255Rat
1593334Terb2telomere repeat binding bouquet formation protein 23109138343109156700Rat
3734Sordsorbitol dehydrogenase3109184697109216133Rat
40992335Tk1-ps2thymidine kinase 1, pseudogene 23109191206109192343Rat
628761Duox2dual oxidase 23109223809109247023Rat
1560628Duoxa2dual oxidase maturation factor 23109245337109249055Rat
1306601Duoxa1dual oxidase maturation factor 13109249815109260511Rat
628760Duox1dual oxidase 13109260526109295588Rat
1562705ShfSrc homology 2 domain containing F3109296517109316315Rat
11407687Trnah-gug7transfer RNA histidine (anticodon GUG) 73109323124109323195Rat
11496245Trnah-gug8transfer RNA histidine (anticodon GUG) 83109324630109324701Rat
61840Slc28a2solute carrier family 28 member 23109324815109387702Rat
11476027Trnah-gug9transfer RNA histidine (anticodon GUG) 93109325246109325317Rat
41072169LOC120102128U4 spliceosomal RNA3109433925109434099Rat
41113166LOC120101643sodium/nucleoside cotransporter 2-like3109505640109535183Rat
41172918LOC120101644sodium/nucleoside cotransporter 2-like3109577556109593992Rat
1593599Tra2b-ps3transformer 2 beta, pseudogene 33109634622109636026Rat
71090Gatmglycine amidinotransferase3109658919109675508Rat
1595990Afg2bAFG2 AAA ATPase homolog B3109694739109708356Rat
1359583C3h15orf48similar to human chromosome 15 open reading frame 483109719952109723505Rat
2325507Mir147microRNA 1473109722692109722770Rat
619750Slc30a4solute carrier family 30 member 43109753270109775306Rat
1310208Bloc1s6biogenesis of lysosomal organelles complex 1 subunit 63109816397109826528Rat
1564504Sqorsulfide quinone oxidoreductase3109841225109886724Rat
40972321LOC120101646uncharacterized LOC1201016463109917153109919854Rat
41215235LOC120101647oogenesin-3-like3109926856109927633Rat
41114814Dmdl1dystrophin like 13110282105110284854Rat
41164137Rpl7-ps19ribosomal protein L7, pseudogene 193110312211110312971Rat
1586187Eef2-ps2eukaryotic translation elongation factor 2, pseudogene 23110340830110343575Rat
41013566LOC120102028small nucleolar RNA SNORA483110656354110656498Rat
1588496Ahcy-ps8adenosylhomocysteinase, pseudogene 83111306794111307688Rat
41139445LOC120101648uncharacterized LOC1201016483111840429111871313Rat
1310910Sema6dsemaphorin 6D3111883415111941100Rat
7690189LOC102555070uncharacterized LOC1025550703111988107111993983Rat
11450983LOC108350455uncharacterized LOC1083504553112271347112275444Rat
1310565Slc24a5solute carrier family 24 member 53112319349112338889Rat
1306547Myef2myelin expression factor 23112338241112374122Rat
2311261Ctxn2cortexin 23112390972112401321Rat
3685Slc12a1solute carrier family 12 member 13112406140112482913Rat
2320789Rpl32-ps1ribosomal protein L32, pseudogene 13112494978112495501Rat
620849Dutdeoxyuridine triphosphatase3112498864112509994Rat
620908Fbn1fibrillin 13112554257112750835Rat
41276602LOC120101649uncharacterized LOC1201016493112609056112611665Rat
1305348Cep152centrosomal protein 1523112803185112878298Rat
41147450LOC120101652uncharacterized LOC1201016523112807157112814132Rat
41088749LOC12010165040S ribosomal protein S14-like3112838842112839309Rat
1583644Shc4SHC adaptor protein 43112880598112974216Rat
1562702Eid1EP300 interacting inhibitor of differentiation 13112922961112924680Rat
1559930Secisbp2lSECIS binding protein 2-like3112989613113036060Rat
7607903Tmf1-ps1TATA element modulatory factor 1, pseudogene 13113022599113027243Rat
628791Cops2COP9 signalosome subunit 23113084174113110090Rat
1308691Galk2galactokinase 23113110057113243014Rat
1359452Fam227bfamily with sequence similarity 227, member B3113226662113392396Rat
61805Fgf7fibroblast growth factor 73113280448113333279Rat
1311144Dtwd1DTW domain containing 13113392402113409322Rat
1306712Atp8b4ATPase phospholipid transporting 8B4 (putative)3113554979113757635Rat
41364680LOC120101972U6 spliceosomal RNA3113775940113776054Rat
71103Slc27a2solute carrier family 27 member 23113804728113842208Rat
2790Hdchistidine decarboxylase3113847256113865334Rat
1560391Gabpb1GA binding protein transcription factor subunit beta 13113879972113924742Rat
41055476LOC120102036small nucleolar RNA SNORA483113905684113905826Rat
1304979Usp8ubiquitin specific peptidase 83113962136114009683Rat
1564751Usp50ubiquitin specific peptidase 503114012104114035468Rat
620053Trpm7transient receptor potential cation channel, subfamily M, member 73114046258114134799Rat
1563001Sppl2asignal peptide peptidase-like 2A3114149337114193408Rat
1562199Ap4e1adaptor related protein complex 4 subunit epsilon 13114272997114339484Rat
41147582LOC120101654mitochondrial fission regulator 1-like3114286751114293220Rat
620721Blvrabiliverdin reductase A3114340778114366048Rat
1596799Ncaphnon-SMC condensin I complex, subunit H3114371937114399178Rat
1564158Itpripl1ITPRIP like 13114403123114407917Rat
1561120Snrnp200small nuclear ribonucleoprotein U5 subunit 2003114428854114458194Rat
1307285Ciao1cytosolic iron-sulfur assembly component 13114458671114465928Rat
1309744Tmem127transmembrane protein 1273114466095114478894Rat
1307613Stard7StAR-related lipid transfer domain containing 73114487161114515828Rat
9153540LOC103691883uncharacterized LOC1036918833114528697114529457Rat
1305804Dusp2dual specificity phosphatase 23114556325114558510Rat
1562279Astlastacin like metalloendopeptidase3114563135114580295Rat
2057Adra2badrenoceptor alpha 2B3114585174114589220Rat
1304904Gpat2glycerol-3-phosphate acyltransferase 2, mitochondrial3114646446114657051Rat
1563674Fahd2afumarylacetoacetate hydrolase domain containing 2A3114657176114665349Rat
1561323Rpl9-ps28ribosomal protein L9, pseudogene 283114670948114671735Rat
70888Kcnip3potassium voltage-gated channel interacting protein 33114677027114742923Rat
621435Prom2prominin 23114747654114761787Rat
7727044LOC102556271uncharacterized LOC1025562713114766560114769026Rat
11459092LOC108350458uncharacterized LOC1083504583114769516114793766Rat
6500748LOC100909998zinc finger protein 2-like3114793783114818395Rat
1308318Mrps5mitochondrial ribosomal protein S53114821046114837291Rat
11497432LOC108350459uncharacterized LOC1083504593114844866114849140Rat
3037Malmal, T-cell differentiation protein3114864378114888136Rat
7572515LOC102555822uncharacterized LOC1025558223114910231114924485Rat
1310869Mallmal, T-cell differentiation protein-like3114927897114950840Rat
1308136Nphp1nephrocystin 13114960650115016234Rat
2319932Wac-ps2WW domain containing adaptor with coiled-coil, pseudogene 23114996917114998457Rat
10401149Mtlnmitoregulin3115018810115019668Rat
1311707Bub1BUB1 mitotic checkpoint serine/threonine kinase3115020254115051650Rat
1306814Acoxlacyl-CoA oxidase-like3115061069115367032Rat
628774Bcl2l11Bcl2-like 113115366783115404068Rat
7735873Snrpf-ps3small nuclear ribonucleoprotein polypeptide F, pseudogene 33115420800115423872Rat
7751632LOC102555576uncharacterized LOC1025555763115424504115507561Rat
7681354LOC102550367uncharacterized LOC1025503673115713494115795134Rat
1561675Spdye4cspeedy/RINGO cell cycle regulator family, member E4C3115830999115838358Rat
1306629Anapc1anaphase promoting complex subunit 13115850117115930259Rat
69283MertkMER proto-oncogene, tyrosine kinase3115939351116045141Rat
1307907Tmem87btransmembrane protein 87B3116061933116097421Rat
41056854Trnaa-agc45transfer RNA alanine (anticodon AGC) 453116086177116086257Rat
41167816LOC120102056small nucleolar RNA SNORA173116105515116105641Rat
1310131Fbln7fibulin 73116111581116145839Rat
1310458Zc3h8zinc finger CCCH type containing 83116176779116193752Rat
1591768Mthfd1-ps1methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1, pseudogene 13116195791116198973Rat
1311061Zc3h6zinc finger CCCH type containing 63116203466116254186Rat
1561442Vinac1vinculin/alpha-catenin family member 13116259951116285108Rat
621113Ttltubulin tyrosine ligase3116298813116328538Rat
620822Polr1bRNA polymerase I subunit B3116333910116358385Rat
1307809Chchd5coiled-coil-helix-coiled-coil-helix domain containing 53116361845116372238Rat
41160055LOC120101659uncharacterized LOC1201016593116391390116393379Rat
621079Slc20a1solute carrier family 20 member 13116427095116441049Rat
7635188LOC102549265uncharacterized LOC1025492653116448610116456120Rat
1590645Ckap2lcytoskeleton associated protein 2-like3116497186116524302Rat
2890Il1ainterleukin 1 alpha3116526601116537055Rat
41123014LOC120101660uncharacterized LOC1201016603116555888116568213Rat
2891Il1binterleukin 1 beta3116577005116583386Rat
1566226Sirpb3signal-regulatory protein beta 33116678935116763246Rat
3449Sirpasignal-regulatory protein alpha3116819730116858099Rat
41281400LOC120101661uncharacterized LOC1201016613116889857116899563Rat
62054Pdynprodynorphin3116900990116913334Rat
1590585Rpl22l2ribosomal protein L22-like 23116994156116994620Rat
1310247Stk35serine/threonine kinase 353117016819117049131Rat
1589473Rpl12-ps5ribosomal protein L12, pseudogene 53117059318117085889Rat
11446767LOC108350462uncharacterized LOC1083504623117137843117180099Rat
1561831Tgm3transglutaminase 33117228661117264078Rat
41316947LOC120102055small nucleolar RNA SNORA173117295470117295602Rat
1565348Tgm6transglutaminase 63117324268117355674Rat
621301Snrpbsmall nuclear ribonucleoprotein polypeptides B and B13117369816117379344Rat
1310073Tmc2transmembrane channel-like 23117396378117464336Rat
41019236LOC120102118small nucleolar RNA U33117407488117407574Rat
1308892Nop56NOP56 ribonucleoprotein3117476963117481847Rat
41232419Snord110small nucleolar RNA, C/D box 1103117477945117478013Rat
41099731Snora51small nucleolar RNA, H/ACA box 513117478742117478873Rat
41029490Snord86small nucleolar RNA, C/D box 863117479698117479783Rat
41084667Snord56small nucleolar RNA, C/D box 563117480197117480266Rat
41234200Snord57small nucleolar RNA, C/D box 573117480517117480588Rat
621881Idh3bisocitrate dehydrogenase (NAD(+)) 3 non-catalytic subunit beta3117481845117486909Rat
1561317Rpl31l6ribosomal protein L31-like 63117489763117490616Rat
2321715Rps12l12ribosomal protein S12-like 123117490998117491509Rat
1588215Ebf4EBF family member 43117498186117566566Rat
1306937Cpxm1carboxypeptidase X (M14 family), member 13117588532117595330Rat
1308836Pced1aPC-esterase domain containing 1A3117600958117622992Rat
243065133LOC129351010uncharacterized LOC1293510103117603534117604319Rat
1592450Tmem239transmembrane 2393117604765117605978Rat
1359414Vps16VPS16 core subunit of CORVET and HOPS complexes3117622534117644041Rat
3450Ptpraprotein tyrosine phosphatase, receptor type, A3117650146117759744Rat
1308733Mrps26mitochondrial ribosomal protein S263117769220117770883Rat
3238Oxtoxytocin/neurophysin I prepropeptide3117782650117783490Rat
2184Avparginine vasopressin3117793447117805091Rat
1305440Ubox5U-box domain containing 53117806212117847711Rat
1563839Fastkd5FAST kinase domains 53117830219117847707Rat
631327Lzts3leucine zipper tumor suppressor family member 33117850286117861132Rat
1309979Ddrgk1DDRGK domain containing 13117861916117882680Rat
1589751Itpainosine triphosphatase3117885464117897247Rat
1310188Slc4a11solute carrier family 4 member 113117900223117912787Rat
41377672Rnu6-45RNA, U6 small nuclear 453117917815117917917Rat
1565616Dnaaf9dynein axonemal assembly factor 93117918047118052641Rat
41328988LOC120101934U6 spliceosomal RNA3118057755118057861Rat
9459076Gsta4-ps3glutathione S-transferase alpha 4, pseudogene 33118059138118069958Rat
7532501LOC102547276uncharacterized LOC1025472763118105557118110171Rat
69063Atrnattractin3118110320118244326Rat
620503Gfra4GDNF family receptor alpha 43118254937118262252Rat
1305278Adam33ADAM metallopeptidase domain 333118262395118283456Rat
1311953Siglec1sialic acid binding Ig like lectin 13118287988118307125Rat
40955557LOC120101662uncharacterized LOC1201016623118315987118319330Rat
41248306LOC120102129U6 spliceosomal RNA3118319647118319753Rat
41050347Rpl12-ps12ribosomal protein L12, pseudogene 123118339360118342238Rat
1312004Hspa12bheat shock protein family A (Hsp70) member 12B3118346372118364374Rat
1311739Adisspadipose secreted signaling protein3118364730118378881Rat
1311267Spef1sperm flagellar 13118390659118396842Rat
1304794Cenpbcentromere protein B3118396987118399780Rat
621500Cdc25bcell division cycle 25B3118407127118417272Rat
1561852Ap5s1adaptor related protein complex 5 subunit sigma 13118429618118432929Rat
1359371Mavsmitochondrial antiviral signaling protein3118451650118466094Rat
1305169Pank2pantothenate kinase 23118483382118519551Rat
7489028Mir103a2microRNA 103a-23118510194118510279Rat
1309384Rnf24ring finger protein 243118520459118575213Rat
7513945LOC102550049uncharacterized LOC1025500493118575112118610817Rat
1584704Fam98b-ps3family with sequence similarity 98, member B, pseudogene 33118644247118645571Rat
1564425Psmb3l2proteasome 20S subunit beta 3 like 23118672316118672933Rat
1565299Rps3a-ps4ribosomal protein S3a, pseudogene 43118676553118678148Rat
11355719LOC108350566heterogeneous nuclear ribonucleoproteins A2/B1 pseudogene3118679416118680923Rat
1306049Smoxspermine oxidase3118731814118767242Rat
62064Adra1dadrenoceptor alpha 1D3118793356118809354Rat
9302596Ervv-2endogenous retrovirus group V member 2, envelope3119129119119135004Rat
41272284LOC120101666uncharacterized LOC1201016663119150650119159816Rat
40991209Cycs-ps4cytochrome c, somatic, pseudogene 43119184668119185773Rat
3410Prnpprion protein3119186073119201513Rat
1306618Prndprion like protein doppel3119213462119218742Rat
1305551Rassf2Ras association domain family member 23119244288119280462Rat
7643344LOC102552722uncharacterized LOC1025527223119284683119302115Rat
619876Slc23a2solute carrier family 23 member 23119302651119395289Rat
1307399Tmem230transmembrane protein 2303119473109119497617Rat
3269Pcnaproliferating cell nuclear antigen3119499039119502911Rat
621186Cds2CDP-diacylglycerol synthase 23119514963119553555Rat
41097361LOC120102115U2 spliceosomal RNA3119557611119557671Rat
708445Prokr2prokineticin receptor 23119624738119639442Rat
41271028LOC120101670uncharacterized LOC1201016703119756587119762871Rat
735140Gpcpd1glycerophosphocholine phosphodiesterase 13119787681119832550Rat
7636000LOC102552951uncharacterized LOC1025529513119891578119909584Rat
1597982Shld1shieldin complex subunit 13119938695120011068Rat
41038490LOC120101966U6 spliceosomal RNA3119971782119971889Rat
2339Chgbchromogranin B3120043824120057169Rat
1308877Trmt6tRNA methyltransferase 6 non-catalytic subunit3120074899120086639Rat
1305218Mcm8minichromosome maintenance 8 homologous recombination repair factor3120086741120117008Rat
1311037Crls1cardiolipin synthase 13120119822120138674Rat
1305256Lrrn4leucine rich repeat neuronal 43120138093120150877Rat
1306816Fermt1FERM domain containing kindlin 13120171301120213555Rat
2321296Zscan5b-ps1zinc finger and SCAN domain containing 5B, pseudogene 13120342424120353794Rat
7726691LOC102554852uncharacterized LOC1025548523120385353120408304Rat
11503373LOC108350469uncharacterized LOC1083504693120626945120631997Rat
2211Bmp2bone morphogenetic protein 23120812660120822579Rat
41046177Rnu6-897RNA, U6 small nuclear 8973121508617121508711Rat
40971044Cct8-ps4chaperonin containing Tcp1, subunit 8 (theta), pseudogene 43121667549121680078Rat
9282085LOC103691897uncharacterized LOC1036918973121755209121758182Rat
1589750Hao1hydroxyacid oxidase 13121757400121828721Rat
1305146Tmx4thioredoxin-related transmembrane protein 43121856237121899680Rat
6493462Rpl6-ps12ribosomal protein L6, pseudogene 123121885601121891992Rat
1583213Rtkn-ps1rhotekin, pseudogene 13122050907122052916Rat
3344Plcb1phospholipase C beta 13122059988122772896Rat
40999887LOC120101919uncharacterized LOC1201019193122153798122157189Rat
41199054Nsa2-ps5NSA2 ribosome biogenesis factor, pseudogene 53122162700122163365Rat
41170365LOC120101678uncharacterized LOC1201016783122855153122862617Rat
3345Plcb4phospholipase C, beta 43122952965123322522Rat
40955793LOC120101970U6 spliceosomal RNA3123329939123330048Rat
1306991Lamp5lysosomal-associated membrane protein family, member 53123372462123384973Rat
1312009Pak5p21 (RAC1) activated kinase 53123395678123703967Rat
41289263Scarna4l2small Cajal body-specific RNA 4 like 23123674265123674392Rat
11507744LOC108350472uncharacterized LOC1083504723123833102124042494Rat
1304809Ankef1ankyrin repeat and EF-hand domain containing 13123847832123883060Rat
3728Snap25synaptosome associated protein 253124041898124123761Rat
41341385LOC120101685uncharacterized LOC1201016853124143576124157473Rat
2320350Rplp1-ps2ribosomal protein lateral stalk subunit P1, pseudogene 23124192239124192965Rat
1308814MkksMKKS centrosomal shuttling protein3124201877124221142Rat
1563120Slx4ipSLX4 interacting protein3124220215124396797Rat
41348658LOC120101686uncharacterized LOC1201016863124333829124338856Rat
11390742LOC108350474uncharacterized LOC1083504743124346668124352305Rat
2937Jag1jagged canonical Notch ligand 13124406783124442220Rat
7709640LOC102547655uncharacterized LOC1025476553124631974124666366Rat
7664087LOC102547911uncharacterized LOC1025479113124901646124968413Rat
41225295LOC120101692uncharacterized LOC1201016923124971230124981753Rat
41201670Chp1-ps1calcineurin-like EF-hand protein 1, pseudogene 13125069990125070498Rat
41343396LOC120101698uncharacterized LOC1201016983125347840125378621Rat
1311623Btbd3BTB domain containing 33125591427125621660Rat
41112066LOC120101704uncharacterized LOC1201017043125747891125756388Rat
41317548LOC120101705uncharacterized LOC1201017053125935521125965953Rat
1587304Pcbp2-ps6poly(rC) binding protein 2, pseudogene 63126118114126177008Rat
2320328Mrpl47-ps2mitochondrial ribosomal protein L47, pseudogene 23126190337126191320Rat
2320314Gapdh-ps49Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 493126310113126311401Rat
41288053LOC120101714glyceraldehyde-3-phosphate dehydrogenase-like3126349641126350664Rat
40931098LOC120101459uncharacterized LOC1201014593126395727126396666Rat
2320277Hmgn2l1high mobility group nucleosomal binding domain 2 like 13126570438126573173Rat
7617590LOC102548210uncharacterized LOC1025482103126677895126702104Rat
2320137Slc25a5-ps2solute carrier family 25 member 5, pseudogene 23126797239126798867Rat
40965090LOC120101715uncharacterized LOC1201017153126818605126936623Rat
1310030Sptlc3serine palmitoyltransferase, long chain base subunit 33126847878126978010Rat
1562551Ism1isthmin 13127023296127102228Rat
1597027Ldha-ps10lactate dehydrogenase A, pseudogene 103127091593127092669Rat
1308591Tasp1taspase 13127176416127408039Rat
41163706LOC120101716uncharacterized LOC1201017163127209267127212053Rat
41320428Gapdh-ps87Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 873127431140127432363Rat
1306067Esf1ESF1 nucleolar pre-rRNA processing protein homolog3127454744127507941Rat
1309829Ndufaf5NADH:ubiquinone oxidoreductase complex assembly factor 53127507931127537477Rat
1311278Sel1l2SEL1L2 adaptor subunit of SYVN1 ubiquitin ligase3127586031127713857Rat
1591318Macrod2mono-ADP ribosylhydrolase 23127720066129737511Rat
41357829LOC120101941U6 spliceosomal RNA3127769125127769231Rat
1566005Flrt3fibronectin leucine rich transmembrane protein 33127994491128008137Rat
7509526LOC102554505uncharacterized LOC1025545053129787752129844601Rat
41236200LOC120101717uncharacterized LOC1201017173129895901129961517Rat
1310146Kif16bkinesin family member 16B3129974692130254194Rat
41223283LOC120101718uncharacterized LOC1201017183129991230130019643Rat
41231371LOC120102071small nucleolar RNA SNORA173130137075130137194Rat
41098980LOC120102060small nucleolar RNA SNORA173130325643130325780Rat
1310194Snrpb2small nuclear ribonucleoprotein polypeptide B23130399239130408821Rat
1305253Otorotoraplin3130415339130418601Rat
40966702LOC120101719uncharacterized LOC1201017193130524370130574657Rat
3273Pcsk2proprotein convertase subtilisin/kexin type 23130880422131183127Rat
2320129Wbp4-ps1WW domain binding protein 4, pseudogene 13130893186130894522Rat
2205Bfsp1beaded filament structural protein 13131195087131252668Rat
1588366Dstndestrin, actin depolymerizing factor3131284647131311361Rat
1306536Rrbp1ribosome binding protein 13131314996131376930Rat
1307909Banf2BANF family member 23131387107131442837Rat
41096059LOC120101721uncharacterized LOC1201017213131396632131400429Rat
41330244LOC120101722uncharacterized LOC1201017223131481568131487131Rat
7605010LOC102550304uncharacterized LOC1025503043131522575131526274Rat
9463287LOC103691911uncharacterized LOC1036919113131577961131591149Rat
1310190Snx5sorting nexin 53131621875131641127Rat
41276891Snord17small nucleolar RNA, C/D box 173131636460131636698Rat
1307465Mgme1mitochondrial genome maintenance exonuclease 13131640770131649933Rat
1588365Pycr3-ps1pyrroline-5-carboxylate reductase 3, pseudogene 13131654565131656473Rat
1306130Ovol2ovo-like zinc finger 23131677391131707123Rat
41003609LOC120102008small nucleolar RNA SNORA36 family3131699975131700105Rat
1309538Kat14lysine acetyltransferase 143131736430131781732Rat
1566283Zfp133zinc finger protein 1333131829404131847552Rat
1311344Dzank1double zinc ribbon and ankyrin repeat domains 13131855890131908217Rat
1306428Polr3fRNA polymerase III subunit F3131908466131924838Rat
3542Rbbp9RB binding protein 9, serine hydrolase3131925095131939042Rat
11501358LOC108350480glyceraldehyde-3-phosphate dehydrogenase pseudogene3131933978131936843Rat
1310699Sec23bSec23 homolog B, COPII coat complex component3131939011131981489Rat
1566320Smim26small integral membrane protein 263131990147131991779Rat
1311821Dtd1D-aminoacyl-tRNA deacylase 13131995870132158646Rat
7751921Rack1-ps3receptor for activated C kinase 1, pseudogene 33132057645132058996Rat
1308385Scp2d1SCP2 sterol-binding domain containing 13132201979132202729Rat
69256Slc24a3solute carrier family 24 member 33132552119133051192Rat
41012882LOC120101723uncharacterized LOC1201017233132778720132796217Rat
41227463LOC120102073small nucleolar RNA SNORA173132960051132960169Rat
11440623LOC108350484uncharacterized LOC1083504843133074431133086736Rat
1305873Rin2Ras and Rab interactor 23133086858133303604Rat
40933111LOC120102122U4 spliceosomal RNA3133102492133102574Rat
11453203LOC108350483probable rRNA-processing protein EBP2 pseudogene3133160018133161377Rat
41203361Trnat-agu15transfer RNA threonine (anticodon AGU) 153133229015133229095Rat
7571782LOC102555365uncharacterized LOC1025553653133311274133322017Rat
1307713Naa20N(alpha)-acetyltransferase 20, NatB catalytic subunit3133322036133336843Rat
620507Crnkl1crooked neck pre-mRNA splicing factor 13133338593133354329Rat
1311519Cfap61cilia and flagella associated protein 613133354400133633310Rat
11366792Eif4a1-ps3eukaryotic translation initiation factor 4A1, pseudogene 33133493365133494262Rat
6486258Insm1INSM transcriptional repressor 13133640030133642963Rat
1308023Ralgapa2Ral GTPase activating protein catalytic subunit alpha 23133658725133938821Rat
11426867LOC108350486uncharacterized LOC1083504863133710823133715862Rat
41158921LOC120101950U6 spliceosomal RNA3133775907133776009Rat
11483653LOC108350487uncharacterized LOC1083504873133969341133998166Rat
1586461Bcl2l12-ps1Bcl2 like 12, pseudogene 13134152509134153252Rat
1307071Kizkizuna centrosomal protein3134277631134385260Rat
41396104Trnaa-agc54transfer RNA alanine (anticodon AGC) 543134357728134357802Rat
1586408Rpl18-ps9ribosomal protein L18, pseudogene 93134407050134408065Rat
1310218Xrn25'-3' exoribonuclease 23134436916134509308Rat
1304985Nkx2-4NK2 homeobox 43134514368134517243Rat
7587343LOC102547081uncharacterized LOC1025470813134516091134524752Rat
1585002Amd1-ps3adenosylmethionine decarboxylase 1, pseudogene 33134533682134535868Rat
1308443Nkx2-2NK2 homeobox 23134619701134630282Rat
11487974LOC108350489uncharacterized LOC1083504893134664020134683310Rat
1588548Pax1paired box 13134792330134801637Rat
11440632LOC108350490uncharacterized LOC1083504903134823759134827977Rat
1587302Eno1-ps30enolase 1, pseudogene 303135055218135056527Rat
41233677LOC120101936U6 spliceosomal RNA3135194918135195023Rat
40954948LOC120101725uncharacterized LOC1201017253135364107135467677Rat
2808Foxa2forkhead box A23135470123135474326Rat
41225358LOC120101726uncharacterized LOC1201017263135472358135477469Rat
41088816LOC120101727uncharacterized LOC1201017273135551775135567986Rat
41127869LOC120102104small nucleolar RNA U853135571162135571451Rat
7520429LOC102549662uncharacterized LOC1025496623135584899135588967Rat
41132131LOC120101462uncharacterized LOC1201014623135737056135740540Rat
3764Sstr4somatostatin receptor 43135854826135856689Rat
621299Thbdthrombomodulin3135863366135867018Rat
621251Cd93CD93 molecule3135891859135898378Rat
9145171LOC103691916uncharacterized LOC1036919163135994960136042640Rat
40953006LOC120102047small nucleolar RNA SNORA173136056090136056221Rat
1309327Nxt1nuclear transport factor 2-like export factor 13136108975136111897Rat
620279Sert1Sertoli cell protein 13136114902136118882Rat
1562321Gzf1GDNF-inducible zinc finger protein 13136119004136131223Rat
1589649NapbNSF attachment protein beta3136132248136179280Rat
1307417Cstl1cystatin-like 13136199914136204912Rat
620589Cst11cystatin 113136211414136214138Rat
7574865LOC102548897zinc finger protein 844-like3136218562136219077Rat
708555Cstdc1cystatin domain containing 13136224721136231441Rat
708514Cst12cystatin 123136235052136238912Rat
2434Cst8cystatin 83136244586136255412Rat
41018009Rnu1-39RNA, U1 small nuclear 393136257921136258086Rat
1564873Cst13cystatin 133136267070136276860Rat
41183431LOC120102029small nucleolar RNA SNORA483136282679136282826Rat
1311032Cst9lcystatin 9-like3136288093136290906Rat
1597405Cstdc2cystatin domain containing 23136302588136336782Rat
2432Cst3cystatin C3136336923136340796Rat
9163856P22k15-ps1cystatin related protein 2, pseudogene 13136534719136631118Rat
2115Andproandrogen regulated protein3136718601136725131Rat
41055206Andpro-ps1androgen regulated protein, pseudogene 13136862196136879373Rat
41284298Eif1-ps6eukaryotic translation initiation factor 1, pseudogene 63136905975136915055Rat
1596174Fth1-ps5ferritin heavy chain 1, pseudogene 53136914889136915757Rat
1596924Dpp3l1dipeptidylpeptidase 3 like 13136920237136922858Rat
727814P22k15cystatin related protein 23136960300136967358Rat
1559924Eif1l1eukaryotic translation initiation factor 1 like 13137070999137073720Rat
1563136Cst2lcystatin 2 like3137116122137122502Rat
41119918LOC120101464cystatin-S-like3137205417137228473Rat
40929690LOC120101465cystatin-S-like3137241240137245990Rat
41184973LOC120101466cystatin-S-like3137268963137273711Rat
41280229LOC120101467cystatin-S-like3137300845137312492Rat
1594832Cyssl2cystatin S like 23137328443137333183Rat
735160Cysscystatin S3137432049137436654Rat
1566383Cyssl3cystatin S like 33137470409137473857Rat
1565109Cyssl1cystatin S like 13137484098137489304Rat
1310978Cst5cystatin D3137573194137577754Rat
7631496LOC102551848uncharacterized LOC1025518483137910697137956233Rat
1310753Syndig1synapse differentiation inducing 13138030995138234646Rat
41073926LOC120101729uncharacterized LOC1201017293138178349138187949Rat
41119407LOC120101733uncharacterized LOC1201017333138389404138405290Rat
40984840Dnajb6-ps9DnaJ heat shock protein family (Hsp40) member B6, pseudogene 93138437900138439108Rat
41262294Smokxl-ps6sperm motility kinase X like, pseudogene 63138463218138465215Rat
41232979Galk1-ps1galactokinase 1, pseudogene 13138465217138468099Rat
41027581LOC120101738uncharacterized LOC1201017383138491426138549109Rat
2318489LOC100362296protein S100-A11-like3138537579138539300Rat
7547607ZNF69lzinc finger protein 69 like3138545521138560500Rat
1585001Tead2-ps1TEA domain transcription factor 2, pseudogene 13138583467138585546Rat
7717583LOC102555217zinc finger protein 120-like3138595665138627247Rat
11400029Rnaset2-ps1ribonuclease T2, pseudogene 13138600084138600943Rat
7551590Zfp442zinc finger protein 4423138655982138675874Rat
11382618LOC108350494UPF0472 protein C16orf72 homolog pseudogene3138736034138749614Rat
7747897Zfp120zinc finger protein 1203138763244138791042Rat
1310527Agfg1-ps1ArfGAP with FG repeats 1, pseudogene 13138777896138779912Rat
7541619LOC102554820uncharacterized LOC1025548203138812737138837689Rat
75244363300002I08Rikl1RIKEN cDNA 3300002I08 gene like 13138835647138983464Rat
7533201Smokxl3sperm motility kinase x like 33138846516138851436Rat
1591076Mcl1-ps1MCL1 apoptosis regulator, BCL2 family member, pseudogene 13138869221138871032Rat
41035097Ankrd40-ps3ankyrin repeat domain 40, pseudogene 33138893278138895202Rat
2324275Ppp3r1-ps2protein phosphatase 3, regulatory subunit B, alpha, pseudogene 23138924775138926246Rat
7742870LOC102549488uncharacterized LOC1025494883138980916139033402Rat
1565648S100a11l2S100 calcium binding protein A11 like 23138989652138992491Rat
11495800Smokxl-ps4sperm motility kinase X like, pseudogene 43139056925139057765Rat
41081935Galk1-ps3galactokinase 1, pseudogene 33139074227139079172Rat
41150898Smokxl-ps7sperm motility kinase X like, pseudogene 73139079155139079993Rat
1587301Cdca7l-ps2cell division cycle associated 7 like, pseudogene 23139094276139095488Rat
41119604Dnajb6-ps7DnaJ heat shock protein family (Hsp40) member B6, pseudogene 73139095867139098394Rat
94760121810024B03RiklRIKEN cDNA 1810024B03 gene like3139125202139171387Rat
40939444LOC120101744uncharacterized LOC1201017443139175955139241065Rat
11391622Smokl-ps2sperm motility kinase like, pseudogene 23139235422139238434Rat
41211223S100a11-ps3S100 calcium binding protein A11, pseudogene 33139245086139246190Rat
7504683LOC102555661uncharacterized LOC1025556613139302498139325804Rat
1565143Galk1l1galactokinase 1 like 13139345180139365440Rat
1585000Galk1-ps4galactokinase 1, pseudogene 43139360447139361681Rat
1589892Rpsa-ps6ribosomal protein SA, pseudogene 63139368299139380092Rat
1309154Cst7cystatin F3139396830139405557Rat
1308874Apmapadipocyte plasma membrane associated protein3139409021139437296Rat
1306246Acss1acyl-CoA synthetase short-chain family member 13139450383139500325Rat
7656316LOC102547396uncharacterized LOC1025473963139500272139521248Rat
1305667Vsx1visual system homeobox 13139514270139521869Rat
11414648LOC108350499uncharacterized LOC1083504993139537657139575790Rat
41098665LOC120101949U6 spliceosomal RNA3139543541139543645Rat
619725Entpd6ectonucleoside triphosphate diphosphohydrolase 63139575659139598163Rat
3460Pygbglycogen phosphorylase B3139611724139658521Rat
1562570Abhd12abhydrolase domain containing 12, lysophospholipase3139659315139719529Rat
41284146LOC120101747uncharacterized LOC1201017473139704462139719166Rat
1562246Gins1GINS complex subunit 13139724513139745930Rat
7597217Abt1-ps2activator of basal transcription 1, pseudogene 23139733866139736658Rat
40944166Rnu6-722RNA, U6 small nuclear 7223139747792139747893Rat
1306152Ninlninein-like3139748353139814683Rat
1306009NanpN-acetylneuraminic acid phosphatase3139826549139841655Rat
41058592LOC120102054small nucleolar RNA SNORA173139854323139854450Rat
7691208LOC102548278uncharacterized LOC1025482783139874129139907159Rat
41294038LOC120101749uncharacterized LOC1201017493139891547139936867Rat
41197209LOC120101748uncharacterized LOC1201017483139954705139964363Rat
1589647Nfkb2-ps1nuclear factor kappa B subunit 2, pseudogene 13139964528139967770Rat
7694064LOC102548446uncharacterized LOC1025484463139968512139978326Rat
619952Nsfl1cNSFL1 cofactor3139978306140002876Rat
7689509LOC102548575uncharacterized LOC1025485753140037968140040907Rat
2617Fkbp1aFKBP prolyl isomerase 1A3140040359140060107Rat
1307709Sdcbp2syndecan binding protein 23140060746140098063Rat
1305867Snphsyntaphilin3140098540140139342Rat
41000018Snphl1syntaphilin like 13140136868140139247Rat
41292422Anp32e-ps1acidic nuclear phosphoprotein 32 family member E, pseudogene 13140155661140159968Rat
1587557Rad21l1RAD21 cohesin complex component like 13140160128140188324Rat
2323360Tmem74bostransmembrane 74B, opposite strand3140197773140204953Rat
1564048Tmem74btransmembrane protein 74B3140219592140224208Rat
1587528Psmf1proteasome inhibitor subunit 13140235371140260546Rat
2323164Hnrnph1-ps2heterogeneous nuclear ribonucleoprotein H1, pseudogene 23140311910140336606Rat
1563415Rspo4R-spondin 43140357256140391780Rat
41337677LOC120101753uncharacterized LOC1201017533140405557140414036Rat
1307539Angpt4angiopoietin 43140420389140454213Rat
1308904Fam110afamily with sequence similarity 110, member A3140474484140485074Rat
40982723LOC120101754uncharacterized LOC1201017543140478638140482705Rat
11433440Rps29-ps15ribosomal protein S29, pseudogene 153140488269140488605Rat
1304644Slc52a3solute carrier family 52 member 33140498924140515845Rat
41060366LOC120101756uncharacterized LOC1201017563140515978140541284Rat
1564796Scrt2scratch family transcriptional repressor 23140581336140595273Rat
1307332Srxn1sulfiredoxin 13140604490140610050Rat
1308464Tcf15transcription factor 153140638984140644766Rat
621663Csnk2a1casein kinase 2 alpha 13140709984140756757Rat
1303293Tbc1d20TBC1 domain family, member 203140768537140787010Rat
708404Rbck1RANBP2-type and C3HC4-type zinc finger containing 13140789079140806017Rat
708432Trib3tribbles pseudokinase 33140809634140815230Rat
1586322Nrsn2neurensin 23140838813140847291Rat
1586313Sox12SRY-box transcription factor 123140859499140860518Rat
1585203Zcchc3zinc finger CCHC-type containing 33140872460140875292Rat
1559448C3h20orf96similar to human chromosome 20 open reading frame 963140876987140907711Rat
1560097Defb23defensin beta 233140923474140927715Rat
1565177Defb20defensin beta 203140948108140950907Rat
708352Defb22defensin beta 223140957093140961373Rat
1564413Defb26defensin beta 263140977214140980949Rat
1565792Defb28defensin beta 283140988032140993767Rat
6493921Rps10-ps1ribosomal protein S10, pseudogene 13140996660140997392Rat
1564030Defb29defensin beta 293141004098141009379Rat
1561746Defb19defensin beta 193141030332141037979Rat
1562393Defb21defensin beta 213141042810141044228Rat
1559541Defb24defensin beta 243141046571141052706Rat
1589571Defb27defensin beta 273141065135141068767Rat
1564902Defb36defensin beta 363141078001141086832Rat
1564765Defb25defensin beta 253141098813141099752Rat
1306560Rem1RRAD and GEM like GTPase 13141103722141112206Rat
7651008LOC102553281uncharacterized LOC1025532813141107781141145711Rat
1308946Hm13histocompatibility minor 133141145792141183557Rat
1591127Mcts2MCTS family member 23141163330141164108Rat
2858Id1inhibitor of DNA binding 13141210666141212420Rat
69422Cox4i2cytochrome c oxidase subunit 4i23141228443141239337Rat
2200Bcl2l1Bcl2-like 13141253508141304582Rat
11403788Rps2-ps43ribosomal protein S2, pseudogene 433141273638141274748Rat
1311894Tpx2TPX2, microtubule nucleation factor3141318428141360684Rat
41014374LOC120102102small nucleolar RNA U1093141335435141335551Rat
7684453LOC102553350uncharacterized LOC1025533503141362126141376351Rat
620934Mylk2myosin light chain kinase 23141376450141388357Rat
1310679Foxs1forkhead box S13141397012141398296Rat
1305990Dusp15dual specificity phosphatase 153141408495141419137Rat
1359622Ttll9tubulin tyrosine ligase like 93141429351141475965Rat
1305096Pdrg1p53 and DNA damage regulated 13141477561141483730Rat
1359224Xkr7XK related 73141500908141525062Rat
11434931LOC108350503uncharacterized LOC1083505033141518484141522235Rat
1305202Ccm2lCCM2 like scaffold protein3141533470141549136Rat
2785HckHCK proto-oncogene, Src family tyrosine kinase3141571587141614696Rat
7634195LOC102554664uncharacterized LOC1025546643141615499141621688Rat
41042908LOC120101963U6 spliceosomal RNA3141620611141620710Rat
1307768Tm9sf4transmembrane 9 superfamily member 43141627128141675386Rat
1310192Tspy26testis specific protein, Y-linked 263141690653141692729Rat
1307999Plagl2PLAG1 like zinc finger 23141695322141708516Rat
1303001Pofut1protein O-fucosyltransferase 13141708618141735558Rat
1582864Rpl27al6ribosomal protein L27A like 63141747835141748599Rat
1306815Kif3bkinesin family member 3B3141758466141798012Rat
1561878Asxl1ASXL transcriptional regulator 13141814012141881526Rat
1563510Nol4lnucleolar protein 4-like3141884840142007668Rat
11441130LOC108350618uncharacterized LOC1083506183142036623142040244Rat
9406645LOC103691935uncharacterized LOC1036919353142062129142076395Rat
41033438LOC120101758uncharacterized LOC1201017583142076408142080824Rat
1307786Commd7COMM domain containing 73142099566142114348Rat
1303274Dnmt3bDNA methyltransferase 3 beta3142130588142169128Rat
1589645Dnmt3b-ps1DNA methyltransferase 3B, pseudogene 13142152555142210602Rat
621781Mapre1microtubule-associated protein, RP/EB family, member 13142218846142246990Rat
9854662Rps27a-ps8ribosomal protein S27a, pseudogene 83142241989142242426Rat
41345769LOC120101759uncharacterized LOC1201017593142252406142257077Rat
1597364Efcab8EF-hand calcium binding domain 83142257195142323743Rat
1306357Sun5Sad1 and UNC84 domain containing 53142334931142355349Rat
1310866Bpifb2BPI fold containing family B, member 23142356990142377053Rat
1311602Bpifb6BPI fold containing family B, member 63142381478142395304Rat
1565613Bpifb3BPI fold containing family B, member 33142401068142415684Rat
1561174Bpifb4BPI fold containing family B, member 43142423571142448044Rat
41400483LOC120101760uncharacterized LOC1201017603142444035142447913Rat
2323465Bpifa6BPI fold containing family A, member 63142465236142483857Rat
3431Bpifa2BPI fold containing family A, member 23142493379142501343Rat
3725Bpifa2fBPI fold containing family A, member 2F3142521255142533462Rat
1564277Timm17al1-ps1translocase of inner mitochondrial membrane 17a-like 1, pseudogene 13142523181142523902Rat
41155485LOC120102098small nucleolar RNA U133142572873142572974Rat
1596102Bpifa3BPI fold containing family A, member 33142609748142619703Rat
619818Bpifa1BPI fold containing family A, member 13142627810142633553Rat
1559748Bpifa5BPI fold containing family A, member 53142646103142652884Rat
1563047Bpifb1BPI fold containing family B, member 13142672995142706258Rat
1596031Bpifb5BPI fold containing family B, member 53142706316142728330Rat
1596015Morf4l2-ps1mortality factor 4 like 2, pseudogene 13142752096142752789Rat
1594746Rplp1l3ribosomal protein lateral stalk subunit P1 like 33142756538142770325Rat
1594733Hmgb1l3high mobility group box 1 like 33142792113142792852Rat
41026694LOC120101703vomeromodulin-like3142804633142814240Rat
708387Cdk5rap1CDK5 regulatory subunit associated protein 13142838081142872669Rat
41237402LOC120101761uncharacterized LOC1201017613142872649142878051Rat
1307068Snta1syntrophin, alpha 13142876285142906737Rat
1309088Cbfa2t2CBFA2/RUNX1 partner transcriptional co-repressor 23142936945143043205Rat
1585184Sms-ps2spermine synthase, pseudogene 23142943678142945260Rat
7678473Rps10-ps7ribosomal protein S10, pseudogene 73142962044142962626Rat
41088778Zfyve21-ps1zinc finger FYVE-type containing 21, pseudogene 13143013286143014456Rat
1310124Necab3N-terminal EF-hand calcium binding protein 33143049477143064372Rat
1561517C3h20orf144similar to human chromosome 20 open reading frame 1443143053971143055327Rat
6491130Actl10actin-like 103143057061143058561Rat
728892E2f1E2F transcription factor 13143064535143075362Rat
628782Pxmp4peroxisomal membrane protein 43143093371143110620Rat
9414358Snrpel3small nuclear ribonucleoprotein polypeptide E like 33143118822143119593Rat
1564726Zfp341zinc finger protein 3413143122699143156250Rat
11427923Trnaa-agc3transfer RNA alanine (anticodon AGC) 33143128296143128368Rat
9202998Eef1a1l2eukaryotic translation elongation factor 1 alpha 1 like 23143138360143139773Rat
1309846Chmp4bcharged multivesicular body protein 4B3143170859143211376Rat
1594668Rpl38l6ribosomal protein L38 like 63143285738143286894Rat
1307228RalyRALY heterogeneous nuclear ribonucleoprotein3143306039143370542Rat
41054535Sec61g-ps7Sec61 translocon subunit gamma, pseudogene 73143357260143357815Rat
735192Eif2s2eukaryotic translation initiation factor 2 subunit beta3143374652143395460Rat
41153664LOC120102011small nucleolar RNA SNORA443143401085143401193Rat
2003Asipagouti signaling protein3143473584143561170Rat
41044769Trnaa-agc28transfer RNA alanine (anticodon AGC) 283143536893143536974Rat
69260Ahcyadenosylhomocysteinase3143569134143584359Rat
1587297Rpl12-ps7ribosomal protein L12, pseudogene 73143611486143612104Rat
7598717LOC102549926uncharacterized LOC1025499263143633881143642358Rat
1359556Itchitchy E3 ubiquitin protein ligase3143642348143733745Rat
619910Dynlrb1dynein light chain roadblock-type 13143742427143764227Rat
41309114LOC120102109U2 spliceosomal RNA3143781974143782150Rat
735183Map1lc3amicrotubule-associated protein 1 light chain 3 alpha3143783024143784670Rat
727825Piguphosphatidylinositol glycan anchor biosynthesis, class U3143784831143881268Rat
41159423Rnu6-524RNA, U6 small nuclear 5243143809843143809946Rat
41095606LOC12010192240S ribosomal protein S12-like3143816918143818611Rat
735085Tp53inp2tumor protein p53 inducible nuclear protein 23143881427143890104Rat
7489021Mir6334microRNA 63343143883158143883256Rat
620111Ncoa6nuclear receptor coactivator 63143890896143961916Rat
41085601LOC120102001U1 spliceosomal RNA3143962670143962834Rat
619870Ggt7gamma-glutamyltransferase 73143978073144004597Rat
1305489Acss2acyl-CoA synthetase short-chain family member 23144003808144047452Rat
41328501LOC120102019small nucleolar RNA SNORA183144015157144015287Rat
2752Gssglutathione synthetase3144047849144078197Rat
1307994Myh7bmyosin heavy chain 7B3144076911144122714Rat
2325514Mir499amicroRNA 499a3144110469144110533Rat
1309914Trpc4aptransient receptor potential cation channel, subfamily C, member 4 associated protein3144122003144192986Rat
1303074Edem2ER degradation enhancing alpha-mannosidase like protein 23144201604144227423Rat
1305991Procrprotein C receptor3144254596144258863Rat
41329311Pomp-ps2proteasome maturation protein, pseudogene 23144266741144267794Rat
620202Mmp24matrix metallopeptidase 243144279096144323572Rat
28912741Mmp24osMMP24 opposite strand3144322936144324449Rat
1305373Eif6eukaryotic translation initiation factor 63144325038144331396Rat
1585687Fam83cfamily with sequence similarity 83, member C3144333736144339758Rat
1585681Uqcc1ubiquinol-cytochrome c reductase complex assembly factor 13144353276144445810Rat
620102Gdf5growth differentiation factor 53144454316144458508Rat
1562262Cep250centrosomal protein 2503144470946144516125Rat
7514905C3h20orf173similar to human chromosome 20 open reading frame 1733144514060144524979Rat
1308144Ergic3ERGIC and golgi 33144525059144534813Rat
1308250Fer1l4fer-1-like family member 43144536099144571634Rat
620151Spag4sperm associated antigen 43144581006144587879Rat
1311148Cpne1copine 13144587531144629911Rat
1594333Rbm12RNA binding motif protein 123144609661144629911Rat
11373702LOC108350619glyceraldehyde-3-phosphate dehydrogenase pseudogene3144635975144637182Rat
620912Nfs1NFS1 cysteine desulfurase3144637309144659660Rat
1587111Romo1reactive oxygen species modulator 13144659709144661310Rat
1310071Rbm39RNA binding motif protein 393144662998144696222Rat
1305020Phf20PHD finger protein 203144710253144816696Rat
1308530Scand1SCAN domain-containing 13144818615144819479Rat
1311678Cnbd2cyclic nucleotide binding domain containing 23144819166144884825Rat
41355136LOC120102024small nucleolar RNA SNORA483144829292144829430Rat
9186323LOC103691957ferritin light chain 1 pseudogene3144914641144915944Rat
71087Epb41l1erythrocyte membrane protein band 4.1-like 13144929195145052723Rat
1311066Aar2AAR2 splicing factor3145057368145079838Rat
41205609LOC120101765uncharacterized LOC1201017653145082290145082766Rat
41314027LOC120101766uncharacterized LOC1201017663145084166145084774Rat
708350Dlgap4DLG associated protein 43145124189145271791Rat
9238136LOC103691945uncharacterized LOC1036919453145223628145230600Rat
1311235Myl9myosin light chain 93145281943145288333Rat
7616921LOC102551821uncharacterized LOC1025518213145300178145310983Rat
41398160LOC120101767uncharacterized LOC1201017673145322745145333091Rat
1560115Tgif2TGFB-induced factor homeobox 23145333152145348599Rat
1307752Rab5ifRAB5 interacting factor3145357990145368012Rat
1562071Sla2Src-like-adaptor 23145367070145383586Rat
41400309Ndrg3-ps1NDRG family member 3, pseudogene 13145470533145506438Rat
41265125LOC120101769protein NDRG3-like3145508996145544082Rat
41037735LOC120101770protein NDRG3-like3145548032145584913Rat
1359424Ndrg3NDRG family member 33145587505145650896Rat
7523536Rps2-ps10ribosomal protein S2, pseudogene 103145652737145653710Rat
1565179Dsn1DSN1 component of MIS12 kinetochore complex3145652741145668025Rat
1563627Mtcl2microtubule crosslinking factor 23145669102145741578Rat
1561343Tldc2TBC/LysM-associated domain containing 23145742381145758847Rat
1308369Samhd1SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 13145761549145794420Rat
1595511Rbl1RB transcriptional corepressor like 13145806160145869434Rat
11469368LOC10835054560S ribosomal protein L34 pseudogene3145838414145840322Rat
41181263LOC120101995U7 small nuclear RNA3145873716145873780Rat
2321481Mroh8maestro heat-like repeat family member 83145873995145942439Rat
62075Rpn2ribophorin II3145941787145989271Rat
61883Ghrhgrowth hormone releasing hormone3145992762146012528Rat
1561447Manbalmannosidase beta like3146035082146064676Rat
11400670LOC108350508uncharacterized LOC1083505083146086851146091815Rat
620795SrcSRC proto-oncogene, non-receptor tyrosine kinase3146091969146139492Rat
621666BlcapBLCAP, apoptosis inducing factor3146222699146232859Rat
620155Nnatneuronatin3146225941146228868Rat
11479204LOC108350620uncharacterized LOC1083506203146304258146306205Rat
40999503LOC120101772uncharacterized LOC1201017723146327117146346813Rat
1563558Ctnnbl1catenin, beta like 13146387940146548987Rat
41257292Mpc1l-ps3mitochondrial pyruvate carrier 1-like, pseudogene 33146410248146410689Rat
1305725Vstm2lV-set and transmembrane domain containing 2 like3146571099146600930Rat
1562582Tti1TELO2 interacting protein 13146639048146682945Rat
1304782Rprd1bregulation of nuclear pre-mRNA domain containing 1B3146682975146729251Rat
11491028LOC108350509uncharacterized LOC1083505093146732293146733569Rat
621081Tgm2transglutaminase 23146772684146801924Rat
1563354Kiaa1755KIAA1755 ortholog3146850558146884238Rat
1303179Bpibactericidal/permeability-increasing protein3146909626146936487Rat
61865Lbplipopolysaccharide binding protein3146953889146981032Rat
1591715Dctn5-ps1dynactin subunit 5, pseudogene 13146998786146999477Rat
2322428Hnrnpa1-ps15heterogeneous nuclear ribonucleoprotein A1, pseudogene 153147001731147003445Rat
6492401LOC100911534uncharacterized LOC1009115343147013654147019523Rat
41327133LOC120101987small nucleolar RNA SNORA713147014315147014444Rat
41397284Snora71asmall nucleolar RNA, H/ACA box 71A3147016197147016322Rat
40927043Snora71csmall nucleolar RNA, H/ACA box 71C3147017736147017867Rat
1563912Snhg11small nucleolar RNA host gene 113147031367147037043Rat
41024476Snora71esmall nucleolar RNA, H/ACA box 71E3147033814147033947Rat
41074242Snora60small nucleolar RNA, H/ACA box 603147035279147035411Rat
1306861RalgapbRal GTPase activating protein non-catalytic subunit beta3147062443147152090Rat
2320953Adigadipogenin3147155079147160412Rat
1562428Arhgap40Rho GTPase activating protein 403147165781147206552Rat
41382617LOC120102121U4 spliceosomal RNA3147218608147218749Rat
41345674LOC120101470uncharacterized LOC1201014703147223601147227747Rat
41047500LOC120101774uncharacterized LOC1201017743147240764147244923Rat
621402Slc32a1solute carrier family 32 member 13147267373147271842Rat
1307958Actr5actin related protein 53147282461147295870Rat
1589460Ppp1r16bprotein phosphatase 1, regulatory subunit 16B3147323652147419658Rat
41018012LOC12010177560S ribosomal protein L13-like3147355340147355972Rat
1565583Fam83dfamily with sequence similarity 83, member D3147421941147441211Rat
1311165Dhx35DEAH-box helicase 353147450178147507473Rat
11452066LOC108350510uncharacterized LOC1083505103147754670147769849Rat
40940482LOC120102066small nucleolar RNA SNORA173147810531147810653Rat
7562811LOC102550519uncharacterized LOC1025505193148173363148183141Rat
1589409Bzw1-ps1basic leucine zipper and W2 domains 1, pseudogene 13148537465148539596Rat
41362151LOC120102133U6 spliceosomal RNA3148766711148766817Rat
9249256LOC103691947uncharacterized LOC1036919473148928870149001316Rat
2982MafbMAF bZIP transcription factor B3148998111149000031Rat
7523161LOC102550814uncharacterized LOC1025508143149024496149036479Rat
7526217LOC102550898uncharacterized LOC1025508983149197582149204111Rat
7578813LOC102550999uncharacterized LOC1025509993149214619149276915Rat
9450932LOC103691948uncharacterized LOC1036919483149283224149290405Rat
621246Top1DNA topoisomerase I3149293469149376618Rat
7588290LOC102551164uncharacterized LOC1025511643149376458149385570Rat
3347Plcg1phospholipase C, gamma 13149385587149416330Rat
631431Zhx3zinc fingers and homeoboxes 33149417787149548671Rat
1588534Lpin3lipin 33149533719149558494Rat
1309607Emilin3elastin microfibril interfacer 33149558785149564785Rat
1310465Chd6chromodomain helicase DNA binding protein 63149596509149757765Rat
41102028LOC120102052small nucleolar RNA SNORA173149644352149644484Rat
11488586LOC108350515uncharacterized LOC1083505153149771791149807094Rat
40932337LOC120101777uncharacterized LOC1201017773150167127150174708Rat
1309653Ptprtprotein tyrosine phosphatase, receptor type, T3150189343151288145Rat
40961177LOC120101926uncharacterized LOC1201019263151060130151070987Rat
41321799LOC120101925uncharacterized LOC1201019253151286340151298063Rat
7599447LOC102547303uncharacterized LOC1025473033151346470151358385Rat
41289034LOC120102062small nucleolar RNA SNORA173151394507151394629Rat
11516994LOC108350621uncharacterized LOC1083506213151538876151540615Rat
1588363Rpl28-ps6ribosomal protein L28, pseudogene 63151557942151558349Rat
2318122Coa6-ps1cytochrome c oxidase assembly factor 6, pseudogene 13151583826151584063Rat
1359241Srsf6serine and arginine rich splicing factor 63151589546151594869Rat
1307316L3mbtl1L3MBTL histone methyl-lysine binding protein 13151597903151633657Rat
620232Sgk2serum/glucocorticoid regulated kinase 23151644102151669480Rat
41300955LOC120101778uncharacterized LOC1201017783151663565151672463Rat
1311004Ift52intraflagellar transport 523151672505151696975Rat
1308474Mybl2MYB proto-oncogene like 23151705254151733714Rat
41081803LOC1201019315S ribosomal RNA3151710338151710456Rat
1306224Gtsf1lgametocyte specific factor 1-like3151736020151738715Rat
735184Tox2TOX high mobility group box family member 23151853294151980086Rat
1305196Jph2junctophilin 23151994768152058941Rat
1303142Oser1oxidative stress responsive serine-rich 13152066975152085180Rat
41068047LOC120101779uncharacterized LOC1201017793152106514152109928Rat
1304960Gdap1l1ganglioside-induced differentiation-associated protein 1-like 13152110225152129693Rat
1307696Fitm2fat storage-inducing transmembrane protein 23152141346152147858Rat
9451115LOC103691964uncharacterized LOC1036919643152147833152150973Rat
7517936LOC102548241uncharacterized LOC1025482413152163163152195866Rat
1305296R3hdmlR3H domain containing-like3152171382152182151Rat
2810Hnf4ahepatocyte nuclear factor 4, alpha3152186787152248320Rat
41259414LOC120101780uncharacterized LOC1201017803152208294152216446Rat
1588362Atp5mc2-ps4ATP synthase membrane subunit c locus 2, pseudogene 43152271942152273241Rat
1305754Ttpalalpha tocopherol transfer protein like3152278246152296550Rat
1308390Serinc3serine incorporator 33152301882152321327Rat
628775PkigcAMP-dependent protein kinase inhibitor gamma3152330477152398085Rat
2031Adaadenosine deaminase3152398745152422854Rat
41063594LOC120101472uncharacterized LOC1201014723152453710152455392Rat
41301916LOC120101781uncharacterized LOC1201017813152459032152476353Rat
621867Ccn5cellular communication network factor 53152491247152502639Rat
619733Kcnk15potassium two pore domain channel subfamily K member 153152515237152521455Rat
628695Rims4regulating synaptic membrane exocytosis 43152520982152585070Rat
41175933LOC120102044small nucleolar RNA SNORA173152555953152556082Rat
61998Ywhabtyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta3152659663152682105Rat
1563142Pabpc1lpoly(A) binding protein, cytoplasmic 1-like3152692825152725997Rat
1309029Tomm34translocase of outer mitochondrial membrane 343152729345152746295Rat
1312035Stk4serine/threonine kinase 43152745958152827747Rat
621524Kcns1potassium voltage-gated channel, modifier subfamily S, member 13152835642152843032Rat
1304986Wfdc5WAP four-disulfide core domain 53152849025152854868Rat
1303229Wfdc12WAP four-disulfide core domain 123152861461152862784Rat
11381365LOC108350520uncharacterized LOC1083505203152861663152870845Rat
1303026Wfdc15aWAP four-disulfide core domain 15A3152873311152874619Rat
1303042Wfdc15bWAP four-disulfide core domain 15B3152889453152899392Rat
3790Semg1semenogelin 13152910033152912882Rat
1564090Svs3bseminal vesicle secretory protein 3B3152929645152931919Rat
3791Svs4seminal vesicle secretory protein 43152948264152950499Rat
708390Svs3aseminal vesicle secretory protein 3A3152961706152963922Rat
1311054Svs6seminal vesicle secretory protein 63152978315152979986Rat
620290Svs5seminal vesicle secretory protein 53152996146152997756Rat
1303102Slpi-ps1secretory leukocyte peptidase inhibitor, pseudogene 13153019109153021371Rat
1302977Slpi-ps2secretory leukocyte peptidase inhibitor, pseudogene 23153056907153061611Rat
621768Slpisecretory leukocyte peptidase inhibitor3153082208153084457Rat
41115206LOC120101783uncharacterized LOC1201017833153092264153099459Rat
1309732Matn4matrilin 43153120605153135628Rat
1304786Rbpjlrecombination signal binding protein for immunoglobulin kappa J region-like3153134044153147421Rat
3650Sdc4syndecan 43153154888153173576Rat
1583224Sys1Sys1 golgi trafficking protein3153191061153195463Rat
1561934Tp53tg5TP53 target 53153200792153204337Rat
1559521Dbndd2dysbindin domain containing 23153216300153220651Rat
1307156Pigtphosphatidylinositol glycan anchor biosynthesis, class T3153227749153236922Rat
41388601LOC120101784uncharacterized LOC1201017843153247096153253177Rat
1309998Bola2-ps4bolA family member 2, pseudogene 43153272435153272781Rat
628757Wfdc2WAP four-disulfide core domain 23153286946153314832Rat
1597746Spint3serine peptidase inhibitor, Kunitz type, 33153293969153296717Rat
1597730Wfdc6aWAP four-disulfide core domain 6A3153305336153309144Rat
1597722Eppinepididymal peptidase inhibitor3153312396153319310Rat
1597713Wfdc8WAP four-disulfide core domain 83153323503153339849Rat
1303277Wfdc6bWAP four-disulfide core domain 6B3153339051153346940Rat
2324115Cmpk1-ps1cytidine/uridine monophosphate kinase 1, pseudogene 13153348087153348802Rat
41020389LOC120102050small nucleolar RNA SNORA173153355849153355965Rat
1596495Wfdc16WAP four-disulfide core domain 163153366913153370083Rat
1303087Wfdc9WAP four-disulfide core domain 93153380554153389055Rat
1596480Wfdc10aWAP four-disulfide core domain 10A3153390067153391420Rat
1596469Wfdc11WAP four-disulfide core domain 113153397585153406407Rat
11440643LOC10835057360S ribosomal protein L21 pseudogene3153406853153407451Rat
2319575Wfdc13WAP four-disulfide core domain 133153419553153421306Rat
2319289Spint4serine peptidase inhibitor, Kunitz type 43153430633153432821Rat
1302989Spint5pserine peptidase inhibitor, Kunitz type 53153449161153450953Rat
11423236LOC10835062260S ribosomal protein L13 pseudogene3153462786153463422Rat
1305295Wfdc3WAP four-disulfide core domain 33153464862153478952Rat
621627Dnttip1deoxynucleotidyltransferase, terminal, interacting protein 13153481718153505403Rat
1305382Ube2cubiquitin-conjugating enzyme E2C3153506636153509036Rat
1311973Tnnc2troponin C2, fast skeletal type3153513272153516033Rat
2323753Snx21sorting nexin family member 213153522474153532235Rat
70368Acot8acyl-CoA thioesterase 83153531192153542851Rat
1309789Zswim3zinc finger, SWIM-type containing 33153542741153558022Rat
1305715Zswim1zinc finger, SWIM-type containing 13153559104153562821Rat
1564523Spata25spermatogenesis associated 253153562479153566508Rat
1306409Neurl2neuralized E3 ubiquitin protein ligase 23153566659153569380Rat
1309070Ctsacathepsin A3153569106153574983Rat
1306695Pltpphospholipid transfer protein3153574825153592647Rat
1310800Pcif1phosphorylated CTD interacting factor 13153614147153627079Rat
9275514Pcif1l1phosphorylated CTD interacting factor 1 like 13153615149153615604Rat
628751Zfp335zinc finger protein 3353153618587153648213Rat
621320Mmp9matrix metallopeptidase 93153684158153692118Rat
620811Slc12a5solute carrier family 12 member 53153696517153735801Rat
11384587LOC108350521uncharacterized LOC1083505213153702015153703512Rat
1307702Ncoa5nuclear receptor coactivator 53153736420153769838Rat
41004453LOC120101785uncharacterized LOC1201017853153769706153778971Rat
619830Cd40CD40 molecule3153790372153805279Rat
2321Cdh22cadherin 223153845563153970630Rat
1311250Slc35c2solute carrier family 35 member C23154012262154023549Rat
1305784Elmo2engulfment and cell motility 23154023661154061259Rat
2318893Zfp663zinc finger protein 6633154084553154102521Rat
1592574Zfp334zinc finger protein 3343154112537154125087Rat
1308620Ocstamposteoclast stimulatory transmembrane protein3154131113154141611Rat
628786Slc13a3solute carrier family 13 member 33154141878154204604Rat
1591394Tp53rkaTp53 tumor protein p53 regulating kinase A3154219672154224841Rat
1306552Slc2a10solute carrier family 2 member 103154240395154252690Rat
41277354LOC120101927uncharacterized LOC1201019273154311068154317225Rat
620096Eya2EYA transcriptional coactivator and phosphatase 23154335598154519006Rat
1309544Zmynd8zinc finger, MYND-type containing 83154528917154629532Rat
40927946LOC120101928uncharacterized LOC1201019283154643003154645106Rat
6500902LOC100909912uncharacterized LOC1009099123154734556154738516Rat
620109Ncoa3nuclear receptor coactivator 33154738566154821395Rat
1305078Sulf2sulfatase 23154822079154904566Rat
41256047LOC120101930uncharacterized LOC1201019303154883783154884962Rat
41037570LOC120101786uncharacterized LOC1201017863154949768154955237Rat
11428843LOC108350523uncharacterized LOC1083505233154990008155001468Rat
11410735LOC108350623small nuclear ribonucleoprotein F-like3155116497155116945Rat
7706860LOC102551879uncharacterized LOC1025518793155188063155193426Rat
1306534Prex1phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 13155306950155456688Rat
40987626Rnu6-760RNA, U6 small nuclear 7603155442281155442387Rat
1304911Tp53rkbtumor protein p53 regulating kinase B3155529298155532662Rat
631430Arfgef2ADP ribosylation factor guanine nucleotide exchange factor 23155547504155633652Rat
1307536Cse1lchromosome segregation 1 like3155641104155678866Rat
621778Stau1staufen double-stranded RNA binding protein 13155680000155725969Rat
11455577LOC108350624uncharacterized LOC1083506243155730671155738660Rat
1305634Ddx27DEAD-box helicase 273155744182155763380Rat
1306344Znfx1zinc finger, NFX1-type containing 13155764073155791777Rat
6494811LOC100911177uncharacterized LOC1009111773155792295155794886Rat
41171735Snord12csmall nucleolar RNA, C/D box 12C3155792525155792616Rat
40949806Snord12small nucleolar RNA, C/D box 123155794227155794317Rat
2954Kcnb1potassium voltage-gated channel subfamily B member 13155820255155913383Rat
3438Ptgisprostaglandin I2 synthase3155928564155964228Rat
1587812Rpl38-ps9ribosomal protein L38, pseudogene 93155980667155981020Rat
1310062B4galt5beta-1,4-galactosyltransferase 53156018056156033983Rat
41333938LOC120101788uncharacterized LOC1201017883156111384156129567Rat
41053495LOC120101999small nucleolar RNA SNORD223156137391156137513Rat
1308193Slc9a8solute carrier family 9 member A83156147855156198497Rat
620754Spata2spermatogenesis associated 23156202962156213283Rat
1303139Rnf114ring finger protein 1143156222487156234263Rat
620758Snai1snail family transcriptional repressor 13156248479156252969Rat
41024070LOC120101789uncharacterized LOC1201017893156293328156302959Rat
9266805LOC103691970uncharacterized LOC1036919703156306274156320301Rat
1305503Ube2v1ubiquitin conjugating enzyme E2 V13156317339156340198Rat
1309093Peds1plasmanylethanolamine desaturase 13156350135156369309Rat
41243497LOC120101790uncharacterized LOC1201017903156381035156386145Rat
2327CebpbCCAAT/enhancer binding protein beta3156398035156399466Rat
41390385LOC120101791uncharacterized LOC1201017913156476679156486008Rat
61965Ptpn1protein tyrosine phosphatase, non-receptor type 13156638811156687503Rat
1587669Ripor3RIPOR family member 33156687253156760524Rat
1308205Pard6bpar-6 family cell polarity regulator beta3156790540156811620Rat
7538602LOC102553156uncharacterized LOC1025531563156872879156873703Rat
7729081LOC102553092uncharacterized LOC1025530923156880762156882779Rat
71030Adnpactivity-dependent neuroprotector homeobox3156886921156921500Rat
1310120Dpm1dolichyl-phosphate mannosyltransferase subunit 1, catalytic3156919979156939522Rat
1307044Mocs3molybdenum cofactor synthesis 33156939763156941723Rat
631416Kcng1potassium voltage-gated channel modifier subfamily G member 13156960717156992877Rat
41400128LOC120101792uncharacterized LOC1201017923157046519157072830Rat
7710370LOC102554533uncharacterized LOC1025545333157193584157198233Rat
1307690Nfatc2nuclear factor of activated T-cells 23157195970157328640Rat
7683257LOC102554478uncharacterized LOC1025544783157324455157329119Rat
621421Atp9aATPase phospholipid transporting 9A (putative)3157360354157467628Rat
1597672Sall4spalt-like transcription factor 43157474067157491055Rat
41346936LOC120102059small nucleolar RNA SNORA173157621381157621508Rat
1309760Zfp93zinc finger protein 933157633211157654236Rat
1307948Zfp64zinc finger protein 643157666819157695774Rat
9110674LOC103691973uncharacterized LOC1036919733157729291157733784Rat
41244792LOC120101795uncharacterized LOC1201017953157750967157754157Rat
41115352LOC120101796uncharacterized LOC1201017963157963311157966275Rat
11383205LOC108350529uncharacterized LOC1083505293157997701158018156Rat
41064579LOC120101797uncharacterized LOC1201017973158065500158074798Rat
41192048LOC120101798uncharacterized LOC1201017983158080398158091573Rat
7744145LOC102555272uncharacterized LOC1025552723158173585158183177Rat
7550390LOC102555336uncharacterized LOC1025553363158184293158198409Rat
9197892LOC103691976uncharacterized LOC1036919763158212159158224699Rat
7678978LOC102555601uncharacterized LOC1025556013158276872158297268Rat
41299165LOC120101799uncharacterized LOC1201017993158289636158293611Rat
11491213LOC108350530uncharacterized LOC1083505303158297488158306485Rat
9290003LOC103691977uncharacterized LOC1036919773158395987158406402Rat
6490867Tshz2teashirt zinc finger homeobox 23158405469158666915Rat
7593399LOC102556304uncharacterized LOC1025563043158469505158477070Rat
41331986LOC120101800uncharacterized LOC1201018003158501059158512927Rat
41172582LOC120101801uncharacterized LOC1201018013158735442158744966Rat
41300298LOC120101802uncharacterized LOC1201018023158852835158858001Rat
1308451Zfp217zinc finger protein 2173158890464158931148Rat
41271408LOC120102108U2 spliceosomal RNA3158925769158925972Rat
11452902LOC108350531uncharacterized LOC1083505313158959041158969146Rat
7685764LOC102547159uncharacterized LOC1025471593159021085159033695Rat
41254347LOC120101473uncharacterized LOC1201014733159041850159044575Rat
41054110LOC120101803uncharacterized LOC1201018033159099211159103562Rat
628644Bcas1brain enriched myelin associated protein 13159136077159219072Rat
40937752Rps23-ps5ribosomal protein S23, pseudogene 53159137524159138024Rat
41225616LOC120101805uncharacterized LOC1201018053159149220159164695Rat
2462Cyp24a1cytochrome P450, family 24, subfamily a, polypeptide 13159275947159290383Rat
2324021Pfdn4prefoldin subunit 43159303173159311221Rat
41161701LOC120101807uncharacterized LOC1201018073159427661159430526Rat
41063718LOC120101806uncharacterized LOC1201018063159431516159435707Rat
41241031LOC120101808uncharacterized LOC1201018083159432076159435278Rat
1562846Dok5docking protein 53159515886159652811Rat
7497111LOC102552784uncharacterized LOC1025527843159656411159663132Rat
11445730LOC108350532uncharacterized LOC1083505323159804025159818898Rat
7603413LOC102557230uncharacterized LOC1025572303159891981159922501Rat
41293147LOC120101809uncharacterized LOC1201018093159922502159923329Rat
7559980LOC102552273uncharacterized LOC1025522733159952069159955323Rat
7647918LOC102552372uncharacterized LOC1025523723159988001160011215Rat
41358041LOC120101810uncharacterized LOC1201018103160176231160182446Rat
40963483LOC120101474uncharacterized LOC1201014743160291927160295151Rat
11358065LOC108350533uncharacterized LOC1083505333160358656160398067Rat
41328089LOC120101811uncharacterized LOC1201018113160395523160397395Rat
41308635LOC120101812uncharacterized LOC1201018123160400655160428412Rat
41305630LOC120101475uncharacterized LOC1201014753160489808160500414Rat
9419535LOC103691983uncharacterized LOC1036919833160583625160590797Rat
41195593LOC120101813uncharacterized LOC1201018133160729623160732726Rat
40936439LOC120101814uncharacterized LOC1201018143160746754160750295Rat
1589642Cbln4cerebellin 4 precursor3160799587160807143Rat
3056Mc3rmelanocortin 3 receptor3161016347161017444Rat
7628126