AU047753 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU047753

Symbol: AU047753
Previously known as:
RGD ID: 5067194
Expected Size: 0 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21951,607,665 - 51,607,864 (+)MAPPERmRatBN7.2
mRatBN7.21951,585,889 - 51,586,086 (+)MAPPERmRatBN7.2
mRatBN7.21168,383,983 - 168,384,025 (-)MAPPERmRatBN7.2
mRatBN7.21390,826,441 - 90,826,472 (-)MAPPERmRatBN7.2
mRatBN7.27127,189,592 - 127,189,623 (-)MAPPERmRatBN7.2
mRatBN7.21951,584,129 - 51,584,326 (+)MAPPERmRatBN7.2
mRatBN7.21951,582,374 - 51,582,573 (+)MAPPERmRatBN7.2
mRatBN7.21951,580,617 - 51,580,816 (+)MAPPERmRatBN7.2
mRatBN7.21951,588,303 - 51,588,500 (+)MAPPERmRatBN7.2
mRatBN7.21951,578,857 - 51,579,054 (+)MAPPERmRatBN7.2
mRatBN7.21951,577,097 - 51,577,294 (+)MAPPERmRatBN7.2
mRatBN7.21951,602,391 - 51,602,590 (+)MAPPERmRatBN7.2
mRatBN7.21951,597,107 - 51,597,306 (+)MAPPERmRatBN7.2
mRatBN7.21951,605,911 - 51,606,108 (+)MAPPERmRatBN7.2
mRatBN7.21951,600,629 - 51,600,826 (+)MAPPERmRatBN7.2
mRatBN7.21951,598,869 - 51,599,066 (+)MAPPERmRatBN7.2
mRatBN7.21951,595,347 - 51,595,544 (+)MAPPERmRatBN7.2
mRatBN7.21951,591,823 - 51,592,020 (+)MAPPERmRatBN7.2
mRatBN7.21951,590,063 - 51,590,260 (+)MAPPERmRatBN7.2
Rnor_6.01956,338,084 - 56,338,289NCBIRnor6.0
Celera1950,804,914 - 50,805,105UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTCCTGCCTCCTGCTAAGG
Reverse Primer ACAGGTAGACAGGCCCCCTAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562635Smyd3SET and MYND domain containing 3139070926391266209Rat
41093667LOC1200987185S ribosomal RNA195160303751603155Rat
41264674LOC1200986725S ribosomal RNA195158477351584891Rat
41366977LOC1200987485S ribosomal RNA195158302051583138Rat
41190846LOC1200987115S ribosomal RNA195159246751592585Rat
41367669Rna5s7RNA, 5S ribosomal 7195159951351599631Rat
41162948LOC1200987175S ribosomal RNA195157774151577859Rat
41011831LOC1200987195S ribosomal RNA195160479551604913Rat
40984105Rna5s13RNA, 5S ribosomal 13195158126351581381Rat
41226032LOC1200987125S ribosomal RNA195159423151594349Rat
41016926LOC1200987165S ribosomal RNA195160127351601391Rat
41019155Rna5s6RNA, 5S ribosomal 6195157950151579619Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)135236217197362171Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1356056920101056920Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
8655959Pur32Proteinuria QTL 328.4urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)137402391897213863Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1374862117101339893Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1380753256106807694Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
1354582Stl11Serum triglyceride level QTL 113.42blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7119513385135012528Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
634315Niddm45Non-insulin dependent diabetes mellitus QTL 457.16blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1144267916172949660Rat
61379Bp44Blood pressure QTL 4419.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144267916174133260Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
1582204Livw1Liver weight QTL 13.60.0003liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)1155422851172949803Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
631548Bp88Blood pressure QTL 8850.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1156677124176484451Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393213533942Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164747424209747424Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1164747424209747424Rat
737974Bp161Blood pressure QTL 1610.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1164747558181133855Rat
2312558Glom17Glomerulus QTL 173.90.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1166532971191278129Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum insulin level (CMO:0000358)193383821455283146Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat
5135224Leukc1Leukocyte quantity QTL 1eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)194434021455283277Rat
2313395Anxrr26Anxiety related response QTL 26aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)194997648153225766Rat


Additional Information

Database Acc Id Source(s)
UniSTS 110063 UniSTS