PMC145386P1 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: PMC145386P1

Symbol: PMC145386P1
Previously known as: PMC356028P1; 
RGD ID: 5066300
Expected Size: 465 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21211,665,582 - 11,666,047 (+)MAPPERmRatBN7.2
mRatBN7.25120,658,751 - 120,659,093 (+)MAPPERmRatBN7.2
Rnor_6.05125,373,749 - 125,374,090NCBIRnor6.0
Rnor_6.01213,718,314 - 13,718,778NCBIRnor6.0
Rnor_5.01215,748,327 - 15,748,791UniSTSRnor5.0
Rnor_5.05129,231,142 - 129,231,483UniSTSRnor5.0
RGSC_v3.45126,881,786 - 126,882,127UniSTSRGSC3.4
RGSC_v3.41212,049,541 - 12,050,005UniSTSRGSC3.4
Celera1213,454,914 - 13,455,378UniSTS
Celera5119,421,837 - 119,422,178UniSTS
Cytogenetic Map12p11UniSTS
Cytogenetic Map5q34UniSTS
Is Marker For: Genes:   Actb   Actb-ps9  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCTGTGGCATCCATGAAACT
Reverse Primer AACGCAGCTCAGTAACAGTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
628837Actbactin, beta121166311211666697Rat
1584843Actb-ps9actin, beta, pseudogene 95120658714120659243Rat

Nucleotide Sequences
RefSeq Transcripts NM_031144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC063166 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225285 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ226945 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227027 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227201 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228068 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228822 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229293 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231277 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231503 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231691 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232650 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232682 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH615212.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  V01217 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12119611090Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
1331739Hrtrt14Heart rate QTL 143.56232heart pumping trait (VT:2000009)heart rate (CMO:0000002)12931821612829686Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449846669029Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)12960327746669029Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12610757946669029Rat
61331Eau2Experimental allergic uveoretinitis QTL 20.0005uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)12852542328064601Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12129333307Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12123297788Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12719673046669029Rat
1331786Kidm11Kidney mass QTL 113.571kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)121107382524234895Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
1600391Edcs2Endometrial carcinoma susceptibility QTL23.50.01uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)12683319017870186Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121047413746669029Rat
10755457Coatc14Coat color QTL 140.01759coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)12122591684Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382545055165Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6556449546669029Rat
7387292Kidm42Kidney mass QTL 423.030.0004kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)12136247923Rat
1300157Rf21Renal function QTL 214.4renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)12931821632103380Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121047413746669029Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
2293086Iddm30Insulin dependent diabetes mellitus QTL 303.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)12844949028302290Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
1331755Bp219Blood pressure QTL 2193.041arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382528064557Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
1298070Scl18Serum cholesterol level QTL 183.7blood LDL cholesterol amount (VT:0000181)calculated plasma low density lipoprotein cholesterol level (CMO:0001245)579584860124584860Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
1582230Bw78Body weight QTL 783.20.0016epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)5119085612128034027Rat
1331739Hrtrt14Heart rate QTL 143.56232heart pumping trait (VT:2000009)heart rate (CMO:0000002)12931821612829686Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)12960327746669029Rat
61331Eau2Experimental allergic uveoretinitis QTL 20.0005uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)12852542328064601Rat
1598859Cm66Cardiac mass QTL 662heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)579584860124584860Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12123297788Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)597570330136479578Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12719673046669029Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)587468046132468046Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
1600391Edcs2Endometrial carcinoma susceptibility QTL23.50.01uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)12683319017870186Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
10755457Coatc14Coat color QTL 140.01759coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)12122591684Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382545055165Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
1358909Kidm25Kidney mass QTL 251.87kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)590067849128034027Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6556449546669029Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
1300157Rf21Renal function QTL 214.4renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)12931821632103380Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
1298086Bp156Blood pressure QTL 156arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)584132602129132602Rat
2306971Anxrr21Anxiety related response QTL 219.47fear/anxiety-related behavior trait (VT:1000241)number of entries into a discrete space in an experimental apparatus (CMO:0000960)566174080124160948Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121047413746669029Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1358895Bp254Blood pressure QTL 2543.60.0003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)558829236128034027Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
1358889Bp261Blood pressure QTL 2612.86arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)590067849128034027Rat
1331755Bp219Blood pressure QTL 2193.041arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121107382528064557Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12119611090Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
7794739Bp372Blood pressure QTL 3720.0058arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5117913688125222967Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
1331801Rf33Renal function QTL 334.149kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)543726656129132602Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449846669029Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12610757946669029Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12129333307Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12556449546669029Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
1331786Kidm11Kidney mass QTL 113.571kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)121107382524234895Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121047413746669029Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
1598846Bp293Blood pressure QTL 2933.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)579584860124584860Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
7387292Kidm42Kidney mass QTL 423.030.0004kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)12136247923Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)590450144135450144Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12556449546669029Rat
2293086Iddm30Insulin dependent diabetes mellitus QTL 303.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)12844949028302290Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)587765973132765973Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 502977 UniSTS
  81822 UniSTS
UniSTS 270999 UniSTS