BE108794 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BE108794

Symbol: BE108794
Previously known as:
RGD ID: 5064966
Expected Size: 160 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21766,562,451 - 66,562,611 (+)MAPPERmRatBN7.2
mRatBN7.22107,579,316 - 107,579,475 (+)MAPPERmRatBN7.2
Rnor_6.02110,365,999 - 110,366,157NCBIRnor6.0
Rnor_6.01770,213,200 - 70,213,359NCBIRnor6.0
Rnor_5.01771,916,184 - 71,916,343UniSTSRnor5.0
Rnor_5.02130,083,792 - 130,083,950UniSTSRnor5.0
RGSC_v3.42110,422,217 - 110,422,375UniSTSRGSC3.4
RGSC_v3.41777,756,857 - 77,757,016UniSTSRGSC3.4
Celera1766,067,638 - 66,067,797UniSTS
Celera2102,845,580 - 102,845,738UniSTS
RH 3.4 Map17634.9UniSTS
Cytogenetic Map2q24UniSTS
Is Marker For: Genes:   Naaladl2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTATTGGACAACAATGGTGCG
Reverse Primer CCATGGAATTGTAATAGCAGCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1565147Naaladl2N-acetylated alpha-linked acidic dipeptidase-like 22106639146107992218Rat

Nucleotide Sequences
GenBank Nucleotide FQ212375 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172459934069599340Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173583708569599340Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)174207316069599340Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)174207316069599340Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175349882882479847Rat
70210Cm15Cardiac mass QTL 156.5heart right ventricle mass (VT:0007033)heart right ventricle wet weight (CMO:0000072)175724672370156904Rat
1600398Edcs5Endometrial carcinoma susceptibility QTL 52.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)175724672370852846Rat
2302365Gluco40Glucose level QTL 404.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)175724684382046127Rat
7488963Bp369Blood pressure QTL 3690.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)175900564977910000Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)176078142686533673Rat
7411577Bw141Body weight QTL 1410.001body mass (VT:0001259)body weight gain (CMO:0000420)176261951686533673Rat
1300131Bp193Blood pressure QTL 1933.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)176364000973951021Rat
631502Cm26Cardiac mass QTL 263.71heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)176570358081153923Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243162366111362592Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)243162366111362592Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)259134147127460910Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)264366971109366971Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
7411551Bw131Body weight QTL 13129.60.001body mass (VT:0001259)body weight gain (CMO:0000420)267942638112942638Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)280270434125270434Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)281018907126018907Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)282345893130923501Rat
7207808Bmd89Bone mineral density QTL 894.1femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)288862519133862519Rat
2300165Bmd49Bone mineral density QTL 494.80.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)288862519133862519Rat
2300170Bmd45Bone mineral density QTL 4512.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)288862519133862519Rat
2300185Bmd46Bone mineral density QTL 468.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)288862519133862519Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)292337601137337601Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)292337601137337601Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2102803808147803808Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2104559726149559726Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499583 UniSTS
UniSTS 247890 UniSTS