BF396392 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BF396392

Symbol: BF396392
Also known as:
RGD ID: 5061426
Expected Size: 130 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21388,696,278 - 88,696,408 (+)MAPPER
mRatBN7.21388,696,278 - 88,696,408 (-)MAPPER
Rnor_6.01343,843,582 - 43,843,711NCBIRnor6.0
Rnor_6.01394,833,697 - 94,833,826NCBIRnor6.0
Rnor_5.01348,938,547 - 48,938,676UniSTSRnor5.0
Rnor_5.01399,286,752 - 99,286,881UniSTSRnor5.0
RGSC_v3.41392,528,954 - 92,529,083UniSTSRGSC3.4
Celera1388,276,811 - 88,276,940UniSTS
RH 3.4 Map13593.0UniSTS
Cytogenetic Map13q25UniSTS
Is Marker For: Genes:   Cep170   LOC100909664  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATTGCTTCCTGAGTGAAGGAGG
Reverse Primer AGAAGCCCAGGGATACCAAAGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
68400Cd244CD244 molecule138995909189995993Rat
3309Pfkfb26-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2134741345347440682Rat
3886Tnrtenascin R137760224977678385Rat
2131Apoa2apolipoprotein A2138959687289598805Rat
68957Qsox1quiescin sulfhydryl oxidase 1137342339673460890Rat
3656Selpselectin P138242891482464629Rat
3561Rgs1regulator of G-protein signaling 1136106619661070772Rat
3568Rgs5regulator of G-protein signaling 5138796682088002831Rat
3567Rgs4regulator of G-protein signaling 4138805481788061108Rat
3654Seleselectin E138235523482365323Rat
619880Nme7NME/NM23 family member 7138260784482737383Rat
3862Timm17atranslocase of inner mitochondrial membrane 17A135212464152136127Rat
2622Fmo1flavin containing dimethylaniline monoxygenase 1138071288580745095Rat
2305Cd247Cd247 molecule138399604584071408Rat
2837Hsd17b7hydroxysteroid (17-beta) dehydrogenase 7138828811688308019Rat
67366Pla2g4aphospholipase A2 group IVA136706225267206688Rat
2168Atp1a2ATPase Na+/K+ transporting subunit alpha 2139065168290676629Rat
2170Atp1b1ATPase Na+/K+ transporting subunit beta 1138273716182757681Rat
61886Avpr1barginine vasopressin receptor 1B134836730748378831Rat
2235C4bpacomplement component 4 binding protein, alpha134734209047377580Rat
2246Cacna1ecalcium voltage-gated channel subunit alpha1 E137189944572534992Rat
69252Ier5immediate early response 5137274221072744302Rat
61952Atp1a4ATPase Na+/K+ transporting subunit alpha 4139060579290642032Rat
70983Cacna1scalcium voltage-gated channel subunit alpha1 S135288957052964558Rat
61967Mcm6minichromosome maintenance complex component 6134504288245068073Rat
2411CrpC-reactive protein139108044891081358Rat
71005Prdx6peroxiredoxin 6137907756779088113Rat
61822Kcnj10potassium inwardly-rectifying channel, subfamily J, member 10139072294590753338Rat
3109Mpzmyelin protein zero138952420489530070Rat
620055Ppfia4PTPRF interacting protein alpha 4135113483151183321Rat
3882Tnnt2troponin T2, cardiac type135266297452680992Rat
2048Adora1adenosine A1 receptor135104211151076913Rat
2710Glulglutamate-ammonia ligase137133105271340207Rat
62053Csrp1cysteine and glycine-rich protein 1135255384352575054Rat
621665Rgs2regulator of G-protein signaling 2136084645860849061Rat
628851Tor1aip1torsin 1A interacting protein 1137367064973704668Rat
620287Mybphmyosin binding protein H135103422851041903Rat
71088Niban1niban apoptosis regulator 1136894966569101600Rat
708450Adcy10adenylate cyclase 10138370195283787010Rat
727846Zp3rzona pellucida 3 receptor134728637547331213Rat
727850Kiss1KiSS-1 metastasis-suppressor135052950650537603Rat
620651Cd55CD55 molecule (Cromer blood group)134712515647153557Rat
619816Tnfsf4TNF superfamily member 4137926997379293775Rat
727933Rnaselribonuclease L137118871271202636Rat
2446Ctsecathepsin E134842683348449493Rat
621689Pou2f1POU class 2 homeobox 1138407531684217368Rat
2886Il10interleukin 10134773893347743392Rat
621167Dars1aspartyl-tRNA synthetase 1134507406745127815Rat
620046Rxrgretinoid X receptor gamma138581847385868555Rat
2599Fcer1gFc fragment of IgE receptor Ig138960189489606326Rat
621123Ptprvprotein tyrosine phosphatase, receptor type, V135193523951956262Rat
628835Gpr37l1G protein-coupled receptor 37-like 1135198569851992547Rat
3804Syt2synaptotagmin 2135156924851577824Rat
3821Cntn2contactin 2134928091349314061Rat
620430Myocmyocilin138051753180527928Rat
621400Nr1i3nuclear receptor subfamily 1, group I, member 3138958507289591278Rat
708516Ptpn7protein tyrosine phosphatase, non-receptor type 7135195802351971431Rat
628717Klhl12kelch-like family member 12135128093351314753Rat
621162Cep350centrosomal protein 350137349971573637707Rat
68322Apcsamyloid P component, serum139142662191427417Rat
620610Kmokynurenine 3-monooxygenase139368432493715378Rat
619761Fmo3flavin containing dimethylaniline monoxygenase 3138083741880856214Rat
2597Fcer1aFc fragment of IgE receptor Ia139172725391737106Rat
620461Nphs2NPHS2 stomatin family member, podocin137392913673941522Rat
620465Cxcr4C-X-C motif chemokine receptor 4134531495245318856Rat
708421Brinp3BMP/retinoic acid inducible neural specific 3136352648663959390Rat
620742Uck2uridine-cytidine kinase 2138537671685443976Rat
621641Soat1sterol O-acyltransferase 1137403525874077759Rat
620106Nos1apnitric oxide synthase 1 adaptor protein138865312388943976Rat
621658Sec16bSEC16 homolog B, endoplasmic reticulum export factor137515307475216941Rat
621694Rassf5Ras association domain family member 5134795675448022333Rat
631418Ncstnnicastrin139045104690467256Rat
620974Usf1upstream transcription factor 1138979775089805561Rat
620993Nucks1nuclear casein kinase and cyclin-dependent kinase substrate 1134867972648709663Rat
68353Nr5a2nuclear receptor subfamily 5, group A, member 2135375047053870288Rat
621137Rnpeparginyl aminopeptidase135209286352124006Rat
628884Prrx1paired related homeobox 1138114703881215559Rat
727956Lhx9LIM homeobox 9135585454355879305Rat
620428Cfhcomplement factor H135697915557080540Rat
620432Myogmyogenin135112645951129048Rat
621484Il24interleukin 24134761845147623849Rat
621765Tnni1troponin I1, slow skeletal type135262485652637297Rat
620911Nfascneurofascin134933540749522474Rat
619855Ddr2discoidin domain receptor tyrosine kinase 2138831163988436561Rat
68375Dusp12dual specificity phosphatase 12138925830989267402Rat
1303146Cacybpcalcyclin binding protein137794877177959089Rat
1304916Optcopticin135073550950748908Rat
621440Kcnj9potassium inwardly-rectifying channel, subfamily J, member 9139070304690710148Rat
1306711Gpa33glycoprotein A33138433459884368154Rat
621549Gas5growth arrest specific 5137885252378855844Rat
621842F11rF11 receptor138982627289850151Rat
621242Adamts4ADAM metallopeptidase with thrombospondin type 1 motif, 4138962299689632485Rat
727949Dnm3dynamin 3137990671180379967Rat
620620Cd48Cd48 molecule139011660190140371Rat
3277Pdcphosducin136754543067558600Rat
727821Nit1nitrilase 1138972237089725806Rat
1303067Fcgr3aFc fragment of IgG receptor IIIa138938577589396047Rat
735051Dstykdual serine/threonine and tyrosine protein kinase134919532549243327Rat
735059Tor1aip2torsin 1A interacting protein 2137370408873735339Rat
2236C4bpbcomplement component 4 binding protein, beta134738717347398115Rat
735185SucoSUN domain containing ossification factor137973648579801133Rat
621305Atp2b4ATPase plasma membrane Ca2+ transporting 4135009164450153808Rat
2614Fhfumarate hydratase139365148693677371Rat
61915Stx6syntaxin 6137280421872850757Rat
620349Ptgs2prostaglandin-endoperoxide synthase 2136735123067356920Rat
620868Acmsdaminocarboxymuconate semialdehyde decarboxylase134442468944468734Rat
735067Rgsl2hregulator of G-protein signaling like 2 homolog (mouse)137128141071282417Rat
620874Chi3l1chitinase 3 like 1135102284451030797Rat
3655Sellselectin L138236982082387774Rat
68409Aldh9a1aldehyde dehydrogenase 9 family, member A1138558082885597497Rat
620226Prelpproline and arginine rich end leucine rich repeat protein135074952650773934Rat
620823Lctlactase134499841445040593Rat
631362Mapkapk2MAPK activated protein kinase 2134778515747871684Rat
71041Pigmphosphatidylinositol glycan anchor biosynthesis, class M139075926090762957Rat
1304635Atp6v1g3ATPase H+ transporting V1 subunit G3135526579455288651Rat
1304566Igsf9immunoglobulin superfamily, member 9139080945990832300Rat
628600Fmo2flavin containing dimethylaniline monoxygenase 2138075252680775264Rat
735074Kcnt2potassium sodium-activated channel subfamily T member 2135713085557520263Rat
621052Lamc1laminin subunit gamma 1137065672770783515Rat
621053Lamc2laminin subunit gamma 2137056664370632126Rat
3880FaslgFas ligand137969681179717581Rat
3571Rgs8regulator of G-protein signaling 8137108665471141820Rat
1306263Slamf8SLAM family member 8139096786290978752Rat
620892Rab29RAB29, member RAS oncogene family134864457548650229Rat
1307236Lmod1leiomodin 1135214709952189835Rat
1305532Rbbp5RB binding protein 5, histone lysine methyltransferase complex subunit134925030149277152Rat
727799Astn1astrotactin 1137605496576370674Rat
1305083Ro60Ro60, Y RNA binding protein136054689260567882Rat
1304702Colgalt2collagen beta(1-O)galactosyltransferase 2136979755869902916Rat
3328Pigrpolymeric immunoglobulin receptor134756417647592093Rat
3570Rgs7regulator of G-protein signaling 7139309565993534452Rat
3554Renrenin135050272450513953Rat
1306084Cyb5r1cytochrome b5 reductase 1135122969751236447Rat
2225Btg2BTG anti-proliferation factor 2135091318550916944Rat
1304715Rcsd1RCSD domain containing 1138385465083917040Rat
620452Xcl1X-C motif chemokine ligand 1138319940283202845Rat
1305132Klhdc8akelch domain containing 8A134907464449082729Rat
1307497R3hdm1R3H domain containing 1134481256744950762Rat
1305194Spta1spectrin, alpha, erythrocytic 1139226423192340091Rat
1308548Dhx9DExH-box helicase 9137088550370922278Rat
1305646Chit1chitinase 1135094702050994644Rat
1306373Mgst3microsomal glutathione S-transferase 3138560149985622392Rat
620050Dedddeath effector domain-containing138970693289721825Rat
1306055Pea15proliferation and apoptosis adaptor protein 15139057984490589466Rat
1307078Tdrd5tudor domain containing 5137387263773922640Rat
1307331Nmnat2nicotinamide nucleotide adenylyltransferase 2137037934670559311Rat
2968Uhmk1U2AF homology motif kinase 1138852162588536728Rat
1305471Atf6activating transcription factor 6138905345789242531Rat
1306206Kif21bkinesin family member 21B135297650553026750Rat
1305066Tnfsf18TNF superfamily member 18137937841279388687Rat
3451Ptprcprotein tyrosine phosphatase, receptor type, C135506156155174150Rat
1306290Ivns1abpinfluenza virus NS1A binding protein136870297068722472Rat
1307451Ubxn4UBX domain protein 4134495696344989653Rat
1305139Zfp281zinc finger protein 281135353108053534399Rat
1306541Pik3c2bphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta134984893949909404Rat
1306554Xpr1xenotropic and polytropic retrovirus receptor 1137291855273056785Rat
1304773Cop1COP1, E3 ubiquitin ligase137694288377076015Rat
1304784Lmx1aLIM homeobox transcription factor 1 alpha138591675386061534Rat
1305191Kifap3kinesin-associated protein 3138207249782217256Rat
1307566Rasal2RAS protein activator like 2137477055775059298Rat
1308513Dcaf8DDB1 and CUL4 associated factor 8139053215390587542Rat
1304620Rabgap1lRAB GTPase activating protein 1-like137797539278609009Rat
1304622RGD1304622similar to 6820428L09 protein137286031372900020Rat
1307404Serpinc1serpin family C member 1137880610778820375Rat
1305030Acbd6acyl-CoA binding domain containing 6137319650473334077Rat
1306089Mndamyeloid cell nuclear differentiation antigen139207366492091335Rat
1307035Cadm3cell adhesion molecule 3139184231191873126Rat
1306804Creg1cellular repressor of E1A-stimulated genes 1138397218683984675Rat
1306774Tada1transcriptional adaptor 1138458858784602542Rat
1306783Mettl18methyltransferase like 18138229853482300763Rat
1307782RGD1307782similar to Williams-Beuren syndrome critical region protein 27135372099253722037Rat
1305414Uchl5ubiquitin C-terminal hydrolase L5136056810260603812Rat
1306002Tnntenascin N137782938477896831Rat
1305609Shcbp1lSHC binding and spindle associated 1 like137085204470882336Rat
1311500Igsf8immunoglobulin superfamily, member 8139069259090703262Rat
1333906Olr1597olfactory receptor 1597139234225592343196Rat
1309442Vangl2VANGL planar cell polarity protein 2139037920390405627Rat
1333649Olr1586-psolfactory receptor pseudogene 1586139212432892124866Rat
1311611Gpr25G protein-coupled receptor 25135313581553139180Rat
1310525CopaCOPI coat complex subunit alpha139046728590508894Rat
1308947Rgl1ral guanine nucleotide dissociation stimulator,-like 1136990912270174590Rat
1308951Pogkpogo transposable element derived with KRAB domain138460312684619042Rat
1307283Aim2absent in melanoma 2139191983491963080Rat
1309753Vamp4vesicle-associated membrane protein 4138046069980483597Rat
1308441Dennd1bDENN domain containing 1B135601581356242041Rat
1307950Glrx2glutaredoxin 2136052905760552115Rat
1307952Nuf2NUF2 component of NDC80 kinetochore complex138781845687847223Rat
1332837Olr1577-psolfactory receptor pseudogene 1577139158034591580950Rat
1333957Olr1592olfactory receptor 1592139220912992210052Rat
1310504Elk4ETS transcription factor ELK4134878826248813267Rat
1310510Cfhr1complement factor H-related 1135686266656877650Rat
1333184Olr1600olfactory receptor 1600139237691592377844Rat
620100Mgat5alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase134385074444157860Rat
1332648Olr1579olfactory receptor 1579139163772991638661Rat
1332672Olr1593olfactory receptor 1593139222497192225918Rat
1359351LOC289035similar to UDP-N-acetylglucosamine:a-1,3-D-mannoside beta-1,4-N-acetylgluco135121842851225602Rat
1563939Fcrl6Fc receptor-like 6139098281490992415Rat
1332683Olr1591olfactory receptor 1591139219687392197823Rat
1311537Ralgps2Ral GEF with PH domain and SH3 binding motif 2137444600174520640Rat
1312014Lrrc52leucine rich repeat containing 52138567201385695421Rat
1308352Ikbkeinhibitor of nuclear factor kappa B kinase subunit epsilon134803132548056394Rat
71069Fcgr2aFc fragment of IgG receptor IIa139114687891163691Rat
1311868Cenplcentromere protein L137888609278901025Rat
1333702Olr1576olfactory receptor 1576139148146191482390Rat
1310950Camsap2calmodulin regulated spectrin-associated protein family, member 2135314571253225349Rat
1311766Cdc73cell division cycle 73136040377160496511Rat
1310924Dyrk3dual specificity tyrosine phosphorylation regulated kinase 3134790623047916877Rat
1311960Tmcc2transmembrane and coiled-coil domain family 2134913268549169771Rat
1310761Smg7SMG7 nonsense mediated mRNA decay factor137025891970321886Rat
1310816Ube2tubiquitin-conjugating enzyme E2T135179087751801379Rat
1332808Olr1581olfactory receptor 1581139169262791693559Rat
1310441Slc26a9solute carrier family 26 member 9134851241548539467Rat
1310442TiprlTOR signaling pathway regulator138347896683504448Rat
1312041Shisa4shisa family member 4135219398952197205Rat
1311526Eef1aknmteEF1A lysine and N-terminal methyltransferase138042759580441353Rat
1359167Nuak2NUAK family kinase 2134909230649109055Rat
1560672Ccdc190coiled-coil domain containing 190138826533188272906Rat
1309424Ncf2neutrophil cytosolic factor 2137022644170259019Rat
1309432Mrps14mitochondrial ribosomal protein S14137794045477946201Rat
1308992Scyl3SCY1 like pseudokinase 3138223093882255640Rat
1306913Pex19peroxisomal biogenesis factor 19139051432490530825Rat
1310623Sft2d2SFT2 domain containing 2138343863583457899Rat
1332878Olr1594-psolfactory receptor pseudogene 1594139223266892233622Rat
1310261Nhlh1nescient helix loop helix 1139043795690443157Rat
1306522Rgs18regulator of G-protein signaling 18136156438161591139Rat
1308611Slc19a2solute carrier family 19 member 2138255258682566586Rat
1309465Exo1exonuclease 1139393698993962749Rat
1308731Zbtb37zinc finger and BTB domain containing 37137883649178852224Rat
1305945Slamf9SLAM family member 9139083641990856913Rat
1307890Trmt1ltRNA methyltransferase 1-like136878588968819018Rat
1304982Tp53i3tumor protein p53 inducible protein 3137510175975145967Rat
1305491Rnf2ring finger protein 2136882971468859920Rat
1309306Mdm4MDM4 regulator of p53134978677649828780Rat
1309490Klhl20kelch-like family member 20137891236178957226Rat
1309202Dusp23dual specificity phosphatase 23139101867091019862Rat
1309205Ccnt2cyclin T2134447595944516892Rat
1308695Swt1SWT1 RNA endoribonuclease homolog136872826668785800Rat
1309257Olfml2bolfactomedin-like 2B138899530189032487Rat
1310101Tor3atorsin family 3, member A137424650474277694Rat
1309287Ppp1r12bprotein phosphatase 1, regulatory subunit 12B135158360351784641Rat
1307830Odr4odr-4 GPCR localization factor homolog136757890467611605Rat
1305304Etnk2ethanolamine kinase 2135048117850498991Rat
1306938Thsd7bthrombospondin type 1 domain containing 7B134602694346931619Rat
1306487Rab3gap1RAB3 GTPase activating protein catalytic subunit 1134457820844649876Rat
1309104RGD1309104similar to RIKEN cDNA 1700025G04 gene136926564969434447Rat
1309106RGD1309106similar to hypothetical protein137985647979901830Rat
1307176Dptdermatopontin138307330783102404Rat
1309333Maelmaelstrom spermatogenic transposon silencer138441256984452140Rat
1307109Ndufs2NADH:ubiquinone oxidoreductase core subunit S2138960684889623506Rat
1307111Aspmassembly factor for spindle microtubules135654602156591793Rat
1310145Tbx19T-box transcription factor 19138340326383426305Rat
1306176FcrlaFc receptor-like A138929657089306219Rat
1310687Elf3E74 like ETS transcription factor 3135208387352088798Rat
1308286Dars2aspartyl-tRNA synthetase 2 (mitochondrial)137885763878885464Rat
1308290Zc3h11azinc finger CCCH-type containing 11A135019604250234862Rat
1310650Kif14kinesin family member 14135335007353421992Rat
1310652Lad1ladinin 1135264525752659619Rat
1311397Slc41a1solute carrier family 41 member 1134860730848627999Rat
1308341Ly9lymphocyte antigen 9139000277990022346Rat
1305482Lrrn2leucine rich repeat neuronal 2134966035649730275Rat
1310537Ipo9importin 9135220338452256196Rat
1310543Ppoxprotoporphyrinogen oxidase138965009489654998Rat
1308213Pbx1PBX homeobox 1138639074186671460Rat
1310664Tprtranslocated promoter region, nuclear basket protein136761168567672833Rat
1308044Lhx4LIM homeobox 4137334887473400416Rat
1307922Tmem9transmembrane protein 9135285403152871300Rat
1307944Ppp1r15bprotein phosphatase 1, regulatory subunit 15B134993315549940961Rat
1308584Tsen15tRNA splicing endonuclease subunit 15136976509369781019Rat
1309947Crb1crumbs cell polarity complex component 1135627051956462893Rat
1309892Tmem183atransmembrane protein 183A135118464751201401Rat
1309674Sox13SRY-box transcription factor 13135043470250479118Rat
1309523Cdk18cyclin-dependent kinase 18134889352548926673Rat
1307472Pkp1plakophilin 1135270517452753089Rat
1306212Tmem163transmembrane protein 163134416630644345735Rat
1308976Prg4proteoglycan 4136767258867688902Rat
1310840Tagln2transgelin 2139080719690814119Rat
1309764Slc45a3solute carrier family 45, member 3134874585548766283Rat
1564063Pm20d1peptidase M20 domain containing 1134857509448596515Rat
1561908RGD1561908similar to COP9 signalosome complex subunit 8 (JAB1-containing signalosome subunit 8)138236624182366905Rat
1303151Adipor1adiponectin receptor 1135124047051260233Rat
1562617Rab7bRab7b, member RAS oncogene family134845614348483714Rat
1566064Prrc2cproline-rich coiled-coil 2C138054478980614925Rat
1561025Klhdc9kelch domain containing 9138974275089746254Rat
1563749RGD1563749similar to 60S ribosomal protein L29 (P23)138524759085248254Rat
1359726Yod1YOD1 deubiquitinase134744129647443013Rat
1565602Kdm5blysine demethylase 5B135138437151455392Rat
1563245Gpr161G protein-coupled receptor 161138353038983576117Rat
1561765Eif2deukaryotic translation initiation factor 2D134793513847958459Rat
1333784Olr1596olfactory receptor 1596139224975992250724Rat
1561559Cfap45cilia and flagella associated protein 45139090955190932958Rat
1565063RGD1565063RGD1565063135570102255701429Rat
1565940Arl8aADP-ribosylation factor like GTPase 8A135197297451981976Rat
1334338Olr1595olfactory receptor 1595139224130692242253Rat
1564614RGD1564614similar to complement factor H-related protein135688966956958549Rat
1561961Dcaf6DDB1 and CUL4 associated factor 6138357873083680330Rat
1562452Blzf1basic leucine zipper nuclear factor 1138259217082607379Rat
1562462RGD1562462similar to Ifi204 protein139199594092006820Rat
1560008Grem2gremlin 2, DAN family BMP antagonist139289443192988137Rat
1561419Arhgap30Rho GTPase activating protein 30138977476489796113Rat
1563293Becn2beclin 2139397172093974467Rat
708419Brinp2BMP/retinoic acid inducible neural specific 2137594867976049363Rat
1559491Fmo6flavin containing monooxygenase 6138079135580819915Rat
1560634Slamf1signaling lymphocytic activation molecule family member 1139018454590219170Rat
1566016Srgap2SLIT-ROBO Rho GTPase activating protein 2134806528048286888Rat
1566099RGD1566099similar to novel protein135588136655886554Rat
1563679RGD1563679similar to 60S ribosomal protein L7a138534551585354181Rat
628601Fmo4flavin containing dimethylaniline monoxygenase 4138068538580703575Rat
1563422Mpc2mitochondrial pyruvate carrier 2138368052783700491Rat
1561496Edem3ER degradation enhancing alpha-mannosidase like protein 3136913509569197708Rat
1565760Fam163afamily with sequence similarity 163, member A137374167473820114Rat
1561566LOC498231LRRGT00144135024247850261438Rat
1562658Cfap126cilia and flagella associated protein 126138948005889495949Rat
1560256Apobec4apolipoprotein B mRNA editing enzyme catalytic polypeptide like 4137015709870165686Rat
1564952Zranb3zinc finger RANBP2-type containing 3134466137544812430Rat
1561048Itln1intelectin 1138991957089929774Rat
1359331RabifRAB interacting factor135131747651330536Rat
1562006Tomm40ltranslocase of outer mitochondrial membrane 40 like138959007689595287Rat
1564106Mettl11bmethyltransferase like 11B138198787782027781Rat
1332986Olr1601olfactory receptor 1601139241261292413565Rat
1311153Ankrd45ankyrin repeat domain 45137897357879000356Rat
1310502Phlda3pleckstrin homology-like domain, family A, member 3135258891752592002Rat
1311668F13bcoagulation factor XIII B chain135659889156623132Rat
1549702NplN-acetylneuraminate pyruvate lyase137093807370981179Rat
1309708Ccdc181coiled-coil domain containing 181138257498082588637Rat
1334126Olr1578-psolfactory receptor pseudogene 1578139159567091596209Rat
1332994Olr1590olfactory receptor 1590139217692192177868Rat
1359282FcmrFc fragment of IgM receptor134760270147617065Rat
1333597Olr1588olfactory receptor 1588139214375192147738Rat
1311337Pigcphosphatidylinositol glycan anchor biosynthesis, class C137988683279889305Rat
1359520Ddx59DEAD-box helicase 59135329987253324824Rat
1359221B4galt3beta-1,4-galactosyltransferase 3138964384789649880Rat
1334435Olr1589olfactory receptor 1589139216764392168581Rat
1334438Olr1575-psolfactory receptor pseudogene 1575139141035291411096Rat
1334407Olr1587olfactory receptor 1587139213629092137228Rat
1560598Dusp27dual specificity phosphatase 27, atypical138430282484332899Rat
1562103Rgs13regulator of G-protein signaling 13136097017261004260Rat
1333029Olr1580-psolfactory receptor pseudogene 1580139165144791652267Rat
1333448Olr1583olfactory receptor 1583139172532491726265Rat
1559826Nectin4nectin cell adhesion molecule 4138975566589774185Rat
1334087Olr1584olfactory receptor 1584139206436592107991Rat
1303313Ufc1ubiquitin-fold modifier conjugating enzyme 1138966176389668513Rat
1334224Olr1602olfactory receptor 1602139250437492505351Rat
1333672Olr1582olfactory receptor 1582139171199591712936Rat
1561848Slamf6SLAM family member 6139030016090321781Rat
1561854Ascl5achaete-scute family bHLH transcription factor 5135288705552888603Rat
1308112Mgat4eMGAT4 family, member E135136480351382702Rat
1333675Olr1598olfactory receptor 1598139235828092359212Rat
621868Cep170centrosomal protein 170139480709094887448Rat
631331Fcgr2bFc fragment of IgG receptor IIb138932929889343916Rat
1311791Arpc5actin related protein 2/3 complex, subunit 5137017497070183879Rat
1311892Inavainnate immunity activator135308843853108713Rat
1311160Nek7NIMA-related kinase 7135548575955617534Rat
1311162Fam20bFAM20B, glycosaminoglycan xylosylkinase137428017374333463Rat
1560834Zbtb41zinc finger and BTB domain containing 41135651323156542444Rat
1564839RGD1564839similar to ribosomal protein L31135328384053284281Rat
1560339Lgr6leucine-rich repeat-containing G protein-coupled receptor 6135181190451931193Rat
1359178Tmco1transmembrane and coiled-coil domains 1138546501585559113Rat
1333301Olr1599-psolfactory receptor pseudogene 1599139236671092367688Rat
1564553Cd84CD84 molecule139024136990283625Rat
1565283Spata46spermatogenesis associated 46138864452088648145Rat
1562464Vsig8V-set and immunoglobulin domain containing 8139094325590951443Rat
1583578Il20interleukin 20134764407147651487Rat
1585268LOC688740similar to 40S ribosomal protein S15 (RIG protein)139033778990338282Rat
1566400Map3k19mitogen-activated protein kinase kinase kinase 19134452405544553197Rat
1561353Uba2-ps1ubiquitin-like modifier activating enzyme 2, pseudogene 1139388268593885316Rat
1582969LOC688938similar to heterogeneous nuclear ribonucleoprotein C135710046757101729Rat
1587499LOC689881similar to ribosomal protein L15137022244270224952Rat
1583292Ndufv3-ps1NADH dehydrogenase (ubiquinone) flavoprotein 3, pseudogene 1135129722351297656Rat
1562140RGD1562140similar to brain Zn-finger protein136136336461365366Rat
1587602LOC688577similar to Macrophage migration inhibitory factor (MIF) (Phenylpyruvate tautomerase) (Glycosylation-inhibiting factor) (GIF) (Delayed early response protein 6) (DER6)138993465189935143Rat
1563018FcrlbFc receptor-like B138928480189293266Rat
1563935Sh2d1bSH2 domain containing 1B138860533988623787Rat
1583808LOC363996similar to SVH protein135396688953967879Rat
1583809LOC363987similar to NADH-ubiquinone oxidoreductase PDSW subunit (Complex I-PDSW) (CI-PDSW)135018793550188463Rat
1562134RGD1562134similar to 60S ribosomal protein L9135393334353933932Rat
1586615B3galt2Beta-1,3-galactosyltransferase 2136043594660444957Rat
1585248LOC688760similar to protein tyrosine phosphatase 4a1137215451872155107Rat
1563522Lax1lymphocyte transmembrane adaptor 1135016456350175119Rat
1584663Cct6a-ps8chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 8138162835781630009Rat
1586467Cct3-ps2chaperonin containing Tcp1, subunit 3 (gamma), pseudogene 2135545882655460621Rat
1582913LOC688994similar to 40S ribosomal protein S15 (RIG protein)135852919258533872Rat
1562613RGD1562613similar to U2 small nuclear ribonucleoprotein B135346017753460902Rat
1564990Gorabgolgin, RAB6-interacting138168220781698827Rat
1565034LOC498222similar to specifically androgen-regulated protein134745243647467432Rat
1565977RGD1565977similar to 40S ribosomal protein S3136886497668866636Rat
1566090Mfsd4amajor facilitator superfamily domain containing 4A134880772048848997Rat
1561635RGD1561635similar to 40S ribosomal protein S17137315079273151353Rat
1583546Il19interleukin 19134766359247677869Rat
1584079Cfhr2complement factor H-related 2135664165756713305Rat
1566310Golt1agolgi transport 1A135053211650550029Rat
1565548RGD1565548similar to ribosomal protein L7-like 1136266066462661483Rat
1565820Slc9c2solute carrier family 9, member C2 (putative)137900036879073060Rat
1560190Slamf7SLAM family member 7139005672690075159Rat
1562609Pld5phospholipase D family, member 5139402569694355219Rat
1563470LOC498265similar to hypothetical protein FLJ10706138225451682298467Rat
1564395Plekha6pleckstrin homology domain containing A6135055545450582236Rat
1559819Fmo13flavin-containing monooxygenase 13138468240384694598Rat
1562634LOC498236LRRGT00186135303059653087386Rat
1559938RGD1559938similar to spermine synthase138855597388557189Rat
1561738RGD1561738similar to interferon induced transmembrane protein 2 (1-8D)137366100573661699Rat
1359140Mpzl1myelin protein zero-like 1138380524483842074Rat
1561967Uap1UDP-N-acetylglucosamine pyrophosphorylase 1138846353288497901Rat
1564745Mroh9maestro heat-like repeat family member 9138092898280986373Rat
1564772Hmcn1hemicentin 1136779979168360664Rat
1566124Axdnd1axonemal dynein light chain domain containing 1137395042274025237Rat
1563410RGD1563410similar to put. type 5 nonmuscle actin139255837992559460Rat
1359454Sdhcsuccinate dehydrogenase complex subunit C138949804789518979Rat
1565384Igfn1immunoglobulin-like and fibronectin type III domain containing 1135279118852823037Rat
1584674FcamrFc fragment of IgA and IgM receptor134753805247552370Rat
1561544Tmem81transmembrane protein 81134927772249280153Rat
1564387Fam78bfamily with sequence similarity 78, member B138511053685233243Rat
1563512Rc3h1ring finger and CCCH-type domains 1137872302878794663Rat
1590261Nav1neuron navigator 1135226047452515016Rat
1589757Dnmt3b-ps2DNA methyltransferase 3B, pseudogene 2138925581589257977Rat
1589758F5coagulation factor V138247999782535540Rat
1593499LOC689365similar to Actin-related protein 2/3 complex subunit 1B (ARP2/3 complex 41 kDa subunit) (p41-ARC)136441863864421694Rat
1586357LOC689943similar to 40S ribosomal protein S2137037335670376619Rat
1586370LOC689930similar to peptidylprolyl isomerase D137034462370345596Rat
1591400LOC685613similar to 60S ribosomal protein L7138720445687207085Rat
1591406Pfdn2prefoldin subunit 2138972511389743849Rat
1591103Wdr64WD repeat domain 64139375175493874149Rat
1592306LOC689456similar to 60S ribosomal protein L29 (P23)136637400566375161Rat
1593124Teddm1transmembrane epididymal protein 1137132275971324016Rat
1592116LOC289157similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)137949261879494352Rat
1592117LOC289134similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)137439743774403525Rat
1587949Gpr52G protein-coupled receptor 52137832654578331349Rat
1588822Usp21ubiquitin specific peptidase 21138965501689661150Rat
1587045LOC680838hypothetical protein LOC680838134514846845150144Rat
1586677Casq1calsequestrin 1139059267690602365Rat
1589042Sh2d1b2SH2 domain containing 1B2138853666888548762Rat
1589074LOC685812similar to ribosomal protein L11135259763552603205Rat
1589741Rgs16regulator of G-protein signaling 16137116341171185147Rat
1587674LOC688505similar to F-box and leucine-rich repeat protein 14135416690154172818Rat
1586661LOC686035similar to heat shock 70kDa protein 6 (HSP70B)138940870389411500Rat
1589909LOC689669hypothetical protein LOC689669136852560568526199Rat
1586783LOC684709similar to putative membrane protein Re9137130445271308203Rat
1590898Abl2ABL proto-oncogene 2, non-receptor tyrosine kinase137415453374333244Rat
1590926Mptx1mucosal pentraxin 1139177292791827231Rat
1584051Rgsl1regulator of G-protein signaling like 1137120626871276799Rat
1588113LOC682054similar to RAN, member RAS oncogene family134871917948721348Rat
1589272LOC683209similar to heterogeneous nuclear ribonucleoprotein F135397899553980396Rat
1588198LOC680768similar to Actin, cytoplasmic 2 (Gamma-actin)137920341479205000Rat
1593291Mr1major histocompatibility complex, class I-related137277199272789861Rat
1595361LOC681470similar to olfactory receptor 1403139176825691769188Rat
1595460Tex35testis expressed 35137472945574740685Rat
1598023Fam72afamily with sequence similarity 72, member A134828807148298604Rat
1592612LOC685536similar to platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit138617596886176658Rat
1596198Ackr1atypical chemokine receptor 1139182731091828875Rat
1596201ChmlCHM like Rab escort protein139374075993742624Rat
1595083Fmo9flavin containing monooxygenase 9138477427484795081Rat
1594177LOC680254hypothetical protein LOC680254137506018975066815Rat
1592348LOC689412similar to CG4025-PA136555067365551379Rat
1592636LOC685511similar to 40S ribosomal protein S7 (S8)135133235851333002Rat
1596806LOC680082similar to cell division cycle associated 4137662578676626921Rat
1591785Pappa2pappalysin 2137638915076660248Rat
1593809Pcp4l1Purkinje cell protein 4-like 1138954237789565920Rat
1594385Opn3opsin 3139371648193746994Rat
1594388LOC498276Fc gamma receptor II beta139116897291181937Rat
1594389LOC498264similar to heat shock protein 1, alpha138078233380785154Rat
1592115LOC289172similar to peptidylprolyl isomerase D138231532182317954Rat
1598107LOC679963similar to eukaryotic translation elongation factor 1 alpha 1137386830473870149Rat
1598123LOC679947similar to ATP synthase, H+ transporting, mitochondrial F1 complex, gamma subunit137385397173854797Rat
1598128Angptl1angiopoietin-like 1137445648774463031Rat
1598005LOC681267similar to adenylate kinase 2 isoform b138234477982345516Rat
619769Fmodfibromodulin135087488650885503Rat
1598302LOC364041similar to 60S ribosomal protein L7a138678131186782087Rat
1598304LOC364034similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)138089876980922128Rat
1598305LOC364022similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)137257586172576656Rat
1598307LOC364000similar to 40S ribosomal protein S2135770456757705443Rat
1595097LOC685351similar to flavin containing monooxygenase 5138474443384762142Rat
1596420Ildr2immunoglobulin-like domain containing receptor 2138447419184532347Rat
1625994Vom2r-ps111vomeronasal 2 receptor, pseudogene 111135693520056935544Rat
2311260LOC100302372hypothetical protein LOC100302372137778451677822333Rat
2313878Znrd1-ps1zinc ribbon domain containing 1, pseudogene 1138946429989464941Rat
2319172LOC100361907complement factor H-related protein B135672991056764060Rat
2318727LOC100362156proteasome alpha 6 subunit136022007460221010Rat
2318772LOC100362111ring finger protein 138135925025059259695Rat
2318303LOC100362384ferritin light chain 1-like138925340489254341Rat
2321289LOC100360869POU class 5 homeobox 1-like135689251656893764Rat
2320539LOC100361224ribosomal protein L36a-like134835570448365764Rat
2321320LOC100360838rCG43676-like137861957378620422Rat
2322099Fmn2formin 2139256925692887302Rat
2322251LOC100363803hypothetical LOC100363803134867453448674911Rat
2320695Rgs21regulator of G-protein signaling 21136128642561310742Rat
2321508LOC100360750Sm protein F-like134738037647382933Rat
2322986LOC100363459hypothetical LOC100363459137898106078981463Rat
2320873LOC100361087hypothetical LOC100361087138863687588642011Rat
2323037Bola2-ps2bolA family member 2, pseudogene 2137875434378754721Rat
2321674LOC100360683protein S100-A11-like137103978471042682Rat
2321675Snrpesmall nuclear ribonucleoprotein polypeptide E135025270750258951Rat
2321708LOC100360649mitochondrial ribosomal protein L30134698833846988811Rat
2322511LOC100360239hypothetical LOC100360239134953841449538993Rat
2321010LOC100364450hypothetical LOC100364450136741561167417000Rat
2322549LOC100360201cyclin B1 interacting protein 1-like137162429071625151Rat
2321067LOC100360993translocase of inner mitochondrial membrane 23 (yeast) homolog138791109087919507Rat
2321906LOC100360551GABA(A) receptor-associated protein-like 2-like134592026245920615Rat
2322696LOC100360153eukaryotic translation initiation factor 3, subunit M137153441771536757Rat
2322707Lemd1LEM domain containing 1134900376349035519Rat
2321949LOC100360508ribosomal protein S26-like134507985745080277Rat
2323611LOC100359583hypothetical protein LOC100359583138987307189874033Rat
2324322LOC100362636mKIAA1191 protein-like136790249967903888Rat
2323778Zfp648zinc finger protein 648137165246471659187Rat
2323779LOC100362914hypothetical LOC100362914137019324470204220Rat
2323815Tstd1thiosulfate sulfurtransferase like domain containing 1138980565289807355Rat
2324511LOC100362543Low affinity immunoglobulin gamma Fc region receptor III-like139118879991204149Rat
2324512LOC100362542MAD homolog 2136646839466543361Rat
2325378Mir199a2microRNA 199a-2138012548780125596Rat
2325425Mir181a-1microRNA 181a-1135495274254952841Rat
2325487Mir488microRNA 488137619859376198671Rat
2325548Mir214microRNA 214138013090580131014Rat
2325561Mir181b1microRNA 181b-1135495290354953012Rat
2325574Mir128-1microRNA 128-1134491653444916615Rat
2325610Mir135bmicroRNA 135b134897698648977082Rat
4888558Mir3570microRNA 3570135495272354952839Rat
2324612LOC100366054Da1-10-like138828671888310964Rat
4145546LOC100526655ribosomal protein L29 pseudogene138948513789485743Rat
4888566Mir3120microRNA 3120138013090980131025Rat
5128565LOC100526819deoxyuridine triphosphatase pseudogene137323409773234884Rat
6488950LOC100912060serine/arginine-rich splicing factor 6-like137479974974802973Rat
6486032LOC100912617uncharacterized LOC100912617138322085683227893Rat
6491293LOC100911717uncharacterized LOC100911717136734715267350860Rat
6491355LOC10091172840S ribosomal protein S27-like138921884489219219Rat
6490259LOC100911901betaine aldehyde dehydrogenase-like138845656488457392Rat
6496245LOC100910850mortality factor 4-like protein 1-like139355970993561403Rat
6502812LOC100909648vasopressin V1b receptor-like134839043448400583Rat
6496484LOC100910764histone deacetylase 1-like135864928758650176Rat
6497154LOC100910748glyceraldehyde-3-phosphate dehydrogenase-like137186503171865826Rat
6497316LOC100910652osteoclast-stimulating factor 1-like138562443885625451Rat
6500808LOC10091000860S ribosomal protein L15-like137035485470355488Rat
6497955LOC100910550macrophage migration inhibitory factor-like135739666557397287Rat
7501983LOC102550525uncharacterized LOC102550525135050768550509232Rat
7514622LOC102557118uncharacterized LOC102557118135076145250764851Rat
7489024Mir3473microRNA 3473134471933544719401Rat
7540956LOC102547307uncharacterized LOC102547307135332139253333118Rat
7541964LOC102550554uncharacterized LOC102550554136853970568584776Rat
7542108LOC102556541uncharacterized LOC102556541137633851176341042Rat
7506261LOC102548453male-enhanced antigen 1-like134483358144838617Rat
7528970LOC102553722uncharacterized LOC102553722135251268752518742Rat
7507381LOC10255299760S ribosomal protein L35-like137279049072798709Rat
7531223LOC102548579uncharacterized LOC102548579135520200055219397Rat
7512173LOC102546371uncharacterized LOC102546371138308966483100916Rat
7535704LOC102555374uncharacterized LOC102555374139090049590905465Rat
7537425LOC102554073uncharacterized LOC102554073138038003180383642Rat
7516494LOC102548181uncharacterized LOC102548181135400540954036603Rat
7539150LOC102553639uncharacterized LOC102553639135225968552266982Rat
7645761LOC102555306complement factor H-like135679265256803359Rat
7646811LOC102555007immunoglobulin-like and fibronectin type III domain-containing protein 1-like135282092852823299Rat
7663451LOC102554978uncharacterized LOC102554978139047998590484951Rat
7664260LOC102552051uncharacterized LOC102552051136302508763049942Rat
7633688LOC102552406uncharacterized LOC102552406135100866951018293Rat
7620820LOC10255252460S ribosomal protein L17-like137532428475337085Rat
7636347LOC10254930260S ribosomal protein L9-like136038929060390524Rat
7636450LOC102556096pyrin domain-containing protein 3-like139197744191981426Rat
7559320LOC102553985uncharacterized LOC102553985137965981279667530Rat
7623570LOC102548646uncharacterized LOC102548646134508775645094548Rat
7638368LOC102546489uncharacterized LOC102546489139300926293035524Rat
7639405LOC102551041uncharacterized LOC102551041137534320475403803Rat
7640179LOC102548908uncharacterized LOC102548908134557391645588310Rat
7656010LOC102552819uncharacterized LOC102552819137272640672731478Rat
7657602LOC102551528uncharacterized LOC102551528136994599469957272Rat
7609998LOC102548111uncharacterized LOC102548111138544352985451929Rat
7643986LOC10254686640S ribosomal protein S3a-like139372061993722048Rat
7644303LOC102549528uncharacterized LOC102549528136056831160572099Rat
7660382LOC10255266740S ribosomal protein S27-like137266956672669987Rat
7661875LOC102556005uncharacterized LOC102556005134867805648679605Rat
7592284LOC102555223uncharacterized LOC102555223139080277090807403Rat
7592376LOC102550271uncharacterized LOC102550271136841394268416820Rat
7592623LOC102547698uncharacterized LOC102547698135362137453628484Rat
7594218LOC102552207uncharacterized LOC102552207137908654279106028Rat
7598395LOC102555487uncharacterized LOC102555487138068180180687739Rat
7544069LOC102553952uncharacterized LOC102553952137168542071774329Rat
7544266LOC102553685uncharacterized LOC102553685137309135573124192Rat
7601148LOC102553522uncharacterized LOC102553522137142944171435985Rat
7561471LOC102551374uncharacterized LOC102551374136081822360828994Rat
7579358LOC102557067uncharacterized LOC102557067138944390289447121Rat
7548142LOC102552085uncharacterized LOC102552085137116034771162831Rat
7562072LOC102552665uncharacterized LOC102552665135122507451228447Rat
7581466LOC102552334uncharacterized LOC102552334136460485664616811Rat
7603292LOC102549273uncharacterized LOC102549273134980680349809400Rat
7603387Clec20aC-type lectin domain containing 20A137471036574767535Rat
7603484LOC102555981uncharacterized LOC102555981138230139282319908Rat
7604184LOC102547622histone acetyltransferase KAT2B-like139325829293261194Rat
7551260LOC102550526RNA-binding motif protein, Y chromosome, family 1 member B-like139425233494254632Rat
7606491LOC102547468uncharacterized LOC102547468137316911273172116Rat
7586102LOC102553951uncharacterized LOC102553951135235962852367485Rat
7567745LOC102553617uncharacterized LOC102553617137288278872909210Rat
7568040LOC102549303uncharacterized LOC102549303138849802288499325Rat
7690852LOC102547822uncharacterized LOC102547822135371187853716296Rat
7673552LOC10255573360S ribosomal protein L7-like137436252074364444Rat
7704134LOC102555344uncharacterized LOC102555344138061497280620732Rat
7677982LOC1025487125' exonuclease Apollo-like137419921474204490Rat
7706115LOC102555077uncharacterized LOC102555077138039232180394875Rat
7723311LOC102550614olfactory receptor 11H6-like139212290792124376Rat
7685856LOC102550428uncharacterized LOC102550428136848711068489412Rat
7724255LOC10254821660S ribosomal protein L7a-like138675354086774625Rat
7724570LOC10255214260S ribosomal protein L5-like137057698670578139Rat
7686641LOC102551886uncharacterized LOC102551886137082967670832465Rat
7687979LOC102554604uncharacterized LOC102554604137982290579838112Rat
7737183LOC102553256ubiquitin-conjugating enzyme E2 C-like135162212251624147Rat
7739330LOC102552277uncharacterized LOC102552277136454889564566180Rat
7739800LOC102551797ornithine decarboxylase-like137074189970746647Rat
7667252LOC102548838uncharacterized LOC102548838134541210745418999Rat
7742455LOC10254905460S ribosomal protein L7a-like138531530585316209Rat
7717561LOC102548647uncharacterized LOC102548647135595394155981554Rat
7743630LOC102547022uncharacterized LOC102547022136014985960157052Rat
7718449LOC102554129uncharacterized LOC102554129137991146179942489Rat
7718804LOC102553924uncharacterized LOC102553924138577889385787358Rat
7671555LOC102550495uncharacterized LOC102550495136855436968556598Rat
7700680LOC102547168guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-5-like138967831689679086Rat
7720978LOC102552335uncharacterized LOC102552335136867519268707660Rat
7671987LOC102549964uncharacterized LOC102549964139003950190048347Rat
7672249LOC102548555COX assembly mitochondrial protein homolog134473168844733196Rat
7674871LOC102547588uncharacterized LOC102547588135355514453572396Rat
7703222LOC102554128uncharacterized LOC102554128137341017773419981Rat
7749071LOC102550090uncharacterized LOC102550090138894412288947898Rat
7728603LOC102554977complement factor H-related protein 1-like135683008356851658Rat
7710301LOC102555796uncharacterized LOC102555796134855312048566395Rat
7681381LOC102551684uncharacterized LOC102551684137047164070483002Rat
7711400Tex50testis expressed 50137898227278987682Rat
9091073LOC103693672uncharacterized LOC103693672135978680259789570Rat
9213668LOC103691912uncharacterized LOC103691912135138129951382848Rat
9093567LOC103691936uncharacterized LOC103691936136090938760925031Rat
9102078LOC103691959uncharacterized LOC103691959137114639471147794Rat
9078385Lnc134long non-coding RNA 134135127594751280865Rat
9078813LOC103691876uncharacterized LOC103691876134802241948031840Rat
9182824LOC10369211460S ribosomal protein L15-like137084584070850541Rat
9147101LOC103691875uncharacterized LOC103691875134780285147811163Rat
9112028LOC10369202040S ribosomal protein S8 pseudogene138113511381137084Rat
9160891LOC103692054uncharacterized LOC103692054138576012985824512Rat
9164779LOC103691877uncharacterized LOC103691877134810705348108995Rat
9201554LOC103691904uncharacterized LOC103691904135090922350911243Rat
9169019LOC103692324uncharacterized LOC103692324139389775293902412Rat
9205262LOC103692291uncharacterized LOC103692291139079152990793004Rat
9127992LOC103693683low affinity immunoglobulin gamma Fc region receptor III139118892691197905Rat
9215774LOC103691910uncharacterized LOC103691910135137113951372927Rat
9349723LOC10369196260S ribosomal protein L28 pseudogene137536777275368283Rat
9216865LOC103692058uncharacterized LOC103692058138617926386179635Rat
9220554LOC103692287uncharacterized LOC103692287139027510890300066Rat
9270250LOC103691905uncharacterized LOC103691905135112007951122225Rat
9272792LOC103693671uncharacterized protein C1orf43 homolog pseudogene135370518353707594Rat
9273883LOC103693675uncharacterized LOC103693675137796548477967485Rat
9280417LOC103693678T-complex protein 1 subunit zeta-like138123612981237049Rat
9238526Zbed6zinc finger, BED-type containing 6135019614350211670Rat
9286707LOC103692062uncharacterized LOC103692062138727080387279183Rat
9288424LOC10369192360S ribosomal protein L31 pseudogene135339799553399251Rat
9333559LOC10369192228S ribosomal protein L42, mitochondrial135306744053067949Rat
9333866LOC103692322uncharacterized LOC103692322139385604793871019Rat
9360918LOC103693684uncharacterized LOC103693684138944028189441844Rat
9252026LOC103691921uncharacterized LOC103691921135257610952584807Rat
9296464LOC103691892uncharacterized LOC103691892134986706249871201Rat
9340199LOC103692000uncharacterized LOC103692000137937173879471048Rat
9362824LOC103692323uncharacterized LOC103692323139375001393783081Rat
9301876LOC103692070uncharacterized LOC103692070138737088887385799Rat
9306126LOC103693681uncharacterized LOC103693681138589978585918418Rat
9365454LOC103692017uncharacterized LOC103692017138076132180762303Rat
9460837LOC103692325uncharacterized LOC103692325139391371193936951Rat
9461626LOC103692077uncharacterized LOC103692077135037175850380755Rat
9465698LOC103693680uncharacterized LOC103693680138661606686617919Rat
9466182LOC103692065uncharacterized LOC103692065138729876587330126Rat
9329753LOC103692286uncharacterized LOC103692286139008852890116074Rat
9329762LOC103693677spore coat protein SP96-like137959942379613009Rat
9330179LOC103692282uncharacterized LOC103692282138999771090004364Rat
9467553LOC103691878uncharacterized LOC103691878134851055548555098Rat
9429724LOC103691934uncharacterized LOC103691934136087837260908972Rat
9468255LOC103693674uncharacterized LOC103693674137327248473276230Rat
9391883LOC103692015uncharacterized LOC103692015137984260579856326Rat
9431477LOC103692288uncharacterized LOC103692288139022683690260571Rat
9431976LOC103692050uncharacterized LOC103692050138540664985407292Rat
9431983LOC103692068uncharacterized LOC103692068138733918287344740Rat
9435417LOC103691961uncharacterized LOC103691961137407350174075325Rat
9398754LOC10369211540S ribosomal protein S10 pseudogene137890765778908287Rat
9438715LOC103692289uncharacterized LOC103692289139058960790592719Rat
9445439LOC103692016uncharacterized LOC103692016138076363080764708Rat
9410469LOC10369367960S ribosomal protein L7a-like138427272784273455Rat
9410925LOC103691924uncharacterized LOC103691924135560496655608822Rat
9413022LOC10369207660S ribosomal protein L29 pseudogene138906574989069216Rat
9415485LOC103692284uncharacterized LOC103692284139010244590115985Rat
9417070LOC103692078ubiquitin-conjugating enzyme E2 D4-like135423811854238590Rat
9219038LOC103691931uncharacterized LOC103691931136071447760729503Rat
9418531LOC103693673phosphoenolpyruvate carboxykinase [GTP], mitochondrial pseudogene136574974865751678Rat
9420301LOC103693682uncharacterized LOC103693682138860156088603696Rat
9685080Mir1843bmicroRNA 1843b137706544677065507Rat
11355415LOC108352575uncharacterized LOC108352575139085699790885746Rat
11369964LOC108352529NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 3 pseudogene134820463748211158Rat
11371098LOC108352642glyceraldehyde-3-phosphate dehydrogenase-like134571014845711151Rat
11445940LOC108352548uncharacterized LOC108352548136199496562007791Rat
11448580LOC108352620glyceraldehyde-3-phosphate dehydrogenase pseudogene138089931780899864Rat
11454394Trnad-guc9transfer RNA aspartic acid (anticodon GUC) 9138946847589468546Rat
11454395Trnag-ucc5transfer RNA glycine (anticodon UCC) 5138944003489440105Rat
11443633LOC108352542uncharacterized LOC108352542135577840755805721Rat
11462796Trnan-guu12transfer RNA asparagine (anticodon GUU) 12138940011889400191Rat
11466399LOC108352547uncharacterized LOC108352547136184997261940421Rat
11466947Trnap-agg14transfer RNA proline (anticodon AGG) 14138384783683847907Rat
11467019LOC108352535uncharacterized LOC108352535135135246951355487Rat
11468747LOC108352538uncharacterized LOC108352538135384460153850856Rat
11469353Trnal-cag4transfer RNA leucine (anticodon CAG) 4139116310291163184Rat
11472643LOC108352549uncharacterized LOC108352549136748499567499974Rat
11474461LOC108352644uncharacterized LOC108352644136171786061721765Rat
11357429Trnag-ucc6transfer RNA glycine (anticodon UCC) 6138944914789449218Rat
11443638LOC108352558uncharacterized LOC108352558137294475672946837Rat
11443645LOC10835264660S ribosomal protein L29-like136636234566365136Rat
11444079Trnag-gcc7transfer RNA glycine (anticodon GCC) 7139120600691206076Rat
11457516LOC108352541uncharacterized LOC108352541135488155054918267Rat
11457523Trnag-gcc4transfer RNA glycine (anticodon GCC) 4138944221989442289Rat
11436410LOC108352574uncharacterized LOC108352574139039607690398705Rat
11459163LOC108352537uncharacterized LOC108352537135258737652589240Rat
11447235Trnal-cag6transfer RNA leucine (anticodon CAG) 6139123379191233873Rat
11358636LOC108352556uncharacterized LOC108352556137270710472717485Rat
11372458LOC108352626uncharacterized LOC108352626138752309787570480Rat
11372680LOC108352565uncharacterized LOC108352565138313825683166399Rat
11438814Trnal-cag2transfer RNA leucine (anticodon CAG) 2138944121989441301Rat
11448281Trnag-gcc3transfer RNA glycine (anticodon GCC) 3138941140589411475Rat
11363202Trnag-gcc5transfer RNA glycine (anticodon GCC) 5138945310189453171Rat
11428601LOC10835262160S ribosomal protein L6 pseudogene139129893091301124Rat
11428758Trnag-ucc8transfer RNA glycine (anticodon UCC) 8139120401791204088Rat
11440287LOC108352566uncharacterized LOC108352566138501160785017428Rat
11442089LOC108352557uncharacterized LOC108352557137274891472756058Rat
11453213LOC108352533uncharacterized LOC108352533135018574950193563Rat
11453963LOC10835252760S ribosomal protein L37 pseudogene134496674944967160Rat
11383645LOC108352617prothymosin alpha pseudogene136334097363341297Rat
11384213LOC10835261960S ribosomal protein L7 pseudogene136863051668631373Rat
11395224Trnag-gcc6transfer RNA glycine (anticodon GCC) 6139120568591205755Rat
11405975LOC108352627uncharacterized LOC108352627138860113888603179Rat
11412620Trnap-cgg3transfer RNA proline (anticodon CGG) 3138384846883848539Rat
11413331Trnad-guc8transfer RNA aspartic acid (anticodon GUC) 8138944976889449839Rat
11413703Trnad-guc7transfer RNA aspartic acid (anticodon GUC) 7138944057289440643Rat
11416093LOC108352569uncharacterized LOC108352569138569803085736655Rat
11416577LOC10835264840S ribosomal protein S28 pseudogene138392415983925401Rat
11416840Trnal-cag5transfer RNA leucine (anticodon CAG) 5139118292591183007Rat
11417571LOC108352555uncharacterized LOC108352555137113816171150295Rat
11417578LOC108352647guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-5 pseudogene137150166171502057Rat
11419406LOC10835255160S ribosomal protein L23a pseudogene136917213069172673Rat
11424972LOC108352567uncharacterized LOC108352567138544584485457067Rat
11426647Trnag-ucc4transfer RNA glycine (anticodon UCC) 4138940451389404584Rat
11355992Trnar-ucu5transfer RNA arginine (anticodon UCU) 5139189587391895946Rat
11427238LOC108352625PHD finger-like domain-containing protein 5A pseudogene137813953878141684Rat
11373728LOC108352531uncharacterized LOC108352531134897535348988474Rat
11409127LOC108352559uncharacterized LOC108352559137493179974977340Rat
11386729Trnad-guc6transfer RNA aspartic acid (anticodon GUC) 6138940357689403647Rat
11398805Trnae-cuc8transfer RNA glutamic acid (anticodon CUC) 8138946930789469378Rat
11376556LOC108352643SRA stem-loop-interacting RNA-binding protein, mitochondrial pseudogene135898911958989453Rat
11376557LOC10835265040S ribosomal protein S29139133399891334323Rat
11377184LOC108352532uncharacterized LOC108352532134954542249560734Rat
11387238Trnal-cag3transfer RNA leucine (anticodon CAG) 3138946792289468004Rat
11387688LOC108352645non-histone chromosomal protein HMG-14 pseudogene136229425462294545Rat
11388196Trnav-cac3transfer RNA valine (anticodon CAC) 3138947715989477231Rat
11389558LOC108352618endogenous retrovirus group K member 113 Gag polyprotein-like136628185566286312Rat
11400800Trnae-cuc7transfer RNA glutamic acid (anticodon CUC) 7138944865489448724Rat
11401909LOC108352563uncharacterized LOC108352563138142907581454559Rat
11379461LOC108352553uncharacterized LOC108352553136960704669673899Rat
11390928LOC108348047low affinity immunoglobulin gamma Fc region receptor III138942083589440644Rat
11391174LOC108352564uncharacterized LOC108352564138148257381512425Rat
11402621LOC10835257260S ribosomal protein L31 pseudogene138998723989988066Rat
11381827LOC108352539uncharacterized LOC108352539135457360754579898Rat
11381889LOC108352578uncharacterized LOC108352578139353593893544225Rat
11392346LOC108352545uncharacterized LOC108352545136049805260512402Rat
11393231LOC108352577uncharacterized LOC108352577139147569591485187Rat
11404766LOC108352570uncharacterized LOC108352570138660778286622320Rat
11382668LOC108352528glyceraldehyde-3-phosphate dehydrogenase pseudogene134723233247233380Rat
11518999LOC108352543POU domain, class 5, transcription factor 1 pseudogene135689044156893756Rat
11519000Trnal-cag1transfer RNA leucine (anticodon CAG) 1138940510989405191Rat
11519731LOC108352554uncharacterized LOC108352554136962175169644905Rat
11501445LOC108352550uncharacterized LOC108352550136863328468643599Rat
11477991LOC108352561uncharacterized LOC108352561137882081978825672Rat
11505411LOC108352560bolA-like protein 2 pseudogene137875271378754891Rat
11505802Trnaw-cca6transfer RNA tryptophan (anticodon CCA) 6137152145471521525Rat
11506008LOC108352536uncharacterized LOC108352536135246087252467679Rat
11506265Trnad-guc10transfer RNA aspartic acid (anticodon GUC) 10139116244791162518Rat
11507220LOC108352546uncharacterized LOC108352546136130104461317700Rat
11481710LOC108352530uncharacterized LOC108352530134887319748893426Rat
11495544LOC108352576uncharacterized LOC108352576139120568591206386Rat
11508071LOC108352552uncharacterized LOC108352552136943459269446560Rat
11509631LOC108352526uncharacterized LOC108352526134446975144475881Rat
11498207Trnag-ucc7transfer RNA glycine (anticodon UCC) 7138946897589469046Rat
11511033LOC108352605ubiquitin-conjugating enzyme E2 G1 pseudogene137193052471932394Rat
11511782Trnag-ucc9transfer RNA glycine (anticodon UCC) 9139123716391237234Rat
11499904LOC108352540uncharacterized LOC108352540135474840654799917Rat
11483296LOC108352573uncharacterized LOC108352573139011321190116261Rat
11485859LOC108352649protein FAM78B pseudogene138511005285110427Rat
11487222LOC108352562glutamyl-tRNA(Gln) amidotransferase subunit A, mitochondrial pseudogene137923833679240833Rat
11518338Trnad-guc11transfer RNA aspartic acid (anticodon GUC) 11139118227191182342Rat
11518817Trnae-cuc6transfer RNA glutamic acid (anticodon CUC) 6138943952989439600Rat
11488317LOC108352571glyceraldehyde-3-phosphate dehydrogenase pseudogene138982339289824392Rat
11491242LOC108352544uncharacterized LOC108352544136019243860193214Rat
11491824Trnad-guc12transfer RNA aspartic acid (anticodon GUC) 12139123313791233208Rat
11494075LOC108352568H/ACA ribonucleoprotein complex subunit 3 pseudogene138558470885585294Rat
12903268Nr1i3em1Sagenuclear receptor subfamily 1, group I, member 3; ZFN induced mutant 1,SAGE138958661189586711Rat



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13147622148Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131107975663Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131107975663Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13901674250513953Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13901690682995569Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13901690682995569Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)1312193394108478121Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)131409633059096330Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)131409633059096330Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131444158250799665Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131444158251577031Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131462463159624631Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131462463159624631Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131981081464810814Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)132005247765052477Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)132148248158537177Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1324502279108770533Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132800833873008338Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132858445273584452Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132907693474076934Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132907693474076934Rat
2303030Bp327Blood pressure QTL 327arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133530126346444796Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1335301263107975663Rat
2301962Cm72Cardiac mass QTL 724.12heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)133614753364868393Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133614753399968921Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133614753399968921Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133734634882346348Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133937292784372927Rat
10755495Bp387Blood pressure QTL 3873.78arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133950130093652524Rat
2292232Pur16Proteinuria QTL 1617.2total urine protein amount (VT:0000032)urine protein level (CMO:0000591)134106005747227923Rat
12879477Bp401Blood pressure QTL 401arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134215554344588509Rat
4889861Pur29Proteinuria QTL 2913.80.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)134231074486833540Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)134231074487310744Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)134250834587508345Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)134357571788575717Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134567662990676629Rat
2303032Bp328Blood pressure QTL 328arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134644457050799665Rat
4145117Mcs27Mammary carcinoma susceptibility QTL 270.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)134877665553264877Rat
6893344Cm79Cardiac mass QTL 791.50.04heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)134905850767207219Rat
12879436Bp395Blood pressure QTL 395arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134999470851081193Rat
12879444Bp397Blood pressure QTL 397arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135026035750897964Rat
12879472Bp399Blood pressure QTL 399arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135060922853264877Rat
12879471Bp398Blood pressure QTL 398arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135089609150918009Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)135108098996080989Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135156924896569248Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)135157782490675199Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1357903612102903612Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1362975663107975663Rat
2303028Bp329Blood pressure QTL 329arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)136361128379034003Rat
724564Uae11Urinary albumin excretion QTL 115.7urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)136450135182995671Rat
738026Lnnr5Liver neoplastic nodule remodeling QTL 53.29liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)136500824591629354Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1366971778111971778Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1371230858114033958Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1371230858114033958Rat
7387280Uae43Urinary albumin excretion QTL 435.690.4174urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1372583716114033958Rat
8655951Rf63Renal function QTL 6312.2blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)137456837882995671Rat
1300166Kidm6Kidney mass QTL 63.93kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)137456837892916783Rat
1331783Bp221Blood pressure QTL 2213.72886arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)137456837892916783Rat
8655945Rf61Renal function QTL 613.6blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)137456837892916783Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)777694986114033958Rat
11530006Niddm72Non-insulin dependent diabetes mellitus QTL 720.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)137956708186833540Rat
8655959Pur32Proteinuria QTL 328.4total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1379567081103613733Rat
738027Lnnr6Liver neoplastic nodule remodeling QTL 63.3liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)138040355991629354Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1380403559108770687Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1386833393114033958Rat
1302791Stl29Serum triglyceride level QTL 293.30.0011blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)139065287492916783Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100909664 UniSTS
  171457 UniSTS
UniSTS 245764 UniSTS