BF401944 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BF401944

Symbol: BF401944
Previously known as:
RGD ID: 5061058
Expected Size: 187 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21195,783,793 - 195,783,979 (+)MAPPERmRatBN7.2
mRatBN7.21187,840,123 - 187,840,310 (+)MAPPERmRatBN7.2
Rnor_6.01205,059,075 - 205,059,261NCBIRnor6.0
Rnor_6.01213,456,067 - 213,456,252NCBIRnor6.0
Rnor_5.01220,350,338 - 220,350,523UniSTSRnor5.0
Rnor_5.01212,051,585 - 212,051,771UniSTSRnor5.0
RGSC_v3.41200,862,312 - 200,862,497UniSTSRGSC3.4
RGSC_v3.41192,521,211 - 192,521,397UniSTSRGSC3.4
Celera1193,411,636 - 193,411,821UniSTS
Celera1185,583,814 - 185,584,000UniSTS
RH 3.4 Map11437.5UniSTS
Is Marker For: Genes:   LOC100909406  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTCAGTTTCCCAAGGTTCTCC
Reverse Primer GGGAGAGCAGAGTGTGTTTCCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
69414Glrx3glutaredoxin 31192241707192272012Rat
69330Echs1enoyl-CoA hydratase, short chain 11194895036194903863Rat
3087MgmtO-6-methylguanine-DNA methyltransferase1191710980191937760Rat
61876Prap1proline-rich acidic protein 11194883078194886874Rat
727837Or6f2olfactory receptor family 6 subfamily F member 21194976929194977864Rat
621739Foxi2forkhead box I21190222857190226657Rat
620932Msx3msh homeobox 31194839041194842209Rat
621719Calycalcyon neuron-specific vesicular protein1194862671194873861Rat
620771Ptpreprotein tyrosine phosphatase, receptor type, E1190344331190494815Rat
68372Ctbp2C-terminal binding protein 21187782064187918115Rat
1304956Ebf3EBF transcription factor 31191996726192114593Rat
620800Bnip3BCL2 interacting protein 31193708164193725348Rat
1306820Edrf1erythroid differentiation regulatory factor 11188441514188478743Rat
1305864Stk32cserine/threonine kinase 32C1193900718193981723Rat
1307362BccipBRCA2 and CDKN1A interacting protein1188512544188524957Rat
1305043Clrn3clarin 31190319025190334648Rat
1304756Fank1fibronectin type III and ankyrin repeat domains 11188577512188685501Rat
1307378Scart1scavenger receptor family member expressed on T-cells 11195020750195031807Rat
2409Dpysl4dihydropyrimidinase-like 41193883039193898916Rat
1333372Or13a23olfactory receptor family 13 subfamily A member 231195517786195518718Rat
1333828Or13a19colfactory receptor family 13 subfamily A member 19C1195334233195335162Rat
1307280Nkx6-2NK6 homeobox 21194380149194383533Rat
1310396Urosuroporphyrinogen III synthase1188490832188513659Rat
1333923Or12j4olfactory receptor family 12 subfamily J member 41195362981195363904Rat
1333513Or13a27dolfactory receptor family 13 subfamily A member 27D1195652234195653166Rat
1333199Or12j3olfactory receptor family 12 subfamily J member 31195264681195265604Rat
1333205Or13a25olfactory receptor family 13 subfamily A member 251195730853195731788Rat
1333083Or13o2-ps1olfactory receptor family 13 subfamily O member 2, pseudogene 11195188443195188890Rat
1332644Or13a27bolfactory receptor family 13 subfamily A member 27B1195393485195394417Rat
1333185Or12j2olfactory receptor family 12 subfamily J member 21195209804195210721Rat
1334051Or12j2bolfactory receptor family 12 subfamily J member 2B1195315038195315949Rat
1333358Or6b13olfactory receptor family 6 subfamily B member 131195003659195004615Rat
1333221Or6ae1olfactory receptor family 6 subfamily A member E11194957151194958089Rat
1333614Olr301-psolfactory receptor pseudogene 3011195366554195367209Rat
1332754Or13a26colfactory receptor family 13 subfamily A member 26C1195702019195702951Rat
1333353Or13a26olfactory receptor family 13 subfamily A member 261195779448195780380Rat
1306168Inpp5ainositol polyphosphate-5-phosphatase A1194190086194380429Rat
1308241Adgra1adhesion G protein-coupled receptor A11194629744194673254Rat
708356Ppp2r2dprotein phosphatase 2, regulatory subunit B, delta1193665918193700277Rat
1307177Jakmip3janus kinase and microtubule interacting protein 31193753134193881105Rat
1309332Mmp21matrix metallopeptidase 211188480186188485855Rat
1307108Pwwp2bPWWP domain containing 2B1194040395194059979Rat
1333124Or13a18olfactory receptor family 13 subfamily A member 181195492445195493377Rat
1305476Mki67marker of proliferation Ki-671190496319190522983Rat
1333429Olr294-psolfactory receptor pseudogene 2941195229270195230031Rat
1308585Zfp511zinc finger protein 5111194817697194822102Rat
1309597Tubgcp2tubulin gamma complex component 21194791113194817807Rat
1333577Or13a27olfactory receptor family 13 subfamily A member 271195235583195236515Rat
1561125Paoxpolyamine oxidase1194919655194928498Rat
1561845Sprnshadow of prion protein1194944602194948448Rat
1334251Or13a27eolfactory receptor family 13 subfamily A member 27E1195639216195640148Rat
1333730Or12j5olfactory receptor family 12 subfamily J member 51195417480195418403Rat
1333778Olr293-psolfactory receptor pseudogene 2931195220868195221101Rat
1334140Olr296-psolfactory receptor pseudogene 2961195260637195260964Rat
1334099Or13a26bolfactory receptor family 13 subfamily A member 26B1195754003195754938Rat
1311740Dhx32DEAH-box helicase 32 (putative)1188524512188577500Rat
1559981Lrrc27leucine rich repeat containing 271194004967194035087Rat
1311186Fuomfucose mutarotase1194888535194893046Rat
1334329Olr314-psolfactory receptor pseudogene 3141195766783195767129Rat
1334216Or13a18bolfactory receptor family 13 subfamily A member 18B1195581371195582303Rat
1333032Or13a18colfactory receptor family 13 subfamily A member 18C1195610776195611708Rat
1332957Or13a27colfactory receptor family 13 subfamily A member 27C1195454589195455521Rat
1333302Or13a19bolfactory receptor family 13 subfamily A member 19B1195160617195161546Rat
1559985Cfap46cilia and flagella associated protein 461194403212194482790Rat
1565431Mapk1ip1mitogen-activated protein kinase 1 interacting protein 11193655319193665817Rat
1566394Adam8ADAM metallopeptidase domain 81194776559194789330Rat
1562437Tcerg1ltranscription elongation regulator 1-like1193012937193201860Rat
1583652Adam12ADAM metallopeptidase domain 121188686984189014206Rat
1566410Tex36testis expressed 361188390062188404448Rat
1565261Kndc1kinase non-catalytic C-lobe domain containing 11194689962194738353Rat
1566072Dock1dedicator of cyto-kinesis 11189467143189983777Rat
1588225Nt5c3a-ps15'-nucleotidase, cytosolic IIIA, pseudogene 11194832479194833350Rat
1589375Utf1undifferentiated embryonic cell transcription factor 11194740339194741465Rat
2302685Insyn2ainhibitory synaptic factor 2A1189697856189753194Rat
2311471C1h10orf90similar to human chromosome 10 open reading frame 901189059744189293353Rat
2318344C1h10orf143similar to human chromosome 10 open reading frame 1431192184440192222676Rat
2322921Nmur1-ps1neuromedin U receptor 1, pseudogene 11188988752188990053Rat
2321900Or13a19olfactory receptor family 13 subfamily A member 191195196027195196956Rat
2322689Ncl-ps6nucleolin, pseudogene 61192181207192182026Rat
2325486Mir202microRNA 2021194754730194754801Rat
2324597Npsneuropeptide S1190077040190080821Rat
6497155Mtg1mitochondrial ribosome-associated GTPase 11194931543194944278Rat
7498653LOC102552864uncharacterized LOC1025528641192580494192600465Rat
7536919LOC102552565uncharacterized LOC1025525651191966309191986518Rat
7646072LOC102553731uncharacterized LOC1025537311194746246194748946Rat
7622122LOC102552773uncharacterized LOC1025527731188120174188148128Rat
7553817LOC102553541uncharacterized LOC1025535411193731097193739373Rat
7694619LOC102552157uncharacterized LOC1025521571191017034191039381Rat
7684888LOC102551319uncharacterized LOC1025513191194845214194857999Rat
7725240LOC102551963uncharacterized LOC1025519631190441582190458258Rat
7744082LOC102551753uncharacterized LOC1025517531190139001190144141Rat
7749502LOC102552907uncharacterized LOC1025529071188413379188420695Rat
9132574LOC103690347uncharacterized LOC1036903471188411066188424673Rat
9271178LOC103691261sperm flagellar protein 1-like1194769043194776455Rat
9257184Mrpl42-ps1mitochondrial ribosomal protein L42, pseudogene 11195068326195071518Rat
9439981LOC103691254ubiquitin-conjugating enzyme E2 L3 pseudogene1189951742189954254Rat
11446129LOC108349660uncharacterized LOC1083496601190980953191004779Rat
11454674LOC108349784ATP synthase subunit g, mitochondrial pseudogene1188001281188001656Rat
11364130LOC108349861high mobility group protein B1 pseudogene1188005315188006052Rat
11391312LOC108349862serine/arginine-rich splicing factor 3 pseudogene1195375344195375899Rat
41380058LOC120099946uncharacterized LOC1200999461188404479188404948Rat
41387290LOC120099954uncharacterized LOC1200999541194005130194006623Rat
41331186Ncl-ps4nucleolin, pseudogene 41192178482192179369Rat
41150368LOC120093064scavenger receptor cysteine-rich domain-containing protein SCART1-like1195080285195136263Rat
41343059LOC120100426small nucleolar RNA SNORA171189941598189941726Rat
41399316LOC120099949uncharacterized LOC1200999491191146405191161742Rat
41015854LOC120099951uncharacterized LOC1200999511192977453192980548Rat
40979906LOC120100145U6 spliceosomal RNA1189412198189412304Rat
40988177LOC12009995760S ribosomal protein L36-like1194805628194806244Rat
41074861LOC120099952uncharacterized LOC1200999521192968015192975350Rat
41029299LOC120099956uncharacterized LOC1200999561194753901194762856Rat

Nucleotide Sequences
GenBank Nucleotide CH473953 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1302787Stl25Serum triglyceride level QTL 252.70.0073blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1180359209210702199Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383668Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61341Bp26Blood pressure QTL 26arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169537671214537671Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1185145134221264292Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642644214537671Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
1359018Hrtrt20Heart rate QTL 203.08heart pumping trait (VT:2000009)heart rate (CMO:0000002)1185356336202902618Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1182623426219932796Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
61378Bp43Blood pressure QTL 4322.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1181746937196383668Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
724559Pancm1Pancreatic morphology QTL 17.1islet of Langerhans morphology trait (VT:0005215)pancreatic islet damage composite score (CMO:0001156)1181759564214537555Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
2312558Glom17Glomerulus QTL 173.90.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1166532971191278129Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1164747424209747424Rat
631260Tcas2Tongue tumor susceptibility QTL 24.93tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)1192485903199050587Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1169112897197261052Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
724562Rends1Renal damage susceptibility QTL 10.05kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)1169537671214537671Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393213533942Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1188377360224054420Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
634338Hcar4Hepatocarcinoma resistance QTL 44.6liver integrity trait (VT:0010547)liver tumorous lesion number to liver area ratio (CMO:0001210)1193422268214537671Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
6480780Insul18Insulin level QTL 184.11blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1189607473200611765Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
2325725Eae31Experimental allergic encephalomyelitis QTL 31nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1178810256188377506Rat
631670Iddm10Insulin dependent diabetes mellitus QTL 101.9blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1174133260196383668Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100909406 UniSTS
UniSTS 245546 UniSTS