BI277150 Marker Search Result - Rat Genome Database

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

General

Marker: BI277150

Symbol:

BI277150

Previously known as:

RGD ID:

5057804

Expected Size:

154 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	15	78,452,022 - 78,452,175 (+)	MAPPER	mRatBN7.2
mRatBN7.2	14	79,566,175 - 79,566,329 (+)	MAPPER	mRatBN7.2
Rnor_6.0	14	84,935,505 - 84,935,658	NCBI	Rnor6.0
Rnor_6.0	15	86,123,093 - 86,123,245	NCBI	Rnor6.0
Rnor_5.0	15	89,888,395 - 89,888,547	UniSTS	Rnor5.0
RGSC_v3.4	15	85,591,962 - 85,592,114	UniSTS	RGSC3.4
Celera	15	77,646,046 - 77,646,198	UniSTS
Celera	14	78,471,605 - 78,471,758	UniSTS
Cytogenetic Map	14	q21	UniSTS

Is Marker For:

Genes: LOC686947 Uqcr10

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GTTGACAGCCGTAGTCAAATGC
Reverse Primer	TGTCAGCTGTCAGCCTGGAG

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1595126	Uqcr10	ubiquinol-cytochrome c reductase, complex III subunit X	14	79566151	79569017	Rat
2320734	Uqcr10-ps1	ubiquinol-cytochrome c reductase, complex III subunit X, pseudogene 1	15	78448397	78452589	Rat

Nucleotide Sequences


RefSeq Transcripts	NM_001170465	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BC166935	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ210702	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ211930	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ211963	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ216944	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ217035	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ217584	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ221635	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ224395	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	FQ224687	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
631839	Niddm37	Non-insulin dependent diabetes mellitus QTL 37	3.37		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	11030622	95876975	Rat
70187	Pancm5	Pancreatic morphology QTL 5	16.7		pancreas mass (VT:0010144)	pancreas weight to body weight ratio (CMO:0000630)	14	30320092	80829842	Rat
2313048	Bss84	Bone structure and strength QTL 84	3.1	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	14	37669719	82669719	Rat
2313084	Bss83	Bone structure and strength QTL 83	2.9	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	14	37669719	82669719	Rat
2313089	Bss81	Bone structure and strength QTL 81	3.4	0.0001	body length (VT:0001256)	body length, nose to rump (CMO:0000079)	14	37669719	82669719	Rat
2313100	Bss82	Bone structure and strength QTL 82	3	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	14	37669719	82669719	Rat
738037	Hcas6	Hepatocarcinoma susceptibility QTL 6	2.93		liver integrity trait (VT:0010547)	liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)	14	39057237	83368335	Rat
631523	Pia13	Pristane induced arthritis QTL 13	3.3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	14	40793460	98037301	Rat
1300136	Rf22	Renal function QTL 22	3.9		renal blood flow trait (VT:2000006)	absolute change in renal vascular resistance (CMO:0001900)	14	42262529	95023211	Rat
1549834	Scl45	Serum cholesterol level QTL 45	5.8		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	14	50023211	95023211	Rat
2300197	Scl59	Serum cholesterol level QTL 59			blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	14	55147478	100147478	Rat
9590294	Uminl4	Urine mineral level QTL 4	5.66	0.001	urine mineral amount (VT:0015086)	urine electrolyte level (CMO:0000593)	14	55624247	100624247	Rat
9589034	Epfw11	Epididymal fat weight QTL 11	6	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	14	55624247	100624247	Rat
2317879	Alcrsp27	Alcohol response QTL 27	3.3	0.63	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	14	56631369	101631369	Rat
634328	Hc5	Hypercalciuria QTL 5	2.3		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	14	58184885	103184885	Rat
70153	Bp59	Blood pressure QTL 59	3.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	14	68757796	83368335	Rat
1582259	Gluco23	Glucose level QTL 23	3.1	0.0008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	14	70053989	104886043	Rat
1641900	Alcrsp11	Alcohol response QTL 11			alcohol metabolism trait (VT:0015089)	blood ethanol level (CMO:0000535)	14	70053989	104886043	Rat
1582197	Gluco27	Glucose level QTL 27	3.4	0.0006	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	14	73415323	92554092	Rat
1582209	Gluco20	Glucose level QTL 20	3.8	0.0005	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	73415323	92554092	Rat
1582236	Gluco22	Glucose level QTL 22	3.3	0.0164	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	73415323	92554092	Rat
1582255	Gluco29	Glucose level QTL 29	3.1	0.0025	blood glucose amount (VT:0000188)	absolute change in blood glucose level area under curve (CMO:0002034)	14	73415323	92554092	Rat
1582250	Gluco26	Glucose level QTL 26	3.3	0.0009	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	14	73415323	95876975	Rat
61424	Scl1	Serum cholesterol level QTL 1	7.7	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	15	16725528	80672115	Rat
1578646	Bmd18	Bone mineral density QTL 18	5.2		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	15	22806240	98288169	Rat
1578647	Bmd17	Bone mineral density QTL 17	4		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	15	22806240	98288169	Rat
1578660	Bss19	Bone structure and strength QTL 19	4.3		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	15	22806240	98288169	Rat
1582214	Stl21	Serum triglyceride level QTL 21	3.1	0.022	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	15	28030665	82262678	Rat
1582227	Gluco30	Glucose level QTL 30	3.6	0.0003	blood glucose amount (VT:0000188)	absolute change in blood glucose level area under curve (CMO:0002034)	15	28030665	82262678	Rat
1582228	Epfw3	Epididymal fat weight QTL 3	4.1	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1582242	Gluco28	Glucose level QTL 28	3.3	0.0008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	15	28030665	82262678	Rat
1582244	Bw79	Body weight QTL 79	4	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1598828	Glom14	Glomerulus QTL 14	2.5		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	15	34054139	79054139	Rat
1300144	Rf23	Renal function QTL 23	3.61		renal blood flow trait (VT:2000006)	absolute change in renal vascular resistance (CMO:0001900)	15	40631268	98288169	Rat
1576315	Schws6	Schwannoma susceptibility QTL 6		0.0069	nervous system integrity trait (VT:0010566)	post-insult time of death (CMO:0002005)	15	53806152	98806152	Rat
61477	Aia4	Adjuvant induced arthritis QTL 4	3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	15	55596089	91365858	Rat
631516	Gluco31	Glucose level QTL 31	7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	15	55596089	95018120	Rat
631655	Bp126	Blood pressure QTL 126	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	58156477	101769107	Rat
731177	Uae26	Urinary albumin excretion QTL 26	2.4	0.025	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	15	67588667	101769107	Rat
2300326	Plaw1	Placental weight QTL 1	15	0.005	placenta mass (VT:0004257)	placenta wet weight (CMO:0002088)	15	68327165	100062518	Rat
1331724	Bp223	Blood pressure QTL 223	3.53715		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	73690518	95018228	Rat
1641889	Colcr6	Colorectal carcinoma resistance QTL 6	2.9	0.0126	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	15	73690518	99794247	Rat
70182	BpQTLcluster12	Blood pressure QTL cluster 12	3.53		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	15	73690657	95018120	Rat
2317055	Aia10	Adjuvant induced arthritis QTL 10	3.41		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	15	75788062	101769107	Rat
1549844	Bss7	Bone structure and strength QTL 7	6.4		femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	15	75788062	101769107	Rat
1581555	Eae19	Experimental allergic encephalomyelitis QTL 19	4.7		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	15	76306099	90088744	Rat
70155	Gcs1	Gastric cancer susceptibility QTL1	3.8		stomach morphology trait (VT:0000470)	stomach tumor susceptibility score (CMO:0002043)	15	76306099	101769107	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100361126	UniSTS
	685322	UniSTS
	686947	UniSTS
UniSTS	243618	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: BI277150