RH143879 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH143879

Symbol: RH143879
Previously known as: AI715354; 
RGD ID: 5055573
Expected Size: 174 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24117,810,827 - 117,811,775 (+)MAPPERmRatBN7.2
mRatBN7.22135,446,266 - 135,446,440 (+)MAPPERmRatBN7.2
Rnor_6.02140,459,949 - 140,460,122NCBIRnor6.0
Rnor_6.04117,053,259 - 117,054,206NCBIRnor6.0
Rnor_5.04181,633,006 - 181,633,953UniSTSRnor5.0
Rnor_5.02159,934,887 - 159,935,060UniSTSRnor5.0
RGSC_v3.44119,523,610 - 119,524,557UniSTSRGSC3.4
RGSC_v3.42140,297,214 - 140,297,387UniSTSRGSC3.4
Celera2129,941,870 - 129,942,043UniSTS
Celera4106,793,653 - 106,794,600UniSTS
RH 3.4 Map2848.2UniSTS
Cytogenetic Map4q34UniSTS
Is Marker For: Genes:   Sfxn5  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTCTTCTGCAAGAGCAGCC
Reverse Primer TCCCCACTGAGCCATCTTAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
628706Sfxn5sideroflexin 54117750213117869826Rat

Nucleotide Sequences
GenBank Nucleotide FQ233114 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2102803808147803808Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
6907363Bp357Blood pressure QTL 3574.10.002arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2129540907174540907Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1358360Sradr2Stress Responsive Adrenal Weight QTL 210.24adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)2129164097152195315Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2127447387143657569Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)292337601137337601Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)292337601137337601Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527185876470Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1582257Gluco21Glucose level QTL 213.10.0035blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2118111229157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527143657569Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2104559726149559726Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
5135226Leukc2Leukocyte quantity QTL 2eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)2118111229149559726Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
738007Anxrr7Anxiety related response QTL 74.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2118189491163189491Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
1581552Pur12Proteinuria QTL 125.190.0009urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)2112103657148076632Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1354594Despr10Despair related QTL 102e-06locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)2114654253159654253Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2102803808147803808Rat
1358360Sradr2Stress Responsive Adrenal Weight QTL 210.24adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)2129164097152195315Rat
1581578Cm49Cardiac mass QTL 494.90.01heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)2127447387143657569Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
724522Bp146Blood pressure QTL 1462.20.0021arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)473630210118630210Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
5135226Leukc2Leukocyte quantity QTL 2eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)2118111229149559726Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
2302051Pia28Pristane induced arthritis QTL 285.30.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)473630210118630210Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)478878504123878504Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481006124120102625Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
1354594Despr10Despair related QTL 102e-06locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)2114654253159654253Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
1578648Bss11Bone structure and strength QTL 114.7femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)2114837527211674221Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
6907363Bp357Blood pressure QTL 3574.10.002arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2129540907174540907Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)292337601137337601Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)292337601137337601Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1359030Bp277Blood pressure QTL 277arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527185876470Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)481192555126192555Rat
1582257Gluco21Glucose level QTL 213.10.0035blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2118111229157142209Rat
1359035Bp276Blood pressure QTL 276arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2114837527143657569Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2104559726149559726Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)480694870125694870Rat
1300165Rf9Renal function QTL 93.28kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)2133914684202447032Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
738007Anxrr7Anxiety related response QTL 74.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2118189491163189491Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
1581552Pur12Proteinuria QTL 125.190.0009urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)2112103657148076632Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 261737 UniSTS
UniSTS 233125 UniSTS