RH143759 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH143759

Symbol: RH143759
Previously known as: AI555230; 
RGD ID: 5055365
Expected Size: 191 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21236,927,295 - 236,927,486 (+)MAPPERmRatBN7.2
mRatBN7.2179,313,674 - 9,313,865 (+)MAPPERmRatBN7.2
Rnor_6.0179,842,571 - 9,842,761NCBIRnor6.0
Rnor_6.01258,130,238 - 258,130,428NCBIRnor6.0
Rnor_5.01711,952,251 - 11,952,441UniSTSRnor5.0
Rnor_5.01265,581,992 - 265,582,182UniSTSRnor5.0
RGSC_v3.41715,358,410 - 15,358,600UniSTSRGSC3.4
RGSC_v3.41715,360,920 - 15,361,110UniSTSRGSC3.4
Celera179,392,045 - 9,392,235UniSTS
Celera1234,012,432 - 234,012,622UniSTS
RH 3.4 Map1783.1UniSTS
Cytogenetic Map1q53UniSTS
Is Marker For: Genes:   Cyp2c24  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCCTGGGAGCTGTCTCACT
Reverse Primer TTTCTGGGCCTCAGTACCAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307748Nsd1nuclear receptor binding SET domain protein 11793119639426373Rat
1563697Cyp2c24cytochrome P450, family 2, subfamily c, polypeptide 241236873967236936238Rat

Nucleotide Sequences
GenBank Nucleotide JH613115.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590316Scort21Serum corticosterone level QTL 214.750.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17122871563Rat
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1641902Colcr7Colorectal carcinoma resistance QTL 73.350.0044intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)17211514921881669Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17211514934551001Rat
631499Stl1Serum triglyceride level QTL 13.6blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)17327139827389946Rat
2324619Coatc4Coat color QTL 40.001coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)17429913021293263Rat
2324619Coatc4Coat color QTL 40.001coat/hair pigmentation trait (VT:0010463)pigmented dorsal coat/hair area to total dorsal coat/hair area ratio (CMO:0001811)17429913021293263Rat
1354613Kidm14Kidney mass QTL 146.2kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)17429913035837242Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2293648Bmd31Bone mineral density QTL 314.50.0001femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)17435448727028127Rat
2293664Bmd28Bone mineral density QTL 285.10.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)17435448727028127Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17452803849528038Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17452803849528038Rat
1581553Pur14Proteinuria QTL 145.30.0001urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)17797996816317111Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
1582199Insul5Insulin level QTL 53.40.0119blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)17920136523653323Rat
1582208Kidm32Kidney mass QTL 323.90.0018kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17920136523653323Rat
1582224Epfw4Epididymal fat weight QTL 43.50.0058epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)17920136523653323Rat
1582225Bw67Body weight QTL 676.20.0001body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582226Bw64Body weight QTL 644.20.0017body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582241Bw70Body weight QTL 704.60.0003body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582245Bw73Body weight QTL 734.60.0004body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582258Bw76Body weight QTL 764.60.0005body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
1358292Cm37Cardiac mass QTL 376.20.00000081heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1214537555238757011Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1218748008257976495Rat
61400Niddm1Non-insulin dependent diabetes mellitus QTL 111blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1218753689245907899Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1218753816256448513Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
2293700Bmd27Bone mineral density QTL 276.60.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1224054293243747962Rat
2293701Bmd34Bone mineral density QTL 348.30.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)1224054293243747962Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
2316896Gluco57Glucose level QTL 577.2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1228985440245907899Rat
1581544Rf52Renal function QTL 520.05urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1233190394258625266Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1236125214260522016Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499353 UniSTS
UniSTS 233005 UniSTS