RH134350 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Community Projects (beta) QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH134350

Symbol: RH134350
Previously known as:
RGD ID: 5050946
Expected Size: 181 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2177,203,095 - 77,203,276 (+)MAPPERmRatBN7.2
mRatBN7.21625,348,423 - 25,348,604 (+)MAPPERmRatBN7.2
Rnor_6.01627,236,186 - 27,236,366NCBIRnor6.0
Rnor_6.0178,457,069 - 78,457,249NCBIRnor6.0
Rnor_5.01627,107,052 - 27,107,232UniSTSRnor5.0
Rnor_5.0179,704,310 - 79,704,490UniSTSRnor5.0
RGSC_v3.4176,754,896 - 76,755,076UniSTSRGSC3.4
RGSC_v3.41628,262,036 - 28,262,216UniSTSRGSC3.4
Celera1625,426,994 - 25,427,174UniSTS
Celera171,688,373 - 71,688,553UniSTS
Cytogenetic Map1q21UniSTS
Cytogenetic Map16p13UniSTS
Is Marker For: Genes:   Arhgap35   Grlf1-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGCTGGGTAATAGGGCTAGAG
Reverse Primer CTGACTTAACATTGGGCCAACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596975Grlf1-ps1glucocorticoid receptor DNA binding factor 1, pseudogene 1162534511025348729Rat
1308738Arhgap35Rho GTPase activating protein 3517720243677319298Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)12887978078430678Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)13344984878449848Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)13344984878449848Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)13483685879836858Rat
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)13523959878430678Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)13523959878430678Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14580314078430678Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
4889962Bss94Bone structure and strength QTL 943.8tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14936146582174945Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)15389511782174945Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)15389511782174945Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306400 UniSTS
  678709 UniSTS
UniSTS 217632 UniSTS