RH134127 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH134127

Symbol: RH134127
Previously known as:
RGD ID: 5050560
Expected Size: 219 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21629,333,863 - 29,334,078 (+)MAPPERmRatBN7.2
mRatBN7.2819,200,556 - 19,200,775 (+)MAPPERmRatBN7.2
Rnor_6.0821,680,387 - 21,680,605NCBIRnor6.0
Rnor_6.01632,656,297 - 32,656,511NCBIRnor6.0
Rnor_5.01632,490,170 - 32,490,384UniSTSRnor5.0
Rnor_5.0821,736,448 - 21,736,666UniSTSRnor5.0
RGSC_v3.41632,656,876 - 32,657,090UniSTSRGSC3.4
RGSC_v3.4819,681,513 - 19,681,731UniSTSRGSC3.4
Celera820,595,860 - 20,596,078UniSTS
Celera1629,327,779 - 29,327,993UniSTS
Cytogenetic Map16p12UniSTS
Cytogenetic Map8q13UniSTS
Is Marker For: Genes:   Pin1   Pin1-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGATTTAATGGAAGGTGCACGG
Reverse Primer GACTTCAGAAGGGCAGTGGAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1592038Pin1-ps1peptidylprolyl cis/trans isomerase, NIMA-interacting 1, pseudogene 1162933329129335321Rat
1310299Pin1peptidylprolyl cis/trans isomerase, NIMA-interacting 181918940819200785Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
9590084Insglur5Insulin/glucose ratio QTL 518.540.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)8124597739Rat
2317882Alcrsp24Alcohol response QTL 243.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)8125902202Rat
12880023Bw184Body weight QTL 1840.001body mass (VT:0001259)body weight (CMO:0000012)8209764047097640Rat
12880025Cm102Cardiac mass QTL 1020.044heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)8209764047097640Rat
12880028Cm103Cardiac mass QTL 1030.02heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)8209764047097640Rat
12880044Am9Aortic mass QTL 90.007aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)8209764047097640Rat
2317032Ginf2Gastrointestinal inflammation QTL 23.210.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)8470581049705810Rat
2317036Livw3Liver weight QTL 32.430.01liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)8470581049705810Rat
2317048Ginf1Gastrointestinal inflammation QTL 13.520.005cecum mucosa thickness (VT:0010234)enterocolitis severity score (CMO:0002138)8470581049705810Rat
2301416Bp315Blood pressure QTL 3150.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)8767057852670578Rat
1354595Despr4Despair related QTL 42.160.0036locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)8768895552688955Rat
1354627Despr14Despair related QTL 140.0056locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)8768895552688955Rat
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
2317030Wbc5White blood cell count QTL 53.210.005leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)8873663553736635Rat
2317051Aia18Adjuvant induced arthritis QTL 182.42joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)8873663553736635Rat
1598824Memor4Memory QTL 42.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)8971222053356647Rat
1357398Slep3Serum leptin concentration QTL 33.43blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)8971246341866876Rat
2302367Slep5Serum leptin concentration QTL 53.43blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)8971246341866876Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat
1558646Swd5Spike wave discharge measurement QTL 53.450.00036brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)81490675159906751Rat
61373Mcs4Mammary carcinoma susceptibility QTL 41.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)81629044461290444Rat
631271Lecl1Lens clarity QTL 10.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)81898416884531599Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 298696 UniSTS
  364561 UniSTS
UniSTS 217409 UniSTS