RH134040 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH134040

Symbol: RH134040
Previously known as:
RGD ID: 5050410
Expected Size: 183 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2120,099,779 - 20,099,962 (+)MAPPERmRatBN7.2
mRatBN7.2871,087,624 - 71,087,807 (+)MAPPERmRatBN7.2
Rnor_6.0876,848,003 - 76,848,185NCBIRnor6.0
Rnor_6.0121,145,390 - 21,145,572NCBIRnor6.0
Rnor_5.0876,233,731 - 76,233,913UniSTSRnor5.0
Rnor_5.0122,625,154 - 22,625,336UniSTSRnor5.0
RGSC_v3.4120,585,359 - 20,585,541UniSTSRGSC3.4
RGSC_v3.4874,892,139 - 74,892,321UniSTSRGSC3.4
Celera870,640,887 - 70,641,069UniSTS
Celera118,075,141 - 18,075,323UniSTS
Cytogenetic Map8q24UniSTS
Cytogenetic Map1p12UniSTS
Is Marker For: Genes:   Akap7   Ccnb2   LOC100361029   Ccnb2-ps2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTCAGTACAGAGCACGGTTATGG
Reverse Primer CTTCCTTCCATCGTGTGCTTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308176Ccnb2cyclin B287108759471100794Rat
1303071Akap7A-kinase anchoring protein 712008719020217799Rat
2321841Ccnb2-ps2cyclin B2, pseudogene 212009975320101246Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat
631271Lecl1Lens clarity QTL 10.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)81898416884531599Rat
731182Uae24Urinary albumin excretion QTL 246.4urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)81933115293965294Rat
2303564Gluco43Glucose level QTL 433blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)82613018771130187Rat
2303572Insul13Insulin level QTL 132blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)82613018771130187Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)82720571599103503Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)82720571599103503Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)82720571599103503Rat
1300146Rf17Renal function QTL 172.9renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)82824291273242912Rat
8662823Vetf5Vascular elastic tissue fragility QTL 51.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)82824291299525068Rat
1549908Neudeg1Neurodegradation QTL 15.50nervous system integrity trait (VT:0010566)logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)83018886794457446Rat
2313046Bss78Bone structure and strength QTL 783.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)83084815482460899Rat
2313057Bss76Bone structure and strength QTL 7630.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)83084815482460899Rat
2313067Bss77Bone structure and strength QTL 773.10.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)83084815482460899Rat
2313088Bss75Bone structure and strength QTL 753.10.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)83084815482460899Rat
1578755Pur5Proteinuria QTL 53.30.0001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)830848154101699754Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)830848154101699754Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)830848154101699754Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)830848259105647037Rat
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83085640475856404Rat
1582222Epfw2Epididymal fat weight QTL 23.20.0005epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)83173772976737729Rat
61358Bp39Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83555193880551938Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83558203280582032Rat
1331838Niddm61Non-insulin dependent diabetes mellitus QTL 613.530.0004blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)83646953599083736Rat
737824Hcar10Hepatocarcinoma resistance QTL 102.9liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)84071306682925667Rat
1358906Bp253Blood pressure QTL 25340.0004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)84071306693965294Rat
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
1331769Rf39Renal function QTL 393.871urine output (VT:0003620)timed urine volume (CMO:0000260)84186687675097878Rat
1298079Activ2Activity QTL 29.50.000001voluntary movement trait (VT:0003491)rearing measurement (CMO:0001515)84186687686866876Rat
70161Bp62Blood pressure QTL 622.90.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84269268490165460Rat
12879882Am8Aortic mass QTL 80.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)84329616998968765Rat
12879878Bw183Body weight QTL 1830.001body mass (VT:0001259)body weight (CMO:0000012)84329616998968765Rat
12879879Cm99Cardiac mass QTL 990.001heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)84329616998968765Rat
12879880Cm100Cardiac mass QTL 1000.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)84329616998968765Rat
12879881Cm101Cardiac mass QTL 1010.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)84329616998968765Rat
12879883Kidm65Kidney mass QTL 650.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)84329616998968765Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)846531639119088624Rat
70197BpQTLcluster8Blood pressure QTL cluster 83.482arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)846531639119088624Rat
1331837Bw23Body weight QTL 234.190.00007body mass (VT:0001259)body weight (CMO:0000012)84653172299083736Rat
2303570Gluco48Glucose level QTL 482blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)84980583194805831Rat
2313086Bss60Bone structure and strength QTL 604.10.0001tibia length (VT:0004357)tibia length (CMO:0000450)85009524982460899Rat
4889938Bss89Bone structure and strength QTL 893.8tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)85009524982460899Rat
5684973Bss100Bone structure and strength QTL 1004.7tibia area (VT:1000281)tibia area measurement (CMO:0001382)85009524982460899Rat
1358912Bw51Body weight QTL 512.95body mass (VT:0001259)body weight (CMO:0000012)851351728107062046Rat
10402857Bp380Blood pressure QTL 3800.95arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)85396876598968765Rat
2301402Bp316Blood pressure QTL 3160.005arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)85396876598968765Rat
2293697Bmd39Bone mineral density QTL 39femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)85404374498968765Rat
1582243Bw66Body weight QTL 663.40.0048body mass (VT:0001259)body weight (CMO:0000012)85423764485365202Rat
1582254Kidm31Kidney mass QTL 313kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)85423764485365202Rat
631664Hcar3Hepatocarcinoma resistance QTL 32.90.0005liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)85423764499103503Rat
1300177Cm2Cardiac mass QTL 23.65heart mass (VT:0007028)heart weight (CMO:0000017)854259986100382532Rat
2303171Bp331Blood pressure QTL 3315.570.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)861290298119084929Rat
631653Bp125Blood pressure QTL 1253.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)866142385111142385Rat
631210Bw3Body weight QTL35.9mesenteric fat pad mass (VT:0010427)mesenteric fat pad weight to body weight ratio (CMO:0000654)869349194112783834Rat
1300171Bp184Blood pressure QTL 1843.66arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)870513503118219066Rat
1354647Despr8Despair related QTL 80.0000341locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1124744506Rat
2298546Neuinf4Neuroinflammation QTL 45.1nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1128736750Rat
2313053Bss51Bone structure and strength QTL 513.80.0001tibia length (VT:0004357)tibia length (CMO:0000450)1132356093Rat
2313070Bss52Bone structure and strength QTL 524.40.0001body length (VT:0001256)body length (CMO:0000013)1132356093Rat
2313090Bmd69Bone mineral density QTL 694.40.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)1132356093Rat
738020Pia8Pristane induced arthritis QTL 84.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1165833076Rat
1578650Bmd6Bone mineral density QTL 612.2femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)150910843284926Rat
1578651Bmd7Bone mineral density QTL 714.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)150910843284926Rat
1578669Bss9Bone structure and strength QTL 96.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)150910843284926Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
1600360Mcs16Mammary carcinoma susceptibility QTL 162.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1224439043433040Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1439328949393289Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
4889451Eae29Experimental allergic encephalomyelitis QTL 295.51nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1592587724697545Rat
631508Sald1Serum aldosterone level QTL 13.7blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)1985600154856001Rat
2302038Pia31Pristane induced arthritis QTL 315.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)11099206555992065Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11148131275088344Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2317755Glom22Glomerulus QTL 223.8urine protein amount (VT:0005160)urine protein level (CMO:0000591)11148148232355910Rat
1578756Iddm22Insulin dependent diabetes mellitus QTL 222.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)11183518156835181Rat
5684998Bss101Bone structure and strength QTL 1013.6tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)11543162149361612Rat
5684999Bss102Bone structure and strength QTL 1025.50.00000072tibia strength trait (VT:1000284)tibia stiffness (CMO:0001735)11543162149361612Rat
631494Bp95Blood pressure QTL 95400.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)11620621049268520Rat
634353Rends2Renal damage susceptibility QTL 20.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)11933357156983283Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100361029 UniSTS
  100364016 UniSTS
  361458 UniSTS
  363088 UniSTS
UniSTS 217322 UniSTS