RH133854 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH133854

Symbol: RH133854
Previously known as: AA819660; 
RGD ID: 5050086
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2225,501,655 - 25,501,870 (+)MAPPERmRatBN7.2
mRatBN7.279,319,922 - 9,320,137 (+)MAPPERmRatBN7.2
Rnor_6.0223,926,112 - 23,926,326NCBIRnor6.0
Rnor_6.0712,186,008 - 12,186,222NCBIRnor6.0
Rnor_5.0712,356,063 - 12,356,277UniSTSRnor5.0
Rnor_5.0243,097,155 - 43,097,369UniSTSRnor5.0
RGSC_v3.4224,571,853 - 24,572,067UniSTSRGSC3.4
RGSC_v3.4710,831,220 - 10,831,434UniSTSRGSC3.4
Celera77,498,625 - 7,498,839UniSTS
Celera221,573,679 - 21,573,893UniSTS
Cytogenetic Map7q11UniSTS
Cytogenetic Map2q12UniSTS
Is Marker For: Genes:   Scamp1   Mbd3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAAAGTGACTTCCTGGTTGGCT
Reverse Primer TCCCTGCTTCCTTACCATAGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3625Scamp1secretory carrier membrane protein 122543395825516734Rat
1307389Mbd3methyl-CpG binding domain protein 3793129619320166Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat
10402051Gdil2Gastrointestinal dilation QTL 2enteric ganglion morphology trait (VT:0001045)length of intestine affected by colonic aganglionosis to total length of colon ratio (CMO:0001836)22490385374786777Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29521 UniSTS
  362834 UniSTS
UniSTS 217137 UniSTS