RH133746 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH133746

Symbol: RH133746
Previously known as: AI576479; 
RGD ID: 5049900
Expected Size: 202 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.23140,885,825 - 140,885,857 (-)MAPPERmRatBN7.2
mRatBN7.2652,739,007 - 52,739,209 (+)MAPPERmRatBN7.2
mRatBN7.25139,407,025 - 139,407,063 (+)MAPPERmRatBN7.2
mRatBN7.23116,056,135 - 116,056,171 (+)MAPPERmRatBN7.2
mRatBN7.21632,615,715 - 32,615,756 (+)MAPPERmRatBN7.2
mRatBN7.26129,902,439 - 129,902,478 (-)MAPPERmRatBN7.2
mRatBN7.21478,045,605 - 78,045,645 (-)MAPPERmRatBN7.2
mRatBN7.2369,980,159 - 69,980,191 (-)MAPPERmRatBN7.2
mRatBN7.2769,181,743 - 69,181,775 (+)MAPPERmRatBN7.2
mRatBN7.2370,259,292 - 70,259,332 (-)MAPPERmRatBN7.2
mRatBN7.2672,306,333 - 72,306,370 (-)MAPPERmRatBN7.2
Rnor_6.0655,497,919 - 55,498,123NCBIRnor6.0
Rnor_5.0665,112,206 - 65,112,410UniSTSRnor5.0
RGSC_v3.4654,726,819 - 54,727,020UniSTSRGSC3.4
Celera651,885,577 - 51,885,778UniSTS
RH 3.4 Map6363.4UniSTS
Cytogenetic Map6q16UniSTS
Is Marker For: Genes:   Tspan13  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCAAGGCTACACAAAGAAACCC
Reverse Primer TGGGATGAATTTGAGGAAGAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1560636Sfi1SFI1 centrin binding protein147799096578048352Rat
620362Galnt7polypeptide N-acetylgalactosaminyltransferase 7163257864332703189Rat
41039845LOC120097421uncharacterized LOC120097421163260078032636371Rat
68418Dio2iodothyronine deiodinase 26109665523109679809Rat
68420Dio3iodothyronine deiodinase 36129285747129287608Rat
3664Srsf5serine and arginine rich splicing factor 56100605165100610192Rat
3911Tshrthyroid stimulating hormone receptor6110341585110475297Rat
3596Rps29ribosomal protein S2968763522987636627Rat
3851Tgfb3transforming growth factor, beta 36105704058105726661Rat
2201Bdkrb2bradykinin receptor B26124472317124502497Rat
3982Yy1YY1 transcription factor6127706739127736499Rat
71066Lrrn3leucine rich repeat neuronal 365848906058520322Rat
69194Gphngephyrin69695436597483617Rat
2594Fbln5fibulin 56120899219120977829Rat
2619Foxg1forkhead box G166667479766677611Rat
2807Foxa1forkhead box A167509990775136534Rat
61844Psma3proteasome 20S subunit alpha 368948374189503775Rat
61849Psma6proteasome 20S subunit alpha 667276553472796554Rat
70907Actn1actinin, alpha 169899855399093334Rat
3209Nrcamneuronal cell adhesion molecule66140281361698536Rat
619732Kcnk10potassium two pore domain channel subfamily K member 106117690052117826120Rat
3745Serpina3lserine (or cysteine) peptidase inhibitor, clade A, member 3L6123298365123305804Rat
3762Sstr1somatostatin receptor 167583229275836806Rat
70894Acot1acyl-CoA thioesterase 16103636173103644167Rat
3747Serpina3nserine (or cysteine) peptidase inhibitor, clade A, member 3N6123323623123331181Rat
619931Dlk1delta like non-canonical Notch ligand 16128410216128417518Rat
62009Zfp36l1zinc finger protein 36, C3H type-like 169893070598935748Rat
68941Kcnk13potassium two pore domain channel subfamily K member 136119240825119345292Rat
2152Arl4aADP-ribosylation factor like GTPase 4A65707949657084156Rat
3171NfkbiaNFKB inhibitor alpha67285871372861941Rat
69404Ifi27interferon, alpha-inducible protein 276122590461122596996Rat
621220Serpina10serpin family A member 106122756106122764544Rat
621556Aldh6a1aldehyde dehydrogenase 6 family, member A16104077975104098636Rat
621010Spata7spermatogenesis associated 76117879828117925284Rat
621230Pnma1PNMA family member 16103782244103784029Rat
631343Cpg1candidate plasticity gene 16118312220118324213Rat
631425Gscgoosecoid homeobox6123388072123390111Rat
727829Sgpp1sphingosine-1-phosphate phosphatase 169442533994446534Rat
727840Cox8ccytochrome c oxidase subunit 8C6122028566122029889Rat
727844Gpr135G protein-coupled receptor 13569062753390630661Rat
621507Bzw2basic leucine zipper and W2 domains 265282806952888599Rat
621827Strn3striatin 366904777669134102Rat
621345Nova1NOVA alternative splicing regulator 166378010563905567Rat
727929Ddx24DEAD-box helicase 246122564767122582032Rat
621850Zc3h14zinc finger CCCH type containing 146118006420118044480Rat
2582Esr2estrogen receptor 269485843894909630Rat
620906Six1SIX homeobox 169174673991751975Rat
621567Atxn3ataxin 36121072228121107902Rat
621279Arf6ADP-ribosylation factor 668785374287854890Rat
621417Kcnh5potassium voltage-gated channel subfamily H member 569361517493908107Rat
620664Hspa2heat shock protein family A (Hsp70) member 269512850495131281Rat
2338Chgachromogranin A6121696051121707399Rat
619817Serpina5serpin family A member 56123009224123028412Rat
620212Nrxn3neurexin 36107641760109272849Rat
727780Gpx2glutathione peroxidase 269549358995496877Rat
631409Hsp90aa1heat shock protein 90 alpha family class A member 16129702376129707907Rat
620401Bdkrb1bradykinin receptor B16124510827124514475Rat
621540Trim9tripartite motif-containing 968875682488856588Rat
69400Synj2bpsynaptojanin 2 binding protein6101189714101227400Rat
69246Gtf2a1general transcription factor 2A subunit 16110488891110521502Rat
61928Hif1ahypoxia inducible factor 1 subunit alpha69262405992669262Rat
620098Mgat2alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase68765636087658849Rat
620119Fntbfarnesyltransferase, CAAX box, subunit beta69553654095619587Rat
620216Ptpn21protein tyrosine phosphatase, non-receptor type 216117933066117998095Rat
621611Jdp2Jun dimerization protein 26105261619105302386Rat
621656Timm9translocase of inner mitochondrial membrane 968961009489622924Rat
727888Serpina16serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 166122800869122808247Rat
621390Srp54asignal recognition particle 54A67258758472626878Rat
3425Psen1presenilin 16103323052103375088Rat
620963Eif2s1eukaryotic translation initiation factor 2 subunit alpha69767282997697499Rat
621156Rpl36al1ribosomal protein L36A like 168765480887656202Rat
621215Vsx2visual system homeobox 26104214842104240264Rat
2972Serpina3cserine (or cysteine) proteinase inhibitor, clade A, member 3C6123240251123250219Rat
628874Mnat1MNAT1 component of CDK activating kinase69181470391971945Rat
628877Sostdc1sclerostin domain containing 165305133653055510Rat
708581Serpina4serpin family A member 46122999970123009083Rat
621097Psmc1proteasome 26S subunit, ATPase 16119392833119405233Rat
621101MaxMYC associated factor X69563685995662204Rat
68380Ltbp2latent transforming growth factor beta binding protein 26104429947104530498Rat
621055Acot2acyl-CoA thioesterase 26103611738103619404Rat
1304671Snapc1small nuclear RNA activating complex, polypeptide 169268478592710772Rat
628756Npc2NPC intracellular cholesterol transporter 26104397239104418161Rat
620107NumbNUMB, endocytic adaptor protein6103431400103553422Rat
619850Pgfplacental growth factor6104816102104826685Rat
1303145Abhd12babhydrolase domain containing 12B68866862788696435Rat
1304923Batfbasic leucine zipper ATF-like transcription factor6105353715105376051Rat
71019Egln3egl-9 family hypoxia-inducible factor 367165029771675766Rat
620197Slc8a3solute carrier family 8 member A36100874359101007989Rat
708531Mthfd1methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 169497786295045375Rat
3681Slc10a1solute carrier family 10 member 16100613045100626670Rat
3070Dnajb9DnaJ heat shock protein family (Hsp40) member B966127038561276795Rat
621444Slc25a21solute carrier family 25 member 2167420343974702902Rat
727810Frmd6FERM domain containing 668934598389419579Rat
735076Zbtb25zinc finger and BTB domain containing 2569507069995095888Rat
621470Adam4a disintegrin and metalloprotease domain 46101123284101125730Rat
620964Prkd1protein kinase D166772519368039002Rat
1303247Slc25a47solute carrier family 25, member 476127767365127773000Rat
620147Sel1lSEL1L adaptor subunit of SYVN1 ubiquitin ligase6110735450110779695Rat
3079Meox2mesenchyme homeobox 265385676053917467Rat
735172Rab15RAB15, member RAS oncogene family69549958495524073Rat
621888Prkchprotein kinase C, eta69229200092490663Rat
619832Lgmnlegumain6121544048121582495Rat
620687Pyglglycogen phosphorylase L68869759888740260Rat
620820Eif2b2eukaryotic translation initiation factor 2B subunit beta6104866926104873351Rat
708497Sipa1l1signal-induced proliferation-associated 1 like 16101839351102118408Rat
1303275Eml5EMAP like 56118046655118175831Rat
2626FosFos proto-oncogene, AP-1 transcription factor subunit6105121170105124036Rat
708347Begainbrain-enriched guanylate kinase-associated6127943651127979876Rat
620829Akap5A-kinase anchoring protein 569505152795061075Rat
620842Gemin2gem (nuclear organelle) associated protein 267670642476721154Rat
735068Serpina3mserpin family A member 3M6123064796123072087Rat
1304563Syne3spectrin repeat containing, nuclear envelope family member 36123872895123964773Rat
2257Calm1calmodulin 16119487691119495759Rat
619828Scfd1sec1 family domain containing 166879581068874076Rat
1306830Gpr33-ps1G protein-coupled receptor 33, pseudogene 166947443569475440Rat
735219Entpd5ectonucleoside triphosphate diphosphohydrolase 56104019095104055311Rat
620435Sos2SOS Ras/Rho guanine nucleotide exchange factor 268804296688156140Rat
1304647Snx6sorting nexin 667223095072274157Rat
2488Dgkbdiacylglycerol kinase, beta65464094855397210Rat
2511Dync1h1dynein cytoplasmic 1 heavy chain 16129615208129680888Rat
735131Mdga2MAM domain containing glycosylphosphatidylinositol anchor 268474642285608640Rat
3866Nkx2-1NK2 homeobox 167399660174001483Rat
620970Tmed10transmembrane p24 trafficking protein 106104991843105026705Rat
1306262Btbd7BTB domain containing 76121920365122010114Rat
1307230Moap1modulator of apoptosis 16121882565121884500Rat
1307232NubplNUBP iron-sulfur cluster assembly factor like66955927869781254Rat
1306414Asb2ankyrin repeat and SOCS box-containing 26122474754122511014Rat
1305849Rin3Ras and Rab interactor 36121431776121540956Rat
1306017Ankmy2ankyrin repeat and MYND domain containing 265288895952930343Rat
1305116Churc1churchill domain containing 169546448895485208Rat
1305119Daam1dishevelled associated activator of morphogenesis 169038954490550114Rat
1305913Rpl10lribosomal protein L10 like68454477184545791Rat
1304992Fkbp3FKBP prolyl isomerase 368311388583125500Rat
1306374Eml1EMAP like 16127283968127457246Rat
1305089Prorpprotein only RNase P catalytic subunit67266965972762419Rat
1306605Cyp46a1cytochrome P450, family 46, subfamily a, polypeptide 16127247543127274765Rat
1303095Zbtb1zinc finger and BTB domain containing 169509683895125811Rat
1303096Fut8fucosyltransferase 869594924696176677Rat
620642Ralgapa1Ral GTPase activating protein catalytic subunit alpha 167297743273252378Rat
621461Ngbneuroglobin6106744378106749830Rat
1306741Clmncalmin6123707710123807283Rat
1306117Stxbp6syntaxin binding protein 666192075662157405Rat
1306119Mideasmitotic deacetylase associated SANT domain protein6103784779103854470Rat
1307503Tecpr2tectonin beta-propeller repeat containing 26129899541130001975Rat
1306726Six4SIX homeobox 469180232891816002Rat
621150EvlEnah/Vasp-like6127473119127594342Rat
2867Ifrd1interferon-related developmental regulator 165726939557317833Rat
1307897FancmFA complementation group M68312690383180455Rat
1307899Serpina1fserpin family A member 1F6122820752122827112Rat
1305711Foxn3forkhead box N36118462018118842442Rat
1305721L3hypdhtrans-L-3-hydroxyproline dehydratase69063631090647106Rat
1307597Arel1apoptosis resistant E3 ubiquitin protein ligase 16104560556104617712Rat
1305080Cdkl1cyclin dependent kinase like 168822415488273434Rat
1305657Ppp2r5eprotein phosphatase 2 regulatory subunit B', epsilon69416884694317872Rat
1307442Arid4aAT-rich interaction domain 4A68952245989593868Rat
1305636Zfp410zinc finger protein 4106103963265103990252Rat
1307253Sav1salvador family WW domain containing protein 168847853688500121Rat
1305023Degs2delta(4)-desaturase, sphingolipid 26127596063127613293Rat
1303126Smoc1SPARC related modular calcium binding 16100701330100897441Rat
1303128Rnf113a2ring finger protein 113A26104063677104064958Rat
1304878Atg2bautophagy related 2B6124522283124592412Rat
2151Arg2arginase 269793600297961379Rat
69412Akap6A-kinase anchoring protein 667018410170624369Rat
620986Rtn1reticulon 169076321290983436Rat
1307769Ttc8tetratricopeptide repeat domain 86118198186118252422Rat
1306310MbipMAP3K12 binding inhibitory protein 167380813373825394Rat
13046242700097O09RiklRIKEN cDNA 2700097009 gene like67254216672587511Rat
1307393Wdr89WD repeat domain 8969435046894382085Rat
708485Serpina12serpin family A member 126122952552122967271Rat
1308574Flrt2fibronectin leucine rich transmembrane protein 26114777547114872688Rat
1306982Cfl2cofilin 267235566472359709Rat
1307621C6h14orf28similar to human chromosome 14 open reading frame 2868296530482973942Rat
1307392Ift43intraflagellar transport 436105729734105806257Rat
1306115Pcnx1pecanex 16101565461101702339Rat
3569Rgs6regulator of G-protein signaling 66102264451102796311Rat
1307429Ccdc88ccoiled-coil domain containing 88C6120169752120289459Rat
1306006Brms1lBRMS1 like transcriptional repressor67326667373300630Rat
735034Scinscinderin65710950057188123Rat
1307187Nek9NIMA-related kinase 96104944056104984538Rat
1307795Zfyve1zinc finger FYVE-type containing 16103184938103234111Rat
1307122Zc2hc1czinc finger, C2HC-type containing 1C6104932631104941555Rat
735119Atp6v1dATPase H+ transporting V1 subunit D69765672597672295Rat
1304789Serpina9serpin family A member 96122918819122936000Rat
1305611Smarce1-ps10SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1, pseudogene 1065650441056505749Rat
1305920Ttc7btetratricopeptide repeat domain 7B6119587389119799167Rat
1305926Slc24a4solute carrier family 24 member 46121279590121419811Rat
1311502Ston2stonin 26110567485110676376Rat
1311087Exd2exonuclease 3'-5' domain containing 26100116867100150452Rat
1309274MokMOK protein kinase6129823794129854669Rat
1308327Alkbh1alkB homolog 1, histone H2A dioxygenase6107068301107088784Rat
1310202Galnt16polypeptide N-acetylgalactosaminyltransferase 166100168943100250718Rat
1311990Ap4s1adaptor related protein complex 4 subunit sigma 166913340369174488Rat
1308507Arhgap5Rho GTPase activating protein 566997590470039299Rat
1309138Dtd2D-aminoacyl-tRNA deacylase 266945014669456430Rat
1307273Abcd4ATP binding cassette subfamily D member 46104246459104260965Rat
1560556Ttc6tetratricopeptide repeat domain 667513682775368176Rat
1310207Tmem63ctransmembrane protein 63c6106667389106738778Rat
1308104Slc25a29solute carrier family 25 member 296127742027127752915Rat
1308907Gpatch2lG patch domain containing 2-like6105883383105935644Rat
1309550Setd3SET domain containing 3, actin N3(tau)-histidine methyltransferase6127023058127090020Rat
1309559Gpr68G protein-coupled receptor 686120135620120166089Rat
1359368CrppaCDP-L-ribitol pyrophosphorylase A65312026453397030Rat
1359384Galcgalactosylceramidase6117452888117522281Rat
1308383Glrx5glutaredoxin 56123988461123998545Rat
1309687Cpsf2cleavage and polyadenylation specific factor 26121123941121152756Rat
1310462Rdh12retinol dehydrogenase 1269801546598028388Rat
3373Ppm1aprotein phosphatase, Mg2+/Mn2+ dependent, 1A69143909491486139Rat
1559639Rpl10al1ribosomal protein L10A like 168734960487350328Rat
1559721Ifi27l2ainterferon, alpha-inducible protein 27 like 2A6122598872122600358Rat
1559724Rps19-ps18ribosomal protein S19, pseudogene 1867206650372072009Rat
1311326Klhl28kelch-like family member 2868298736083018971Rat
1311327Acyp1acylphosphatase 16104919162104932348Rat
1310994Irf2bplinterferon regulatory factor 2 binding protein-like6106527179106531294Rat
1561024Mphosph6-ps2M phase phosphoprotein 6, pseudogene 269929722399298400Rat
1310330Slc38a6solute carrier family 38, member 669198765292076416Rat
1310843Gle1-ps1GLE1 RNA export mediator, pseudogene 16107124892107127024Rat
1359208Dmac2ldistal membrane arm assembly component 2 like68820558088223934Rat
1311962Pole2DNA polymerase epsilon 2, accessory subunit68767470287712723Rat
1310769Erg28ergosterol biosynthesis 28 homolog6105474112105483078Rat
1312001Rdh11retinol dehydrogenase 1169797937797995252Rat
1311438Pighphosphatidylinositol glycan anchor biosynthesis, class H69787490397897188Rat
1308362Plekhh1pleckstrin homology, MyTH4 and FERM domain containing H169783928897888712Rat
1309051Ppp1r36protein phosphatase 1, regulatory subunit 3669513852695159102Rat
1309052Dpf3double PHD fingers 36102841403103125558Rat
1308673Papolapoly (A) polymerase alpha6124682015124734706Rat
1312038Agmoalkylglycerol monooxygenase65398623654317838Rat
1560395Lrrc72leucine rich repeat containing 7265293538752995552Rat
1310474Togaram1TOG array regulator of axonemal microtubules 168301902583083343Rat
1310476Mphosph6-ps1M phase phosphoprotein 6, pseudogene69932107199322114Rat
1560681Rad51bRAD51 paralog B69809652598640988Rat
1311444Pnpla8patatin-like phospholipase domain containing 866132981061391736Rat
1310629Nkx2-8NK2 homeobox 867408627474087977Rat
1306504Klhdc2kelch domain containing 268777718387791609Rat
1310899Fcf1Fcf1 rRNA-processing protein6104617780104629643Rat
1310263G2e3G2/M-phase specific E3 ubiquitin protein ligase66876384768795305Rat
1309381Dicer1dicer 1 ribonuclease III6123627529123692278Rat
1307820Zfyve26zinc finger FYVE-type containing 2669803187498095538Rat
1310528Rhojras homolog family member J69403530794117642Rat
1306515Actr10actin related protein 1068944614189472350Rat
1306199Baz1abromodomain adjacent to zinc finger domain, 1A67238970172512516Rat
1305447Sptlc2serine palmitoyltransferase, long chain base subunit 26106948682107031532Rat
1308470GskipGSK3B interacting protein6124586087124609106Rat
1308278Wars1tryptophanyl-tRNA synthetase 16127776088127807273Rat
1308732Tmem30btransmembrane protein 30B69225162692254702Rat
1308005Tigar-ps1TP53 induced glycolysis regulatory phosphatase, pseudogene 168750952187511891Rat
1307543Fbxo33F-box protein 3367690061976934232Rat
1306535Dcaf5DDB1 and CUL4 associated factor 569917150699260183Rat
1306232Clec14aC-type lectin domain containing 14A67588147075884612Rat
1306238Angel1angel homolog 16106349125106386202Rat
1306241Dcaf4DDB1 and CUL4 associated factor 46103154847103180992Rat
1308036Dhrs7l1dehydrogenase/reductase (SDR family) member 7-like 169128920091312010Rat
1309492CipcCLOCK-interacting pacemaker6106595011106613732Rat
1309493Rps6kl1ribosomal protein S6 kinase-like 16104783227104799895Rat
1306250L2hgdhL-2-hydroxyglutarate dehydrogenase68816442988205585Rat
1309207Ppp2r3cprotein phosphatase 2, regulatory subunit B'', gamma67264702572670885Rat
1306949Insm2INSM transcriptional repressor 267297386172976453Rat
1308702Prpf39pre-mRNA processing factor 3968308898183113826Rat
735098Flvcr2FLVCR choline and putative heme transporter 26105408355105472355Rat
1308536Cochcochlin66903113969045124Rat
13052981700001K19RiklRIKEN cDNA 1700001K19 gene like6129681598129697052Rat
1309618Tdp1tyrosyl-DNA phosphodiesterase 16119163192119231029Rat
1308163Golga5golgin A56121612389121640552Rat
1306688Otub2OTU deubiquitinase, ubiquitin aldehyde binding 26122545067122563657Rat
1306567Trmt5tRNA methyltransferase 569196355891987660Rat
1306499Wdr20WD repeat domain 206129751952129821464Rat
1308755Rbm25RNA binding motif protein 256103271775103319090Rat
1309624EappE2F-associated phosphoprotein67216648672194357Rat
1306492Ninninein68852540588627710Rat
1308089Plekhg3pleckstrin homology and RhoGEF domain containing G369526575695308952Rat
1309103Sec23aSec23 homolog A, COPII coat complex component67665879376706125Rat
1308263Adck1aarF domain containing kinase 16107277170107377057Rat
1306798Lin52lin-52 DREAM MuvB core complex component6104098818104199323Rat
1307181Npas3neuronal PAS domain protein 367070277371527928Rat
1309058Fam161bFAM161 centrosomal protein B6103990603104007754Rat
1309059Ppp4r3aprotein phosphatase 4, regulatory subunit 3A6120302508120365907Rat
1308336Rps6ka5ribosomal protein S6 kinase A56119828823120006190Rat
1309357Lrfn5leucine rich repeat and fibronectin type III domain containing 567946640379822821Rat
1310311Dnaaf2dynein, axonemal, assembly factor 268766110187670267Rat
1310315Prox2prospero homeobox 26104731385104758619Rat
1305786Plek2pleckstrin 269770012397719417Rat
1306069Vrk1VRK serine/threonine kinase 16124914770124981508Rat
1309227Mlh3mutL homolog 36104881483104917686Rat
1310296Med6mediator complex subunit 66101270410101283929Rat
1309600Ak7adenylate kinase 76124611789124679978Rat
1308211Klhdc1kelch domain containing 168767018287765431Rat
1307704Riox1ribosomal oxygenase 16103579642103582260Rat
1308446Zdhhc22zinc finger DHHC-type palmitoyltransferase 226106629090106646996Rat
1311756DglucyD-glutamate cyclase6120055480120130910Rat
1308455Tmx1thioredoxin-related transmembrane protein 168896069188971744Rat
1308917JkampJNK1/MAPK8-associated membrane protein69064804390661985Rat
1308071Pals1protein associated with LIN7 1, MAGUK p55 family member69754813397654163Rat
1309325Trappc6btrafficking protein particle complex subunit 6B67674089876752035Rat
1309669Acot6acyl-CoA thioesterase 66103732372103741446Rat
1305248Syne2spectrin repeat containing nuclear envelope protein 269453708894848085Rat
1562299Taf8l1TATA-box binding protein associated factor 8 like 169929390799295840Rat
1563850Akr1b8-ps2aldo-keto reductase family 1, member B8, pseudogene 267756972077571967Rat
1562028Map4k5mitogen-activated protein kinase kinase kinase kinase 568828408788377118Rat
1559629Atp5mc1l2ATP synthase membrane subunit c locus 1 like 266665418766654763Rat
1359636Prps1l3phosphoribosyl pyrophosphate synthetase 1-like 367475533174763493Rat
1559545RGD1559545similar to ATPase inhibitory factor 168982191689842882Rat
1559921Mifl3macrophage migration inhibitory factor like 369926996299270606Rat
1565752Dnajc17l1DnaJ heat shock protein family (Hsp40) member C17 like 169931721899318129Rat
1561926Snw1SNW domain containing 16107095450107119536Rat
1562540Ccdc196coiled-coil domain containing 19669691396096939415Rat
1562557Zfp839zinc finger protein 8396129865859129885816Rat
1563583Ttll5tubulin tyrosine ligase like 56105483091105700920Rat
1564488Lrrc74aleucine rich repeat containing 74A6106386276106417112Rat
1563395Cinpcyclin-dependent kinase 2-interacting protein6129878618129899575Rat
1311236Slc39a9solute carrier family 39, member 96100291537100330419Rat
1565002Dhrs7dehydrogenase/reductase 769133225991347856Rat
1565006Efcab11EF-hand calcium binding domain 116119008908119162994Rat
1562149Map3k9mitogen-activated protein kinase kinase kinase 96101423754101488822Rat
1565082Nrde2NRDE-2, necessary for RNA interference, domain containing6119405103119446861Rat
1564044Kif4bkinesin family member 4B6120397064120400905Rat
1560894Ccdc175coiled-coil domain containing 17569066194890745015Rat
1563876Tc2ntandem C2 domains, nuclear6120761112120856835Rat
1564008Dact1dishevelled-binding antagonist of beta-catenin 168979067689818254Rat
1563496Wbp11-ps3WW domain binding protein 11, pseudogene 36107227781107230018Rat
1561148Gle1-ps7GLE1 RNA export mediator, pseudogene 76107144085107146180Rat
1565917Acot5acyl-CoA thioesterase 56103701908103708696Rat
1561653Hectd1HECT domain E3 ubiquitin protein ligase 166918142969268045Rat
1565716Lrrc9leucine rich repeat containing 969101773991095847Rat
1564089Acot3acyl-CoA thioesterase 36103682518103688735Rat
1359615Dlstdihydrolipoamide S-succinyltransferase6104758511104783296Rat
1563216Isca2iron-sulfur cluster assembly 26104418509104420019Rat
1311698Hhipl1HHIP-like 16127219616127243839Rat
1560978Bbof1basal body orientation factor 16104055246104081036Rat
1559456Six6os1Six6 opposite strand transcript 169157918591615183Rat
1311176Paplnpapilin, proteoglycan-like sulfated glycoprotein6103398166103432199Rat
1560932Ppp4r4protein phosphatase 4, regulatory subunit 46122663172122753988Rat
1311149Coq6coenzyme Q6 monooxygenase6104007814104019888Rat
1310497Six6SIX homeobox 669163456891639548Rat
1562381Rps17l1ribosomal protein S17 like 169523656595237253Rat
1359232Atl1atlastin GTPase 168837716888475242Rat
1359239Serpina11serpin family A member 116122903246122912695Rat
1560824Pla2g1bl1phospholipase A2 group IB like 16100679993100680397Rat
1310518Ptgr2prostaglandin reductase 26103931367103963113Rat
1312007Etv1ETS variant transcription factor 165559014955681784Rat
1561115Ccdc177coiled-coil domain containing 1776100404526100411112Rat
1561116Heatr5aHEAT repeat containing 5A66932186969419861Rat
1334065Or5ak28-ps1olfactory receptor family 5 subfamily AK member 28, pseudogene 166621392966214582Rat
1311128Bcl11bBCL11 transcription factor B6126834531126927720Rat
1560073Rps10-ps21ribosomal protein S10, pseudogene 2165666905856669628Rat
1303243Sptbspectrin, beta, erythrocytic69531034295437221Rat
1359557Esrrbestrogen-related receptor beta6106007701106163136Rat
1311832Gpr65G-protein coupled receptor 656117515786117536514Rat
1311788Tspan13tetraspanin 1365273874852765503Rat
1560838Pax9paired box 967418674974203508Rat
1560347Tex21testis expressed 2169493138894969409Rat
1359133Aldoart2aldolase 1 A retrogene 267293982172941511Rat
1311117Unc79unc-79 homolog, NALCN channel complex subunit6122082369122327641Rat
1586166Trip11thyroid hormone receptor interactor 116120995242121067693Rat
1585097Ppp2r5cprotein phosphatase 2, regulatory subunit B', gamma6129461689129598344Rat
1566396Lysetlysosomal enzyme trafficking factor6121884577121886319Rat
1359264Gphb5glycoprotein hormone subunit beta 569412996894134585Rat
1586427Pomt2protein-O-mannosyltransferase 26106755462106794849Rat
1586428Eif4a1-ps8eukaryotic translation initiation factor 4A1, pseudogene 867662386676625179Rat
1586488Ddx21-ps10DExD-box helicase 21, pseudogene 1067639943576400992Rat
1582892Pcnx4pecanex 469112506391170423Rat
1566401Meg3maternally expressed 36128491808128524010Rat
1583855Gapdh-ps92Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 9266186594961866939Rat
1583856Zfp277zinc finger protein 27765738345457512785Rat
1583978Prima1proline rich membrane anchor 16122338365122390955Rat
1586460Mrto4-ps8mRNA turnover 4, ribosome maturation factor, pseudogene 867660827276609088Rat
1359144Ubr7ubiquitin protein ligase E3 component n-recognin 76121898613121918480Rat
1583553Dnajb6-ps4DnaJ heat shock protein family (Hsp40) member B6, pseudogene 466129754961299049Rat
1563613Rps25l2ribosomal protein S25 like 265452133554521746Rat
1566112Plekhd1pleckstrin homology and coiled-coil domain containing D16100340655100371942Rat
1565985Ttc9tetratricopeptide repeat domain 96101333274101368110Rat
1561721Fscbfibrous sheath CABYR binding protein68252784982530641Rat
1561724Dock4dedicator of cytokinesis 465751292957902597Rat
1566220Heatr4HEAT repeat containing 46103574360103611578Rat
1582948Sec13-ps3SEC13 homolog, nuclear pore and COPII coat complex component, pseudogene 367890155878903012Rat
1565821Sptssaserine palmitoyltransferase, small subunit A67214471472156130Rat
1566048Pqbp1-ps2polyglutamine binding protein 1, pseudogene 26116872017116875586Rat
1559672Timm23btranslocase of inner mitochondrial membrane 23B67184524471846339Rat
1562622Tmem229btransmembrane protein 229B69777164597819582Rat
1562505Wdr25WD repeat domain 256127807347127939795Rat
1582926Rpl26-ps13ribosomal protein L26, pseudogene 1369201780192018276Rat
1563476Rpl6-ps1ribosomal protein L6, pseudogene 16123976019123977001Rat
1584965Ipo11-ps1importin 11, pseudogene 16123087818123090978Rat
1582931Pcbp2-ps9poly(rC) binding protein 2, pseudogene 967916269279163639Rat
1565693Gle1l1GLE1 RNA export mediator like 16107202205107204543Rat
1564082Vash1vasohibin 16106330374106345740Rat
1564654Syt16synaptotagmin 1669272141592972140Rat
1564946Ylpm1YLP motif containing 16104642615104718508Rat
1564393Garin2golgi associated RAB2 interactor family member 269748956297534729Rat
1589745Ndufa10l1NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10-like 165987981959881252Rat
1589343Ism2isthmin 26106921213106944291Rat
1586354Snx7-ps1sorting nexin 7, pseudogene 168893116388934114Rat
1593648Bckdk-ps1branched chain ketoacid dehydrogenase kinase, pseudogene 169792618297927900Rat
1588675Ybx1-ps24Y box binding protein 1, pseudogene 246127657376127658746Rat
1587342Ak2-ps1adenylate kinase 2, pseudogene 169701025497011724Rat
1587174Vrtnvertebrae development associated6104294655104296919Rat
1591349Dnal1dynein, axonemal, light chain 16103747801103779015Rat
1592286Rpl36-ps7ribosomal protein L36, pseudogene6113712903113717609Rat
1589336Tmed8transmembrane p24 trafficking protein family member 86106806973106841271Rat
1589285Ahsa1activator of Hsp90 ATPase activity 16106913296106921347Rat
1585290SlirpSRA stem-loop interacting RNA binding protein6107088760107097791Rat
1586305Tomm20ltranslocase of outer mitochondrial membrane 20 like68959401689612070Rat
1588546Cyp51a1-ps1cytochrome P450, family 51, subfamily a, polypeptide 1, pseudogene 167672542176727572Rat
1585189Rps3-ps6ribosomal protein S3, pseudogene 66120369120120370007Rat
1586499G3bp1-ps7G3BP stress granule assembly factor 1, pseudogene 767629770776301640Rat
1587060Ube2i-ps3ubiquitin-conjugating enzyme E2I, pseudogene 366880406168805440Rat
1589026Lrr1leucine rich repeat protein 168764319587651894Rat
1587663Ldha-ps17lactate dehydrogenase A, pseudogene 1767572705975728506Rat
1585176Kiaa0586KIAA0586 homolog68962271189725951Rat
1560665Timm17al1translocase of inner mitochondrial membrane 17a-like 167963705479637877Rat
1589818Ccdc85ccoiled-coil domain containing 85C6127113440127184328Rat
1582962Apoo-ps1apolipoprotein O, pseudogene 167885871878859404Rat
1585283Pcgf5l1polycomb group ring finger 5 like 16119916575119960703Rat
1589291Vipas39VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog6106888284106913139Rat
1583694Gle1-ps6GLE1 RNA export mediator, pseudogene 66107159244107161420Rat
1587073Lsmem1leucine-rich single-pass membrane protein 165725172057261590Rat
1589004Syndig1lsynapse differentiation inducing 1-like6104318096104344989Rat
1588211Phb2-ps3prohibitin 2, pseudogene 365698154956986759Rat
1597353Rpl23al7ribosomal protein L23A like 769170727191707812Rat
1593470Gemin8-ps8gem (nuclear organelle) associated protein 8, pseudogene 868427366484274511Rat
1597397Cct6a-ps11chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 1168044267280487379Rat
1597369Serpina1fl1serpin family A member 1F like 16122846808122858814Rat
1598344Pcna-ps1proliferating cell nuclear antigen, pseudogene 167779210877793917Rat
1597086Pnnpinin, desmosome associated protein67675813876766451Rat
1595528Susd6sushi domain containing 66100437834100531621Rat
1597377Serpina1fl2serpin family A member 1F like 26122825598122835059Rat
1595900Serpina3jserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3J6123119647123135364Rat
1595901Serpina6serpin family A member 66122780040122790274Rat
1596109Eif2d-ps2eukaryotic translation initiation factor 2D, pseudogene 268286678382868664Rat
1595690Ccnkcyclin K6127090115127113195Rat
1595691Itpk1inositol-tetrakisphosphate 1-kinase6121710750121844501Rat
1595693Cep128centrosomal protein 1286109951009110328686Rat
1595110Cers5-ps1ceramide synthase 5, pseudogene 166982385169830063Rat
1597173Acot5-ps1acyl-CoA thioesterase 5, pseudogene 16103721814103729656Rat
1597174Rpl23al8ribosomal protein L23A like 86103651415103651852Rat
1592352H2az2l2H2A.Z histone variant 2 like 268432180184322513Rat
1593493Kpna1-ps8karyopherin subunit alpha 1, pseudogene 86112516570112517700Rat
1592266Rpl11-ps10ribosomal protein L11, pseudogene 1068621246286220022Rat
1595409ErhERH, mRNA splicing and mitosis factor6100280933100291200Rat
1593640Atp5pdl1ATP synthase peripheral stalk subunit d like 169869672698697181Rat
1596753Acot4acyl-CoA thioesterase 46103668699103674037Rat
1597022Adam4l1a disintegrin and metallopeptidase domain 4-like 16101071648101074111Rat
1597025Smarce1-ps5SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1, pseudogene 568852027888524964Rat
1594757Mis18bp1MIS18 binding protein 168318249783231978Rat
1589353Noxred1NADP-dependent oxidoreductase domain containing 16106862350106888113Rat
1589363Gstz1glutathione S-transferase zeta 16106794594106805284Rat
1589368Samd15sterile alpha motif domain containing 156106841405106856197Rat
1594186Adtrp-ps1androgen-dependent TFPI-regulating protein, pseudogene 169799537297998563Rat
1598268Nt5c2-ps45'-nucleotidase, cytosolic II, pseudogene 467787813777879911Rat
1598269Paics-ps4phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase, pseudogene 467768566177687084Rat
1597693Dnajc17-ps2DnaJ heat shock protein family (Hsp40) member C17, pseudogene 26100030088100030817Rat
1598258Dnajc17-ps3DnaJ heat shock protein family (Hsp40) member C17, pseudogene 36100020724100021316Rat
1598273Ldha-ps5lactate dehydrogenase A, pseudogene 567351843473519312Rat
1598274Gapdh-ps103Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 10367348811273489095Rat
1598277Kpna1-ps3karyopherin subunit alpha 1, pseudogene 366542390965426151Rat
1598278Eno1-ps32enolase 1, pseudogene 3266184662961847912Rat
1598264Ube2e3-ps1ubiquitin-conjugating enzyme E2E 3, pseudogene 169135235091352964Rat
1598017Gpatch4-ps1G patch domain-containing protein 4, pseudogene 166180238961803939Rat
1597098Rpl3-ps6ribosomal protein L3, pseudogene 66128829406128830595Rat
1597100Phb1-ps13prohibitin 1, pseudogene 136113779124113781487Rat
1597101Pomp-ps1proteasome maturation protein, pseudogene 16113385570113386040Rat
1597102Pa2g4-ps1proliferation-associated 2G4, pseudogene 16113241238113242425Rat
1597103Aimp2-ps1aminoacyl tRNA synthetase complex-interacting multifunctional protein 2, pseudogene 16111083223111084179Rat
1598309Ppil2-ps1peptidylprolyl isomerase like 2, pseudogene 16100024128100025851Rat
3326Serpina1serpin family A member 16122866314122888339Rat
1594686Tcl1aTcl1 family Akt coactivator A6124125032124131025Rat
1598271Rps6-ps8ribosomal protein S6, pseudogene 867529572875296526Rat
1598272Pmpcb-ps2peptidase, mitochondrial processing subunit beta, pseudogene 267402462074043020Rat
1597505Faul1FAU ubiquitin like and ribosomal protein S30 fusion like 168322875183229261Rat
2302582Gon7GON7 subunit of KEOPS complex6121882565121898452Rat
2311610Cox16cytochrome c oxidase assembly factor COX166101162231101181277Rat
2315525Nemfnuclear export mediator factor68779165087835826Rat
2319740Exosc-ps1exosome component 4, pseudogene 165395086753951745Rat
2319136Micos10l1mitochondrial contact site and cristae organizing system subunit 10 like 169136525091365507Rat
2320031LOC100364934Leydig cell tumor 10 kDa protein-like66633698966337899Rat
2318430Alad-ps1aminolevulinate dehydratase, pseudogene 168691994486921014Rat
2319091Gemin8-ps1gem (nuclear organelle) associated protein 8, pseudogene 168056394380564624Rat
2321461Rpl15-ps2ribosomal protein L15, pseudogene 267411817574118794Rat
2322884Entr1l1endosome associated trafficking regulator 1 like 167933121079332658Rat
2322957Tra2a-ps1transformer 2 alpha, pseudogene 16112038960112040601Rat
2323006Rps10l1ribosomal protein S10-like 167203087672031430Rat
2320876Acp1-ps1acid phosphatase 1, pseudogene 168806492388066299Rat
2323066Mdh1-ps1malate dehydrogenase 1, pseudogene 16119361879119371771Rat
2322466Trim13-ps1tripartite motif-containing 13, pseudogene 168069387880695270Rat
2322517Fam167b-ps1family with sequence similarity 167, member B, pseudogene 168062965380630098Rat
2323161Mepce-ps1methylphosphate capping enzyme, pseudogene 16111173160111175910Rat
2323258Serpinb5-ps1serpin family B member 5, pseudogene 16115542815115543441Rat
2322650Ngrn-ps1neugrin, neurite outgrowth associated, pseudogene 16120510829120511890Rat
2322683Nkapd1-ps1NKAP domain containing 1, pseudogene 167189601971898777Rat
2323296Snrnp48-ps2small nuclear ribonucleoprotein U11/U12 subunit 48, pseudogene 266893614068948448Rat
2323500Phgdh-ps1phosphoglycerate dehydrogenase, pseudogene 166664132866642516Rat
2323565Lsm14a-ps1LSM14A mRNA processing body assembly factor, pseudogene 16109533134109534328Rat
4888535Mir3593microRNA 359367325264773252737Rat
2323636Fam177a1family with sequence similarity 177, member A167263262872647553Rat
4888541Mir1193microRNA 11936128729038128729157Rat
2323665Immp2linner mitochondrial membrane peptidase subunit 265807003558970165Rat
2323682Vti1bvesicle transport through interaction with t-SNAREs 1B69795770097976491Rat
2323695St13-ps2ST13, Hsp70 interacting protein, pseudogene 265643522256436810Rat
4888585Mir3576microRNA 35766128742173128742287Rat
4888586Mir3578microRNA 35786128758033128758149Rat
2323734Rps21-ps4ribosomal protein S21, pseudogene 46129418262129432562Rat
2323769Lrif1-ps2ligand dependent nuclear receptor interacting factor, pseudogene 26107524191107525582Rat
4888588Mir1188microRNA 11886128565919128566000Rat
2323872H3f3l1H3.3 histone like 165809993058101667Rat
2323883Pebp1-ps2phosphatidylethanolamine binding protein 1, pseudogene 265554026455540821Rat
2324554Pcbp2-ps1poly(rC) binding protein 2, pseudogene 16106300563106301925Rat
2325343Mir487bmicroRNA 487b6128741485128741566Rat
2325344Mir377microRNA 3776128755051128755122Rat
2325353Mir668microRNA 6686128749502128749569Rat
2325366Mir409microRNA 4096128757780128757856Rat
2325367Mir376amicroRNA 376a6128737966128738047Rat
2325368Mir540microRNA 5406128539185128539268Rat
2325369Mir370microRNA 3706128572257128572335Rat
2325384Mir136microRNA 1366128549096128549177Rat
2325410Mir496microRNA 4966128753644128753722Rat
2325415Mir770microRNA 7706128515843128515918Rat
2325421Mir376bmicroRNA 376b6128737456128737541Rat
2325423Mir433microRNA 4336128545119128545211Rat
2325424Mir300microRNA 3006128738513128738591Rat
2325429Mir134microRNA 1346128748908128748980Rat
2325430Mir127microRNA 1276128546215128546311Rat
2325437Mir665microRNA 6656128539440128539533Rat
2325440Mir758microRNA 7586128725838128725915Rat
2325442Mir434microRNA 4346128548163128548243Rat
2325443Mir380microRNA 3806128724830128724906Rat
2325447Mir379microRNA 3796128722040128722124Rat
2325448Mir539microRNA 5396128742193128742268Rat
2325450Mir431microRNA 4316128544210128544323Rat
2325465Mir345microRNA 3456127754027127754122Rat
2325471Mir666microRNA 6666128730863128730961Rat
2325472Mir667microRNA 6676128733932128734023Rat
2325481Mir544microRNA 5446128743530128743607Rat
2325493Mir673microRNA 6736128524261128524343Rat
2325496Mir495microRNA 4956128732650128732729Rat
2325500Mir411microRNA 4116128723189128723264Rat
2325501Mir410microRNA 4106128758358128758433Rat
2325518Mir369microRNA 3696128758054128758132Rat
2325519Mir485microRNA 4856128749660128749738Rat
2325520Mir382microRNA 3826128748539128748618Rat
2325521Mir381microRNA 3816128740976128741036Rat
2325522Mir376cmicroRNA 376c6128736800128736883Rat
2325523Mir494microRNA 4946128728710128728792Rat
2325524Mir493microRNA 4936128532492128532575Rat
2325525Mir541microRNA 5416128757016128757105Rat
2325526Mir543microRNA 5436128731000128731079Rat
2325529Mir412microRNA 4126128757932128758001Rat
2325540Mir299microRNA 2996128723664128723726Rat
2325562Mir154microRNA 1546128752947128753030Rat
2324062LOC100362796cDNA sequence BC048679-like68729662687331624Rat
2325615Mir342microRNA 3426127565269127565367Rat
2325618Mir337microRNA 3376128538903128538999Rat
2325621Mir329microRNA 3296128726508128726604Rat
2325625Mir323microRNA 3236128725539128725624Rat
4888533Mir3595microRNA 35956128737948128738067Rat
4888583Mir3579microRNA 35796128724813128724925Rat
4888593Mir3581microRNA 35816128757779128757858Rat
4888603Mir299bmicroRNA 299b6128723635128723752Rat
4888615Mir3543microRNA 35436128548130128548244Rat
2325061Ndufaf2-ps1NADH:ubiquinone oxidoreductase complex assembly factor 2, pseudogene 169907473899075236Rat
2325062Ftl1l2ferritin light chain 1 like 267324261273243527Rat
2325111Rpl36l6ribosomal protein L36 like 669880953198810620Rat
4888562Mir3544microRNA 35446128538915128539002Rat
4888569Mir3592microRNA 35926128748522128748637Rat
6489654LOC100911923uncharacterized LOC10091192367395425873994337Rat
6489824Llph-ps1LLP homolog, long-term synaptic facilitation factor, pseudogene 16121118419121119529Rat
6488546Mia2MIA SH3 domain ER export factor 267678750876885246Rat
6489562LOC100912037nuclear nucleic acid-binding protein C1D-like6121934209121936415Rat
6492129Odc1-ps1ornithine decarboxylase 1, pseudogene 16100034351100035988Rat
6487218Ndufb1NADH:ubiquinone oxidoreductase subunit B16121115649121124055Rat
6487637Hmgn4-ps1high mobility group nucleosomal binding domain 4, pseudogene 16112241807112242098Rat
6487778LOC100912332uncharacterized LOC1009123326123995949123998436Rat
6486301LOC100912568probable ATP-dependent RNA helicase DDX41-like6107230038107231786Rat
6494016Dnajc17-ps1DnaJ heat shock protein family (Hsp40) member C17, pseudogene 16100039837100040821Rat
6487545LOC100912402polyadenylate-binding protein 1-like6102655680102656969Rat
6494851Smim12-ps1small integral membrane protein 12, pseudogene 168735379387354855Rat
6501756Gsta4-ps2glutathione S-transferase alpha 4, pseudogene 268754048887541411Rat
6502380LOC100909680uncharacterized LOC10090968069748944197497915Rat
6495888LOC100910914M-phase phosphoprotein 6-like6100038861100039509Rat
6502633Serpina3aserine (or cysteine) peptidase inhibitor, clade A, member 3A6123176131123183731Rat
6503028Serpina3bl-ps1serine (or cysteine) peptidase inhibitor, clade A, member 3B like, pseudogene 16123147517123153390Rat
6500065Catsperbcation channel sperm associated auxiliary subunit beta6120418606120713160Rat
6504274Fam181afamily with sequence similarity 181, member A6122465373122471397Rat
6504372Mipol1mirror-image polydactyly 167475529375090403Rat
6497625Vdac1-ps15voltage-dependent anion channel 1, pseudogene 1568327846983279491Rat
6497809Gle1-ps8GLE1 RNA export mediator, pseudogene 86107236250107238366Rat
6501064C6h14orf132similar to human chromosome 14 open reading frame 1326124365466124398449Rat
6501076Cfl1-ps1cofilin 1, pseudogene 16116892014116892729Rat
7502513Nono-ps3non-POU domain containing, octamer-binding, pseudogene 365290116152904787Rat
7489041Mir3072microRNA 30726128763161128763271Rat
7489042Mir6331microRNA 63316128742939128743061Rat
7489043Scarna3small Cajal body-specific RNA 369922243299222521Rat
7489013Snora58small nucleolar RNA, H/ACA box 586107080945107081020Rat
7543021LOC102548124uncharacterized LOC1025481246121589794121604176Rat
7500279LOC102552766uncharacterized LOC10255276665815077658186306Rat
7532379LOC102556510uncharacterized LOC1025565106112647333112795278Rat
7501932LOC102549032uncharacterized LOC1025490326122517517122527967Rat
7532737LOC102549466uncharacterized LOC1025494666114407998114425638Rat
7513588LOC102551922uncharacterized LOC10255192268895437088960566Rat
7536015LOC102552673uncharacterized LOC1025526736101559962101564971Rat
7503266LOC102547797uncharacterized LOC10254779769772965697758676Rat
7503616Rps7-ps24ribosomal protein S7, pseudogene 2469567070895716079Rat
7503814LOC102546759uncharacterized LOC1025467596129380639129386494Rat
7503866LOC102549239uncharacterized LOC1025492396129708104129713579Rat
7646071Cetn4-ps1centrin 4, pseudogene 167217718272181768Rat
7646365LOC102548461uncharacterized LOC10254846167227414272290681Rat
7662623LOC102555554uncharacterized LOC1025555546106534079106549746Rat
7664637LOC102555254uncharacterized LOC1025552546128546730128737570Rat
7622910LOC102552601uncharacterized LOC1025526016101502291101514173Rat
7636337LOC102548370uncharacterized LOC1025483706121855315121864621Rat
7652149LOC102555435uncharacterized LOC10255543566257374162579908Rat
7653006LOC102549102uncharacterized LOC10254910268885666188887580Rat
7574917LOC102554026uncharacterized LOC1025540266125388033125393933Rat
7576094LOC102555052uncharacterized LOC1025550526127527181127572823Rat
7624969Alg11-ps2ALG11, alpha-1,2-mannosyltransferase, pseudogene 267425915874260776Rat
7625633LOC102548655uncharacterized LOC10254865568824471488246140Rat
7627887LOC102546496uncharacterized LOC10254649666690249166930836Rat
7641929Rabggtb-ps1Rab geranylgeranyltransferase subunit beta, pseudogene 169190857391913048Rat
7658560LOC102550062uncharacterized LOC1025500626116762814116822512Rat
7658903LOC102548223uncharacterized LOC10254822368793903487952758Rat
7629096LOC102547735uncharacterized LOC10254773567087483070899484Rat
7643655Tmem183a-ps2transmembrane protein 183A, pseudogene 269268808192689176Rat
7644584LOC102547663transcription factor BTF3-like68776203787762866Rat
7661450LOC102547242uncharacterized LOC1025472426129491681129503956Rat
7661508LOC102556012uncharacterized LOC10255601269516301095171054Rat
7555383Rpl37a-ps6ribosomal protein L37A, pseudogene 66121084365121085020Rat
7593102LOC102555380uncharacterized LOC10255538066252587262555470Rat
7617617LOC102552530uncharacterized LOC1025525306101390013101404833Rat
7571132LOC102546647uncharacterized LOC10254664769866611898690763Rat
7619249LOC102546421uncharacterized LOC10254642166668963566699336Rat
7578757LOC102547890uncharacterized LOC10254789067182556671832386Rat
7561334LOC102548522uncharacterized LOC10254852267222721772231374Rat
7563444LOC102550345uncharacterized LOC10255034569215313792157129Rat
7582340LOC102551114uncharacterized LOC10255111469298790693002006Rat
7564407LOC102548030uncharacterized LOC10254803068794030987945176Rat
7565188Vcpkmtvalosin containing protein lysine methyltransferase68803648588042151Rat
7551483LOC102549614uncharacterized LOC1025496146114428052114467117Rat
7735797LOC102550910uncharacterized LOC10255091069287743392904513Rat
41054297LOC120093266uncharacterized LOC1200932666117254744117258675Rat
7693843LOC102548189uncharacterized LOC1025481896121794957121797774Rat
7751922LOC102551688uncharacterized LOC10255168867388432173909296Rat
7695433LOC102549502uncharacterized LOC10254950269110387691124774Rat
7677646LOC102551214uncharacterized LOC1025512146125188093125190513Rat
7688606LOC102550434uncharacterized LOC1025504346118349962118388800Rat
7725900LOC102556158uncharacterized LOC10255615866503448965134280Rat
7690509LOC102550790uncharacterized LOC1025507906118621692118624492Rat
7712380Rpl11-ps7ribosomal protein L11, pseudogene 769494420294944813Rat
8157638Rn7sl1RNA component of signal recognition particle 7SL168763680887637106Rat
7741692LOC102552060uncharacterized LOC10255206068914475889147891Rat
7742786G6pd-ps1glucose-6-phosphate dehydrogenase, pseudogene 16120474077120476510Rat
7669283Actg1-ps1actin, gamma 1, pseudogene 165472120154722310Rat
7670252LOC102555497uncharacterized LOC1025554976123807388123825407Rat
7744018LOC102550560uncharacterized LOC1025505606118842643118860217Rat
7744426LOC102546497uncharacterized LOC10254649767326553073266513Rat
7748644LOC102552092uncharacterized LOC10255209267399997874011751Rat
7709349LOC102553798uncharacterized LOC10255379869000503790063921Rat
7728058LOC102557478uncharacterized LOC10255747866844343768505774Rat
7728577LOC102549675uncharacterized LOC1025496756104984524104992105Rat
7709993LOC102552965uncharacterized LOC1025529656102119638102129558Rat
7729423LOC102555774uncharacterized LOC1025557746128368728128369886Rat
7729657LOC102550757uncharacterized LOC1025507576124377500124379015Rat
7681866LOC102547293uncharacterized LOC1025472936103270272103271699Rat
9129693LOC103692636uncharacterized LOC10369263667190298071916408Rat
9093992LOC103690066uncharacterized LOC1036900666101227472101246665Rat
9072809LOC103692621oligosaccharyltransferase complex subunit OSTC pseudogene66043133660453277Rat
9078820LOC103692684small ubiquitin-related modifier 2 pseudogene6113315103113315382Rat
9191681LOC103692694uncharacterized LOC1036926946121659956121661648Rat
9159722LOC103695309glyceraldehyde-3-phosphate dehydrogenase pseudogene67706861277069628Rat
9167354LOC103695296glyceraldehyde-3-phosphate dehydrogenase pseudogene67232884872329825Rat
9170090LOC103692702uncharacterized LOC1036927026126902609126910743Rat
9083574LOC103690152disintegrin and metalloproteinase domain-containing protein 21-like6101256441101265828Rat
9084011LOC10369265340S ribosomal protein SA pseudogene69011930790120185Rat
9323203Cetn2l1centrin 2 like 169828300098283445Rat
9325997Rps18-ps3ribosomal protein S18, pseudogene 36128196864128208694Rat
9378291Mterf1-ps4mitochondrial transcription termination factor 1, pseudogene 468507777585097837Rat
9242302LOC103692643uncharacterized LOC10369264368237426182378710Rat
9338625LOC103692704uncharacterized LOC1036927046126862869126863838Rat
9299213Chchd2l2-ps4coiled-coil-helix-coiled-coil-helix domain containing protein 2-like 2, pseudogene 465330935553311115Rat
9299214LOC103692654chloride intracellular channel protein 4 pseudogene68814629188151998Rat
9263034LOC103692620thyroid hormone receptor-associated protein 3 pseudogene65483121154835676Rat
9317184LOC103692627uncharacterized LOC10369262766260211862606902Rat
9427736Odc1-ps6ornithine decarboxylase 1, pseudogene 669932568899326687Rat
9439988LOC103692705S-phase kinase-associated protein 1 pseudogene6127712011127722620Rat
9219694LOC103692628uncharacterized LOC10369262866696117167055411Rat
9685092Mir1247microRNA 12476129284560129284641Rat
9685630Mir341microRNA 3416128565581128565676Rat
11360540Rpl35al8ribosomal protein L35A like 869164430291644739Rat
11370304LOC108351238uncharacterized LOC10835123867371889173725872Rat
11454361LOC108351251uncharacterized LOC10835125169148942091503040Rat
11455066LOC108351364uncharacterized LOC10835136467812468678134031Rat
11463868LOC108351290uncharacterized LOC1083512906118980141118993039Rat
11469370Rpl35al2ribosomal protein L35A like 26129733876129734339Rat
11472163Rpl36a-ps20ribosomal protein L36A, pseudogene 2069100452191004960Rat
11359726LOC108351293uncharacterized LOC1083512936122642415122658489Rat
11457500LOC10835125360S ribosomal protein L9 pseudogene69064722690647925Rat
11458125LOC108351302uncharacterized LOC1083513026129854738129863427Rat
11366014LOC108351376uncharacterized LOC1083513766129009585129011926Rat
11359984LOC108351275uncharacterized LOC1083512756105368936105409361Rat
11362626Eno1l1enolase 1 like 16122171317122172034Rat
11450428LOC108351230uncharacterized LOC10835123066260524662616196Rat
11440663LOC108351235tensin-2 pseudogene66959456869601783Rat
11452082LOC108351240uncharacterized LOC10835124067432347874333662Rat
11433025LOC10835127440S ribosomal protein S28 pseudogene6105086345105088164Rat
11425096LOC108351370uncharacterized LOC1083513706106468037106470741Rat
11385023LOC108351280uncharacterized LOC1083512806106517139106524101Rat
11395481LOC108351294uncharacterized LOC1083512946122952602122955489Rat
11407073LOC108351229transformer-2 protein homolog alpha pseudogene66184100361841697Rat
11407250LOC108351259uncharacterized LOC10835125969298123392987867Rat
11375288LOC108351336U6 snRNA-associated Sm-like protein LSm8 pseudogene69754355197545937Rat
11398630LOC108351227uncharacterized LOC10835122765434308154383179Rat
11387951Ppia-ps6peptidylprolyl isomerase A, pseudogene 668281357082814071Rat
11378340Rtl1retrotransposon-like 16128543904128549384Rat
11390493LOC108351266uncharacterized LOC10835126669871077098715952Rat
11391162Trnak-cuu9transfer RNA lysine (anticodon CUU) 968947829889478370Rat
11392001LOC108351289uncharacterized LOC1083512896115890070116122724Rat
11382383Rps26-ps5ribosomal protein S26, pseudogene 565298065552996561Rat
11500716LOC108351250uncharacterized LOC10835125069032156390324236Rat
11513758LOC108351371non-histone chromosomal protein HMG-17 pseudogene6106591118106594921Rat
11518989LOC108351363uncharacterized LOC10835136365438326654384851Rat
11519512LOC108351282uncharacterized LOC1083512826107054936107062699Rat
11519988LOC108351283uncharacterized LOC1083512836109281426109294716Rat
11503689LOC108351299uncharacterized LOC1083512996127666911127676950Rat
11509237LOC108351242uncharacterized LOC10835124268432810184449141Rat
11511766Trnai-aau3transfer RNA isoleucine (anticodon AAU) 36129861605129861678Rat
11515855LOC108351257uncharacterized LOC10835125769172975191740470Rat
11486546LOC108351288uncharacterized LOC1083512886114764986114777523Rat
11488287LOC108351243uncharacterized LOC10835124368444920884471178Rat
11491526LOC108351236uncharacterized LOC10835123667249434372522266Rat
14398595Mir3084a-4microRNA mir-3084a-468781508487815152Rat
41320628LOC120103573uncharacterized LOC1201035736103790733103803320Rat
41378797LOC120093383small nucleolar RNA SNORD113/SNORD114 family6128687695128687769Rat
41086662Ldha-ps27lactate dehydrogenase A, pseudogene 2767353767673538554Rat
41087372LOC120093280U6 spliceosomal RNA67723686577236971Rat
41111149LOC120093440small nucleolar RNA SNORA1767746342877463557Rat
41167763Odc1-ps10ornithine decarboxylase 1, pseudogene 106100080927100081946Rat
41167955LOC120093483small nucleolar RNA U136104716796104716890Rat
41235214LOC120093479small nucleolar RNA SNORA796110505359110505501Rat
41275552LOC120093402small nucleolar RNA SNORD113/SNORD114 family6128686121128686195Rat
41276741LOC120093338small nucleolar RNA SNORD113/SNORD114 family6128634442128634531Rat
41281687Arl1-ps1ADP-ribosylation factor like GTPase 1, pseudogene 166895551168962169Rat
41356638LOC120093321small nucleolar RNA SNORD113/SNORD114 family6128619282128619366Rat
41088076LOC120093378small nucleolar RNA SNORD113/SNORD114 family6128612139128612232Rat
41088236LOC120103610uncharacterized LOC1201036106123970723123979025Rat
41139916Scarna13small Cajal body-specific RNA 136123986822123987096Rat
41168923LOC120093376small nucleolar RNA SNORD113/SNORD114 family6128611249128611334Rat
41276988Snord114-9small nucleolar RNA, C/D box 114-96128698823128698888Rat
41278108LOC120093303U6 spliceosomal RNA67249442772494534Rat
41284066LOC120093329small nucleolar RNA SNORD113/SNORD114 family6128637122128637209Rat
41324021LOC120093288U6 spliceosomal RNA6111923640111923746Rat
41324736LOC120103589uncharacterized LOC1201035896107352595107356059Rat
41088860LOC120093460small nucleolar RNA SNORA1768486751684867654Rat
41114783LOC120103593uncharacterized LOC1201035936111580380111685123Rat
41114950LOC120093357U1 spliceosomal RNA67220306672203228Rat
41140941LOC120093313U1 spliceosomal RNA67221868472218847Rat
41205767LOC120103624uncharacterized LOC1201036246129604949129609313Rat
41251471LOC120093339small nucleolar RNA SNORD113/SNORD114 family6128656723128656813Rat
41278504LOC120093504U4 spliceosomal RNA68906885389069001Rat
41279125LOC120093381small nucleolar RNA SNORD113/SNORD114 family6128648708128648796Rat
41279451Gle1-ps2GLE1 RNA export mediator, pseudogene 26107183066107185118Rat
41325645LOC120093356small nucleolar RNA SNORD113/SNORD114 family6128635336128635420Rat
41326035LOC120093326small nucleolar RNA SNORD113/SNORD114 family6128640674128640760Rat
41359618LOC120093501U4 spliceosomal RNA68280110282801218Rat
41384195LOC120093341small nucleolar RNA SNORD113/SNORD114 family6128621064128621155Rat
41384656LOC120093424small nucleolar RNA SNORA2/SNORA34 family67109002471090159Rat
41171343Trnap-agg18transfer RNA proline (anticodon AGG) 186124718914124718994Rat
41172264LOC120103531uncharacterized LOC12010353166668467466685883Rat
41206585LOC120093507U6 spliceosomal RNA68993071789930823Rat
41252287LOC120093307U6 spliceosomal RNA6119915820119915922Rat
41254020LOC120093508U6 spliceosomal RNA67081389370813999Rat
41279995LOC120093283U6 spliceosomal RNA66060760760607713Rat
41280372LOC120093391small nucleolar RNA SNORD113/SNORD114 family6128683564128683638Rat
41287336LOC120093349small nucleolar RNA SNORD113/SNORD114 family6128618385128618479Rat
41326578Ppid-ps7peptidylprolyl isomerase D, pseudogene 769080428990850500Rat
41386977LOC120103557uncharacterized LOC12010355769677556596786927Rat
41092179LOC120093263uncharacterized LOC1200932636109331773109333653Rat
41145298LOC120103582uncharacterized LOC1201035826107013477107021229Rat
41146325LOC120103617uncharacterized LOC1201036176127125741127128210Rat
41172970LOC120103596uncharacterized LOC1201035966113973500114024212Rat
41173474Acp1-ps3acid phosphatase 1, pseudogene 36110657818110672588Rat
41173563LOC120093276U6 spliceosomal RNA66175955261759658Rat
41209044Hsp90ab1-ps16heat shock protein 90 alpha family class B member 1, pseudogene 1667750202177511120Rat
41259651LOC120103592uncharacterized LOC1201035926110747194110756876Rat
41328006LOC120103546uncharacterized LOC12010354668906754789082421Rat
41328288LOC120093502U4 spliceosomal RNA66469570864695834Rat
41092923LOC120103598uncharacterized LOC1201035986119121338119134319Rat
41093004LOC120093332small nucleolar RNA SNORD113/SNORD114 family6128642454128642542Rat
41118376LOC120093372small nucleolar RNA SNORD113/SNORD114 family6128629093128629186Rat
41147718LOC120093342small nucleolar RNA SNORD113/SNORD114 family6128645131128645222Rat
41174745LOC120093305U6 spliceosomal RNA69547414695474248Rat
41174787Snord13l1small nucleolar RNA, C/D box 13 like 168714123087141336Rat
41328737Snord114-4small nucleolar RNA, C/D box 114-46128680869128680943Rat
41329629LOC120093369small nucleolar RNA SNORD113/SNORD114 family6128657621128657701Rat
41362480LOC120093367small nucleolar RNA SNORD113/SNORD114 family6128655837128655917Rat
41362567LOC120093343small nucleolar RNA SNORD113/SNORD114 family6128623750128623830Rat
41363902LOC120093216uncharacterized LOC1200932166102742656102752167Rat
41390018LOC120093403small nucleolar RNA SNORD113/SNORD114 family6128692417128692491Rat
41120331LOC120093256uncharacterized LOC12009325668331404683353136Rat
41148093U2l3U2 spliceosomal RNA like 367673093876731128Rat
41149207LOC120093352small nucleolar RNA SNORD113/SNORD114 family6128646026128646114Rat
41188210Trnaa-agc97transfer RNA alanine (anticodon AGC) 9769449270394492783Rat
41212191LOC120093497U4 spliceosomal RNA67169935171699530Rat
41261849LOC120093286U6 spliceosomal RNA6107091675107091774Rat
41261948LOC120093360small nucleolar RNA SNORD113/SNORD114 family6128627320128627400Rat
41330629LOC120103609uncharacterized LOC1201036096123885118123886137Rat
41331265Ldha-ps26lactate dehydrogenase A, pseudogene 2667352805573528933Rat
41365158LOC120103579uncharacterized LOC1201035796105420290105426393Rat
41390874LOC120093354small nucleolar RNA SNORD113/SNORD114 family6128608583128608663Rat
41097438LOC120093220uncharacterized LOC1200932206109042644109052706Rat
41188981Ddx41-ps1DEAD-box helicase 41, pseudogene 16107156477107157149Rat
41189254LOC120103554uncharacterized LOC12010355469438221594395832Rat
41189413LOC120093406small nucleolar RNA SNORD113/SNORD114 family6128605921128606002Rat
41190543LOC120103584WW domain-binding protein 11-like6107141542107143455Rat
41263556LOC120093490U2 spliceosomal RNA65662950456629658Rat
41343341LOC120093379U1 spliceosomal RNA67170661771706776Rat
41392365LOC120093451small nucleolar RNA SNORA1765658492756585050Rat
41393512LOC120093467small nucleolar RNA SNORA1767401621574016333Rat
41122326LOC120093344small nucleolar RNA SNORD113/SNORD114 family6128626423128626516Rat
41155391LOC120093489U2 spliceosomal RNA67521655975216724Rat
41155533LOC120103612MLV-related proviral Env polyprotein-like6124185344124193006Rat
41179058LOC120103570uncharacterized LOC1201035706100819254100820366Rat
41179368LOC120093436small nucleolar RNA SNORA1768277764282777773Rat
41191761Mt1-ps4metallothionein 1, pseudogene 46104866408104866746Rat
41265170LOC120093441small nucleolar RNA SNORA176109773449109773570Rat
41266297LOC120093380small nucleolar RNA SNORD113/SNORD114 family6128616600128616685Rat
41343659LOC120093108dehydrogenase/reductase SDR family member 7-like69119740591207825Rat
41343863LOC120093465U2 spliceosomal RNA68601876886018953Rat
41367672LOC120093335U1 spliceosomal RNA67222704472227207Rat
41394202LOC120093347small nucleolar RNA SNORD113/SNORD114 family6128615703128615797Rat
41156721LOC120093430small nucleolar RNA SNORA4868340667483406809Rat
41156922LOC120093410small nucleolar RNA SNORD113/SNORD114 family6128607734128607815Rat
41180861LOC120093361small nucleolar RNA SNORD113/SNORD114 family6128632662128632742Rat
41192509LOC120093462small nucleolar RNA SNORA1766219361062193737Rat
41215294Rpl26-ps4ribosomal protein L26, pseudogene 469206709892067681Rat
41267199LOC120093353small nucleolar RNA SNORD113/SNORD114 family6128650489128650574Rat
41288671LOC120093398small nucleolar RNA SNORD113/SNORD114 family6128628206128628291Rat
41344747LOC120093373small nucleolar RNA SNORD113/SNORD114 family6128614814128614899Rat
41344929LOC120093217uncharacterized LOC1200932176102770524102773333Rat
41369129LOC12010356260S ribosomal protein L39-like69880152498804501Rat
41369745LOC120103553uncharacterized LOC12010355369263794692672153Rat
41370298Ppa2-ps1inorganic pyrophosphatase 2, pseudogene67985657179860348Rat
41397045LOC120093385small nucleolar RNA SNORD113/SNORD114 family6128684429128684503Rat
41125462LOC120093365small nucleolar RNA SNORD113/SNORD114 family6128651382128651462Rat
41157524LOC120103524uncharacterized LOC12010352465595678756049486Rat
41158859LOC120093359small nucleolar RNA SNORD113/SNORD114 family6128613924128614009Rat
41194368LOC120093500U4 spliceosomal RNA68086314280863276Rat
41268372LOC120093449small nucleolar RNA SNORA1766285928762859414Rat
41268906LOC120103525uncharacterized LOC12010352565940358259425212Rat
41290586LOC120093370small nucleolar RNA SNORD113/SNORD114 family6128660294128660374Rat
41346464LOC120093503U4 spliceosomal RNA6104736554104736684Rat
41372328LOC120093260uncharacterized LOC12009326069029469090296402Rat
41372374LOC120093491U2 spliceosomal RNA66251956662519704Rat
41398603LOC120103616uncharacterized LOC1201036166124801304124804030Rat
41054114LOC120093323small nucleolar RNA SNORD113/SNORD114 family6128625535128625619Rat
41070124Snora32small nucleolar RNA, H/ACA box 3268528818185288298Rat
41103385LOC120093278U6 spliceosomal RNA67006837370068479Rat
41159797LOC120103555uncharacterized LOC12010355569483906194841971Rat
41160803LOC120103597uncharacterized LOC1201035976117761295117766526Rat
41195602LOC120093317small nucleolar RNA SNORA73 family66305535063055553Rat
41195695LOC120093493small nucleolar RNA U365380824353808325Rat
41195836LOC120093301U6 spliceosomal RNA67217547672175575Rat
41270223LOC120093474small nucleolar RNA SNORA406119394859119394983Rat
41348190LOC120093363small nucleolar RNA SNORD113/SNORD114 family6128646922128647002Rat
41348930Snord113l3small nucleolar RNA, C/D box 113 like 36128602941128603014Rat
41349033LOC120103602uncharacterized LOC1201036026120105366120116156Rat
41399987LOC120093345small nucleolar RNA SNORD113/SNORD114 family6128647809128647902Rat
41104368LOC120093427U11 spliceosomal RNA6104333711104333844Rat
41104710Snord127small nucleolar RNA, C/D box 12768310859683108680Rat
41128136Odc1-ps9ornithine decarboxylase 1, pseudogene 969931392799316759Rat
41185800LOC120093392small nucleolar RNA SNORD113/SNORD114 family6128661181128661261Rat
41185972LOC120103599uncharacterized LOC1201035996119332947119343742Rat
41186164LOC120093471small nucleolar RNA SNORA176112794531112794642Rat
41186844LOC120093396small nucleolar RNA SNORD113/SNORD114 family6128693128128693202Rat
41196598LOC120093384small nucleolar RNA SNORD113/SNORD114 family6128609468128609557Rat
41229061LOC120093269uncharacterized LOC1200932696129200778129205127Rat
41271388LOC120093314U6 spliceosomal RNA67757123077571335Rat
41293354LOC120103536uncharacterized LOC12010353666919891369201280Rat
41293789Trnaa-agc62transfer RNA alanine (anticodon AGC) 6267169429071694370Rat
41350299LOC120093284U6 spliceosomal RNA66862788368627990Rat
41374274LOC120103543uncharacterized LOC12010354368739378087415424Rat
41374377Arf1-ps2ADP-ribosylation factor 1, pseudogene 26109430838109431318Rat
41400444LOC120093389small nucleolar RNA SNORD113/SNORD114 family6128613035128613119Rat
41401479LOC120093388small nucleolar RNA SNORD113/SNORD114 family6128630879128630964Rat
41105615LOC120093496U4 spliceosomal RNA6113480735113480820Rat
41199209Snord45l1small nucleolar RNA, C/D box 45 like 168941468289414752Rat
41351694LOC120093399small nucleolar RNA SNORD113/SNORD114 family6128685136128685210Rat
41082530LOC120093308U6 spliceosomal RNA6112567734112567838Rat
41164084LOC120093355small nucleolar RNA SNORD113/SNORD114 family6128654939128655031Rat
41199827LOC120093371small nucleolar RNA SNORD113/SNORD114 family6128622851128622945Rat
41200290LOC120093485U2 spliceosomal RNA66451313164513345Rat
41353003LOC120103578uncharacterized LOC1201035786105082756105103477Rat
41085348LOC120103595uncharacterized LOC1201035956112849326112890327Rat
41110107LOC120093287U6 spliceosomal RNA6112215144112215251Rat
41110432Max-ps2MYC associated factor X, pseudogene 265294876252950726Rat
41133404LOC120093334small nucleolar RNA SNORD113/SNORD114 family6128621960128622046Rat
41165480LOC120093298U6 spliceosomal RNA65422698154227085Rat
41166107Gle1-ps4GLE1 RNA export mediator, pseudogene 46107150543107152648Rat
40945147LOC120093279U6 spliceosomal RNA67006906070069166Rat
40971021LOC120093210uncharacterized LOC12009321067230649372316083Rat
40972135LOC120093296U6 spliceosomal RNA6107418656107418761Rat
40996730Gle1-ps3GLE1 RNA export mediator, pseudogene 36107225279107227328Rat
40997044LOC120093455small nucleolar RNA SNORA1766684549766845624Rat
40997153Eif5-ps7eukaryotic translation initiation factor 5, pseudogene 769699679296997862Rat
40998058Odc1-ps3ornithine decarboxylase 1, pseudogene 36100007232100008388Rat
40946442LOC120093470small nucleolar RNA SNORA1769185127491851333Rat
40947446LOC120093250uncharacterized LOC12009325066474904964779502Rat
40972370LOC120093400small nucleolar RNA SNORD113/SNORD114 family6128691555128691629Rat
40972851LOC120093330small nucleolar RNA SNORD113/SNORD114 family6128639784128639871Rat
40972876LOC12009324760S ribosomal protein L29-like65688837256888994Rat
41010932LOC120103563uncharacterized LOC12010356369886602798869636Rat
40948191LOC120093382small nucleolar RNA SNORD113/SNORD114 family6128629993128630073Rat
40949261LOC120103565uncharacterized LOC12010356569926055799267559Rat
41340039LOC120103618uncharacterized LOC1201036186127146213127156888Rat
40950765LOC120093319U7 small nuclear RNA66238648762386545Rat
40951447LOC120103529uncharacterized LOC12010352966495868964973053Rat
40952038Ftl1-ps2ferritin light chain 1, pseudogene 26110989982110994781Rat
40952085S100a11-ps4S100 calcium binding protein A11, pseudogene 469701817797018474Rat
40976240LOC120093325small nucleolar RNA SNORD113/SNORD114 family6128638011128638097Rat
40977525LOC120093395small nucleolar RNA SNORD113/SNORD114 family6128689983128690057Rat
40977532LOC120103547uncharacterized LOC12010354769057634790580724Rat
41013013LOC120103615uncharacterized LOC1201036156124487294124510781Rat
41013569Snora50dsmall nucleolar RNA, H/ACA box 50D69587414995874265Rat
40978400LOC120103583uncharacterized LOC1201035836107060560107071738Rat
40978870LOC120093300U6 spliceosomal RNA67775521977755326Rat
40927049LOC120093488U2 spliceosomal RNA69160922691609398Rat
40955620LOC120103594uncharacterized LOC1201035946112752467112766151Rat
40956319LOC120093464small nucleolar RNA SNORA1769687980896879931Rat
40956471LOC120093469small nucleolar RNA SNORA1769651141596511548Rat
40980064LOC120103620uncharacterized LOC1201036206127316410127320301Rat
40998590LOC120093311U6 spliceosomal RNA67990149179901594Rat
40957535LOC120093486U2 spliceosomal RNA68021546380215666Rat
40958936LOC120093448small nucleolar RNA SNORA1768351670483516832Rat
40982521LOC120103556uncharacterized LOC12010355669511208995125645Rat
41003040LOC120103526uncharacterized LOC12010352666127517661282214Rat
41004139LOC120093468small nucleolar RNA SNORA1766583512565835255Rat
41005495LOC120103604uncharacterized LOC1201036046121067891121073737Rat
40934694LOC120093461small nucleolar RNA SNORA1765839618358396315Rat
40934901Trnag-acctransfer RNA glycine (anticodon ACC)6106609469106609549Rat
40935150LOC120093377small nucleolar RNA SNORD113/SNORD114 family6128641568128641648Rat
40935991LOC120093509U6 spliceosomal RNA6104314104104314210Rat
40986010LOC120093463small nucleolar RNA SNORA1765311671453116830Rat
41008008LOC120103588WW domain-binding protein 11-like6107238873107240904Rat
40937433LOC120093328small nucleolar RNA SNORD113/SNORD114 family6128633548128633635Rat
40963012LOC120093310U6 spliceosomal RNA67480579574805882Rat
41008056Prmt1-ps2protein arginine methyltransferase 1, pseudogene 26112302396112303446Rat
41008057LOC120093202uncharacterized LOC12009320265750914557509600Rat
40939369Snord113l1small nucleolar RNA, C/D box 113 like 16128690850128690924Rat
40964578Hnrnpa1-ps2heterogeneous nuclear ribonucleoprotein A1, pseudogene 265369794153700119Rat
40988969LOC120093316small nucleolar RNA SNORA73 family69126560891265811Rat
40990865Ddx41l1DEAD-box helicase 41 like 16107185923107187961Rat
41010064LOC120093251uncharacterized LOC12009325166856912168571922Rat
40967547LOC120093292U6 spliceosomal RNA67335971173359813Rat
40970300LOC120093364small nucleolar RNA SNORD113/SNORD114 family6128649604128649684Rat
41074541LOC120093346U1 spliceosomal RNA67220576072205923Rat
41075203LOC120103538uncharacterized LOC12010353867376066973766166Rat
41243105LOC120103432small nuclear ribonucleoprotein E-like6129039209129040800Rat
41311451LOC120093472small nucleolar RNA SNORA176125122345125122428Rat
41312804Rplp0-ps9ribosomal protein lateral stalk subunit P0, pseudogene 965568605455686977Rat
41025079LOC120093443U2 spliceosomal RNA65660011356600288Rat
41049039Pcnx4l1pecanex 4 like 169125465791258779Rat
41049116LOC120103619uncharacterized LOC1201036196127279924127284440Rat
41076723LOC120093387small nucleolar RNA SNORD113/SNORD114 family6128689272128689346Rat
41244694LOC120093351small nucleolar RNA SNORD113/SNORD114 family6128652269128652353Rat
41244973LOC120093411small nucleolar RNA SNORD113/SNORD114 family6128600461128600532Rat
41078264LOC120093457small nucleolar RNA SNORA176123334321123334451Rat
41245168LOC120093374small nucleolar RNA SNORD113/SNORD114 family6128610367128610447Rat
41245801LOC120093302U1 spliceosomal RNA67221144572211608Rat
41246610LOC120103571uncharacterized LOC1201035716100904353100930460Rat
41315759LOC120093394small nucleolar RNA SNORD113/SNORD114 family6128688406128688480Rat
41316972LOC120093257uncharacterized LOC12009325768417249884177501Rat
41027090LOC120103607uncharacterized LOC1201036076122464871122469084Rat
41050981LOC120093454U2 spliceosomal RNA67649533176495501Rat
41247829LOC120093362small nucleolar RNA SNORD113/SNORD114 family6128638898128638978Rat
41319232LOC120093261uncharacterized LOC12009326169433207794334223Rat
41319468LOC120093324U1 spliceosomal RNA67222436972224532Rat
41029651LOC120093358small nucleolar RNA SNORD113/SNORD114 family6128606833128606913Rat
41029885LOC120093291U1 spliceosomal RNA67219467172194834Rat
41052990LOC120103560uncharacterized LOC12010356069873266698741653Rat
41135267LOC120093458small nucleolar RNA SNORA1766688136966881496Rat
41333177LOC12010357260S ribosomal protein L21-like6101527260101527772Rat
412556112310015A10RiklRIKEN cDNA 2310015A10 gene like69894309698960308Rat
41256286LOC120093407small nucleolar RNA SNORD113/SNORD114 family6128698386128698448Rat
41256622LOC120093393small nucleolar RNA SNORD113/SNORD114 family6128686834128686908Rat
41338597LOC120103552uncharacterized LOC12010355269210173992105881Rat
41338607LOC120093340small nucleolar RNA SNORD113/SNORD114 family6128636229128636319Rat
41339141LOC120093204uncharacterized LOC12009320465819694858227730Rat
41151289LOC120103564uncharacterized LOC12010356469899946799001347Rat
41257709LOC120103532uncharacterized LOC12010353266779498267868731Rat
41335350LOC120093450small nucleolar RNA SNORA1767371998573720115Rat
41335931LOC120103621uncharacterized LOC1201036216127678080127686970Rat
41336004LOC120093327small nucleolar RNA SNORD113/SNORD114 family6128643345128643431Rat
41032403Rps8-ps6ribosomal protein S8, pseudogene 668761771287619541Rat
41057966LOC120093386small nucleolar RNA SNORD113/SNORD114 family6128693996128694070Rat
41315408LOC120093366small nucleolar RNA SNORD113/SNORD114 family6128653162128653242Rat
41033385LOC120093510U6 spliceosomal RNA67563707175637177Rat
41033419Cbx1-ps2chromobox 1, pseudogene 269713808397147280Rat
41059523LOC120093435small nucleolar RNA SNORA4865307013453070273Rat
41059572Odc1-ps11ornithine decarboxylase 1, pseudogene 116100089343100090052Rat
41059820LOC120093445small nucleolar RNA SNORA176102427215102427337Rat
41224543Snord113-3small nucleolar RNA, C/D box 113-36128585558128585628Rat
41337874LOC120103580uncharacterized LOC1201035806106278424106285263Rat
41337983Prdx1-ps3peroxiredoxin 1, pseudogene 36119378967119380117Rat
41034983LOC120093442small nucleolar RNA SNORA1765639963256399763Rat
41035462Snora26l1small nucleolar RNA, H/ACA box 26 like 167682355176823672Rat
41061531TunarTCL1 upstream neural differentiation-associated RNA6124245949124293440Rat
41061609LOC120093487U2 spliceosomal RNA68471415384714319Rat
41334056LOC120093203uncharacterized LOC12009320365841472558430740Rat
41035849LOC120093322small nucleolar RNA SNORD113/SNORD114 family6128659404128659487Rat
41063312LOC120093506U6 spliceosomal RNA6120492486120492592Rat
41064761LOC120093331small nucleolar RNA SNORD113/SNORD114 family6128654051128654138Rat
41226908LOC120093484small nucleolar RNA U1096112175841112175977Rat
41227971LOC120093434small nucleolar RNA SNORA4867210130272101443Rat
41235353LOC120103545uncharacterized LOC12010354568795605487974828Rat
41302933Gapdh-ps90Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 9066739692267441051Rat
41303109LOC120093206uncharacterized LOC12009320667220087072202818Rat
41016925U3l1small nucleolar RNA U3 like 167965620179656389Rat
41039793Ngrn-ps2neugrin, neurite outgrowth associated, pseudogene 26120523873120524934Rat
41040063LOC120093337small nucleolar RNA SNORD113/SNORD114 family6128631767128631856Rat
41236256LOC120103550uncharacterized LOC12010355069142876991442772Rat
41236974LOC120093397small nucleolar RNA SNORD113/SNORD114 family6128624638128624730Rat
41305281Trnav-aac44transfer RNA valine (anticodon AAC) 4467469405574694135Rat
41067375Prelid1-ps3PRELI domain containing 1, pseudogene 367661641576617250Rat
41067405Trnaa-agc24transfer RNA alanine (anticodon AGC) 2468944089989440979Rat
41237657LOC120093277U6 spliceosomal RNA6114359059114359165Rat
41020046LOC120093348small nucleolar RNA SNORD113/SNORD114 family6128617490128617584Rat
41020689LOC120103542uncharacterized LOC12010354268650696286535785Rat
41044336LOC120093320U7 small nuclear RNA6117846274117846336Rat
41239514LOC120093306U6 spliceosomal RNA69609555596095658Rat
41239806LOC120103623uncharacterized LOC1201036236128737719128764820Rat
41044899LOC120103539uncharacterized LOC12010353967465429674666802Rat
41241342LOC120093336small nucleolar RNA SNORD113/SNORD114 family6128658508128658597Rat
41309799LOC120093333small nucleolar RNA SNORD113/SNORD114 family6128644237128644325Rat
41023111LOC120103622uncharacterized LOC1201036226128369997128387872Rat
41023230LOC120093444small nucleolar RNA SNORA1768369407183694202Rat
41023625LOC120093350small nucleolar RNA SNORD113/SNORD114 family6128620173128620263Rat
1561833Zmym6zinc finger MYM-type containing 65139396374139444357Rat
621236Ubr5ubiquitin protein ligase E3 component n-recognin 576911521669224843Rat
3449Sirpasignal-regulatory protein alpha3116819730116858099Rat
3454Ptprjprotein tyrosine phosphatase, receptor type, J37640591776561842Rat
620027Chrm5cholinergic receptor, muscarinic 539928484699337252Rat
68952Ryr3ryanodine receptor 339943175599979125Rat
3669Scg5secretogranin V3100544101100588558Rat
68430Pdia3protein disulfide isomerase family A, member 33108388189108412013Rat
619884Hipk3homeodomain interacting protein kinase 339079698090866701Rat
2205Bfsp1beaded filament structural protein 13131195087131252668Rat
2211Bmp2bone morphogenetic protein 23120812660120822579Rat
621113Ttltubulin tyrosine ligase3116298813116328538Rat
3269Pcnaproliferating cell nuclear antigen3119499039119502911Rat
3734Sordsorbitol dehydrogenase3109184697109216133Rat
3258Pax6paired box 639212877292157022Rat
61805Fgf7fibroblast growth factor 73113280448113333279Rat
3974Wt1WT1 transcription factor39156654091613653Rat
2311Cd59bCD59b molecule39045908590477571Rat
70888Kcnip3potassium voltage-gated channel interacting protein 33114677027114742923Rat
3539Rasgrp1RAS guanyl releasing protein 13104168549104230107Rat
3542Rbbp9RB binding protein 9, serine hydrolase3131925095131939042Rat
2189B2mbeta-2 microglobulin3109095740109101764Rat
619750Slc30a4solute carrier family 30 member 43109753270109775306Rat
2808Foxa2forkhead box A23135470123135474326Rat
3273Pcsk2proprotein convertase subtilisin/kexin type 23130880422131183127Rat
61840Slc28a2solute carrier family 28 member 23109324815109387702Rat
3410Prnpprion protein3119186073119201513Rat
3450Ptpraprotein tyrosine phosphatase, receptor type, A3117650146117759744Rat
70929Dgkzdiacylglycerol kinase zeta37790414977946114Rat
70937Mapk8ip1mitogen-activated protein kinase 8 interacting protein 137835505178372946Rat
3345Plcb4phospholipase C, beta 43122952965123322522Rat
69070Cd82Cd82 molecule37938736179431847Rat
619725Entpd6ectonucleoside triphosphate diphosphohydrolase 63139575659139598163Rat
619731Lrp4LDL receptor related protein 437742960077483593Rat
69283MertkMER proto-oncogene, tyrosine kinase3115939351116045141Rat
2790Hdchistidine decarboxylase3113847256113865334Rat
3460Pygbglycogen phosphorylase B3139611724139658521Rat
2694Gjd2gap junction protein, delta 23100771450100776134Rat
2936Ivdisovaleryl-CoA dehydrogenase3105851710105872144Rat
2937Jag1jagged canonical Notch ligand 13124406783124442220Rat
2307Cd44CD44 molecule38915585089244615Rat
61996F2coagulation factor II, thrombin37759619677609486Rat
2660Gancglucosidase, alpha; neutral C3107353369107406104Rat
3042Map1amicrotubule-associated protein 1A3108263217108283936Rat
62064Adra1dadrenoceptor alpha 1D3118793356118809354Rat
3764Sstr4somatostatin receptor 43135854826135856689Rat
2026Actc1actin, alpha, cardiac muscle 13100811987100817523Rat
3238Oxtoxytocin/neurophysin I prepropeptide3117782650117783490Rat
2432Cst3cystatin C3136336923136340796Rat
628761Duox2dual oxidase 23109223809109247023Rat
619790Rag1recombination activating 138791706187928158Rat
620279Sert1Sertoli cell protein 13136114902136118882Rat
708445Prokr2prokineticin receptor 23119624738119639442Rat
621500Cdc25bcell division cycle 25B3118407127118417272Rat
631327Lzts3leucine zipper tumor suppressor family member 33117850286117861132Rat
619952Nsfl1cNSFL1 cofactor3139978306140002876Rat
2890Il1ainterleukin 1 alpha3116526601116537055Rat
2891Il1binterleukin 1 beta3116577005116583386Rat
621299Thbdthrombomodulin3135863366135867018Rat
621718Gpr176G protein-coupled receptor 1763105236794105337664Rat
620908Fbn1fibrillin 13112554257112750835Rat
621435Prom2prominin 23114747654114761787Rat
619922MaddMAP-kinase activating death domain37711433077157865Rat
2339Chgbchromogranin B3120043824120057169Rat
621330Ambra1autophagy and beclin 1 regulator 137770093677890221Rat
708514Cst12cystatin 123136235052136238912Rat
620221Snap23synaptosome associated protein 233107514088107546177Rat
61976Ckmt1creatine kinase, mitochondrial 13108329859108335760Rat
62054Pdynprodynorphin3116900990116913334Rat
620253P2rx3purinergic receptor P2X 337008085070124664Rat
621251Cd93CD93 molecule3135891859135898378Rat
243065133LOC129351010uncharacterized LOC1293510103117603534117604319Rat
621301Snrpbsmall nuclear ribonucleoprotein polypeptides B and B13117369816117379344Rat
628615Lgr4leucine-rich repeat-containing G protein-coupled receptor 439644738596550006Rat
61909Nr1h3nuclear receptor subfamily 1, group H, member 337715880877168907Rat
619791Bub1bBUB1 mitotic checkpoint serine/threonine kinase B3105563089105615547Rat
619950Itpkainositol-trisphosphate 3-kinase A3106726036106734601Rat
621663Csnk2a1casein kinase 2 alpha 13140709984140756757Rat
620721Blvrabiliverdin reductase A3114340778114366048Rat
620935Cry2cryptochrome circadian regulator 237837499578405001Rat
620589Cst11cystatin 113136211414136214138Rat
2269Capn3calpain 33107407518107457858Rat
2279Catcatalase38984239389874577Rat
2344Chrm4cholinergic receptor, muscarinic 437789342577901166Rat
619876Slc23a2solute carrier family 23 member 23119302651119395289Rat
621004Plcb2phospholipase C, beta 23105683676105704384Rat
621746GchfrGTP cyclohydrolase I feedback regulator3106158046106162080Rat
621143Ssrp1structure specific recognition protein 137012437170134481Rat
628883Ehd4EH-domain containing 43107058191107121985Rat
620503Gfra4GDNF family receptor alpha 43118254937118262252Rat
620507Crnkl1crooked neck pre-mRNA splicing factor 13133338593133354329Rat
621079Slc20a1solute carrier family 20 member 13116427095116441049Rat
628658BmfBcl2 modifying factor3105499534105520159Rat
708555Cstdc1cystatin domain containing 13136224721136231441Rat
620447Chp1calcineurin-like EF-hand protein 13106536009106571255Rat
628760Duox1dual oxidase 13109260526109295588Rat
2184Avparginine vasopressin3117793447117805091Rat
1304669Ccndbp1cyclin D1 binding protein 13107962402107974234Rat
69336Prg2proteoglycan 2, pro eosinophil major basic protein37006253570066102Rat
2021Acp2acid phosphatase 2, lysosomal37717502277185180Rat
1304809Ankef1ankyrin repeat and EF-hand domain containing 13123847832123883060Rat
708432Trib3tribbles pseudokinase 33140809634140815230Rat
1305804Dusp2dual specificity phosphatase 23114556325114558510Rat
1305169Pank2pantothenate kinase 23118483382118519551Rat
1306712Atp8b4ATPase phospholipid transporting 8B4 (putative)3113554979113757635Rat
620724Abtb2ankyrin repeat and BTB domain containing 238995472690108549Rat
621186Cds2CDP-diacylglycerol synthase 23119514963119553555Rat
1304858Vps39VPS39 subunit of HOPS complex3107266846107304884Rat
727814P22k15cystatin related protein 23136960300136967358Rat
735160Cysscystatin S3137432049137436654Rat
1304877Trim44tripartite motif-containing 4438859361988729085Rat
2952Kcna4potassium voltage-gated channel subfamily A member 439375639993778004Rat
628774Bcl2l11Bcl2-like 113115366783115404068Rat
3697Slc1a2solute carrier family 1 member 238900512989135469Rat
708404Rbck1RANBP2-type and C3HC4-type zinc finger containing 13140789079140806017Rat
628791Cops2COP9 signalosome subunit 23113084174113110090Rat
735060Mpped2metallophosphoesterase domain containing 239318089593355605Rat
69256Slc24a3solute carrier family 24 member 33132552119133051192Rat
708367Hsd17b12hydroxysteroid (17-beta) dehydrogenase 1237999004880113556Rat
2202Bdnfbrain-derived neurotrophic factor39616504296215621Rat
619756Bbox1gamma-butyrobetaine hydroxylase 139682265496871786Rat
2630Fshbfollicle stimulating hormone subunit beta39354856093552370Rat
620849Dutdeoxyuridine triphosphatase3112498864112509994Rat
621164Lin7clin-7 homolog C, crumbs cell polarity complex component39640680096417779Rat
1304904Gpat2glycerol-3-phosphate acyltransferase 2, mitochondrial3114646446114657051Rat
1306814Acoxlacyl-CoA oxidase-like3115061069115367032Rat
1306816Fermt1FERM domain containing kindlin 13120171301120213555Rat
2115Andproandrogen regulated protein3136718601136725131Rat
621877Syt13synaptotagmin 1337887711478917527Rat
61905Psmc3proteasome 26S subunit, ATPase 337703182577037207Rat
735214Large2LARGE xylosyl- and glucuronyltransferase 237833462778347167Rat
620822Polr1bRNA polymerase I subunit B3116333910116358385Rat
621881Idh3bisocitrate dehydrogenase (NAD(+)) 3 non-catalytic subunit beta3117481845117486909Rat
3728Snap25synaptosome associated protein 253124041898124123761Rat
620053Trpm7transient receptor potential cation channel, subfamily M, member 73114046258114134799Rat
1304644Slc52a3solute carrier family 52 member 33140498924140515845Rat
1307465Mgme1mitochondrial genome maintenance exonuclease 13131640770131649933Rat
3037Malmal, T-cell differentiation protein3114864378114888136Rat
1307417Cstl1cystatin-like 13136199914136204912Rat
1307809Chchd5coiled-coil-helix-coiled-coil-helix domain containing 53116361845116372238Rat
1305146Tmx4thioredoxin-related transmembrane protein 43121856237121899680Rat
1306009NanpN-acetylneuraminic acid phosphatase3139826549139841655Rat
1307516Ccdc32coiled-coil domain containing 323105998429106010985Rat
1306827Agbl2AGBL carboxypeptidase 237676489376800071Rat
1304695Slc39a13solute carrier family 39 member 1337703941177047528Rat
1306130Ovol2ovo-like zinc finger 23131677391131707123Rat
1305551Rassf2Ras association domain family member 23119244288119280462Rat
69073Mdkmidkine37790113477903997Rat
1304794Cenpbcentromere protein B3118396987118399780Rat
71090Gatmglycine amidinotransferase3109658919109675508Rat
1305256Lrrn4leucine rich repeat neuronal 43120138093120150877Rat
1307498Knl1kinetochore scaffold 13106029627106091915Rat
1305588Rag2recombination activating 238790237387910227Rat
1305198Meis2Meis homeobox 23102742904102944833Rat
1306924Tubgcp4tubulin gamma complex component 43108141081108172207Rat
1305440Ubox5U-box domain containing 53117806212117847711Rat
3685Slc12a1solute carrier family 12 member 13112406140112482913Rat
1305647Tmem62transmembrane protein 623107921940107961830Rat
1305859Elf5E74 like ETS transcription factor 538980883789836977Rat
1305829Lcmt2leucine carboxyl methyltransferase 23108099960108102084Rat
71103Slc27a2solute carrier family 27 member 23113804728113842208Rat
1306601Duoxa1dual oxidase maturation factor 13109249815109260511Rat
1306049Smoxspermine oxidase3118731814118767242Rat
1307128Lrrc57leucine rich repeat containing 573107544786107553256Rat
1305045Emc7ER membrane protein complex subunit 739926393399274365Rat
1305707Caprin1cell cycle associated protein 139015230590230447Rat
1307327Pacsin3protein kinase C and casein kinase substrate in neurons 337722718777235820Rat
3923Tyro3TYRO3 protein tyrosine kinase3106777686106797154Rat
1306991Lamp5lysosomal-associated membrane protein family, member 53123372462123384973Rat
1306202Ndufaf1NADH:ubiquinone oxidoreductase complex assembly factor 13106639025106650549Rat
1307332Srxn1sulfiredoxin 13140604490140610050Rat
1305074Trim69tripartite motif-containing 693109111468109135255Rat
1306428Polr3fRNA polymerase III subunit F3131908466131924838Rat
1306547Myef2myelin expression factor 23112338241112374122Rat
1306349Fmn1formin 13100101103100485652Rat
1309979Ddrgk1DDRGK domain containing 13117861916117882680Rat
735140Gpcpd1glycerophosphocholine phosphodiesterase 13119787681119832550Rat
1307721Celf1CUGBP, Elav-like family member 137692459176999429Rat
1306113Fjx1four-jointed box kinase 138877422088776321Rat
1307071Kizkizuna centrosomal protein3134277631134385260Rat
2311261Ctxn2cortexin 23112390972112401321Rat
1333562Or4c123olfactory receptor family 4 subfamily C member 12337527247575273392Rat
1307399Tmem230transmembrane protein 2303119473109119497617Rat
1310006Dph6diphthamine biosynthesis 63101307229101437463Rat
1310030Sptlc3serine palmitoyltransferase, long chain base subunit 33126847878126978010Rat
1305901Cstf3cleavage stimulation factor subunit 339096641591037669Rat
1307613Stard7StAR-related lipid transfer domain containing 73114487161114515828Rat
1307620Catsper2cation channel, sperm associated 23108368654108389380Rat
1307578Mapkbp1mitogen activated protein kinase binding protein 13106947342106998368Rat
1305348Cep152centrosomal protein 1523112803185112878298Rat
1305873Rin2Ras and Rab interactor 23133086858133303604Rat
1305985Golm2golgi membrane protein 23108827017108896207Rat
1306771Cdan1codanin 13107675147107689811Rat
1306717Nat10N-acetyltransferase 1039011164390149891Rat
1305253Otorotoraplin3130415339130418601Rat
1305867Snphsyntaphilin3140098540140139342Rat
1305410Ttc17tetratricopeptide repeat domain 1738026348880374137Rat
69063Atrnattractin3118110320118244326Rat
1333904Or4k50olfactory receptor family 4 subfamily K member 5039825489098255834Rat
1333910Or5g9olfactory receptor family 5 subfamily G member 937076891970769863Rat
1333913Or4c112olfactory receptor family 4 subfamily C member 11237488967474890588Rat
1332770Or5al7olfactory receptor family 5 subfamily AL member 737116627471167218Rat
1332772Or4f61dolfactory receptor family 4 subfamily F member 61D39880426898805206Rat
1332777Or10ag59bolfactory receptor family 10 subfamily AG member 59B37280375572804699Rat
1333233Or8k30-ps1olfactory receptor family 8 subfamily K member 30, pseudogene 137145769571458634Rat
1333235Or12e8olfactory receptor family 12 subfamily E member 837270465872705578Rat
1333237Or5w15olfactory receptor family 5 subfamily W member 1537320959873210536Rat
1333932Or5as1olfactory receptor family 5 subfamily AS member 137232404372324981Rat
1333935Or10ag54bolfactory receptor family 10 subfamily AG member 54B37267910172680468Rat
1333944Or12e14olfactory receptor family 12 subfamily E member 1437332679973331195Rat
1333945Olr585-psolfactory receptor pseudogene 58537323657173236759Rat
1333948Or5aq7bolfactory receptor family 5 subfamily AQ member 7B37255658472562298Rat
1333370Or4c102olfactory receptor family 4 subfamily C member 10237432327274324192Rat
1333400Or5m8olfactory receptor family 5 subfamily M member 837103476771035750Rat
1333401Or8k43-ps1olfactory receptor family 8 subfamily K member 43, pseudogene 137141386771414658Rat
1333797Or9g4bolfactory receptor family 9 subfamily G member 4B37084332170844259Rat
1333798Or4c3olfactory receptor family 4 subfamily C member 337604265876043584Rat
1333823Or5t18olfactory receptor family 5 subfamily T member 1837172888271729817Rat
1333825Or12e1olfactory receptor family 12 subfamily E member 137258863972589589Rat
1333829Or4k48bolfactory receptor family 4 subfamily K member 48B39843624298437180Rat
1333285Or5j1olfactory receptor family 5 subfamily J member 137215365972154597Rat
1333286Or4c12b-ps1olfactory receptor family 4 subfamily C member 12B, pseudogene 137585430075855420Rat
1333291Or4k42c-ps1olfactory receptor family 4 subfamily K member 42C, pseudogene 139808702098087956Rat
1333267Or4c130-ps1olfactory receptor family 4 subfamily C member 130, pseudogene 137417433574175243Rat
1333641Or4f6bolfactory receptor family 4 subfamily F member 6B39895608198957019Rat
1333642Or4c135-ps1olfactory receptor family 4 subfamily C member 135, pseudogene 137430444474305364Rat
1333643Or4c109bolfactory receptor family 4 subfamily C member 109B37478360574784540Rat
1333645Or5l14bolfactory receptor family 5 subfamily L member 14B37343267773433615Rat
1333646Olr617-psolfactory receptor pseudogene 61737372875173729698Rat
1333650Or4c107olfactory receptor family 4 subfamily C member 10737475100874751943Rat
1332635Or4a71olfactory receptor family 4 subfamily A member 7137515202875152945Rat
1332636Or5m10olfactory receptor family 5 subfamily M member 1037095665770957592Rat
1332637Or5aq6olfactory receptor family 5 subfamily AQ member 637222792372228861Rat
1311707Bub1BUB1 mitotic checkpoint serine/threonine kinase3115020254115051650Rat
1309917Ell3elongation factor for RNA polymerase II 33108413035108417181Rat
1333420Or5d41olfactory receptor family 5 subfamily D member 4137363691473637864Rat
1334151Or4c115olfactory receptor family 4 subfamily C member 11537504919675050128Rat
1311047Sptbn5spectrin, beta, non-erythrocytic 53107013783107054878Rat
1310201Alx4ALX homeobox 437961168279648260Rat
1312016Slc43a3solute carrier family 43, member 337000816070030324Rat
1309740Dll4delta like canonical Notch ligand 43106317114106327004Rat
1308506Srp14signal recognition particle 143105442184105445875Rat
1333498Or5ak22olfactory receptor family 5 subfamily AK member 2237044869270449621Rat
1333499Or4f14olfactory receptor family 4 subfamily F member 1439852074998521687Rat
1333653Or5t9olfactory receptor family 5 subfamily T member 937176790871774271Rat
1333654Or4f4aolfactory receptor family 4 subfamily F member 4A39809690698101076Rat
1333655Or8h10bolfactory receptor family 8 subfamily H member 10B37208962672090591Rat
1308395Tp53i11tumor protein p53 inducible protein 1137914482479160056Rat
1310527Agfg1-ps1ArfGAP with FG repeats 1, pseudogene 13138777896138779912Rat
1307285Ciao1cytosolic iron-sulfur assembly component 13114458671114465928Rat
1309744Tmem127transmembrane protein 1273114466095114478894Rat
1309720Depdc7DEP domain containing 739109911191121152Rat
1308443Nkx2-2NK2 homeobox 23134619701134630282Rat
1332834Or4c11olfactory receptor family 4 subfamily C member 1137459880974599732Rat
1332842Or4c108bolfactory receptor family 4 subfamily C member 108B37482694974827884Rat
1333102Or5m5olfactory receptor family 5 subfamily M member 537102686271027800Rat
1333335Or4f7colfactory receptor family 4 subfamily F member 7C39845888998459827Rat
1333343Or5g25olfactory receptor family 5 subfamily G member 2537071874170719697Rat
1333346Or5aq1dolfactory receptor family 5 subfamily AQ member 1D37237599472383570Rat
1305218Mcm8minichromosome maintenance 8 homologous recombination repair factor3120086741120117008Rat
1311006C1qtnf4C1q and TNF related 437685436876872991Rat
1333515Or4b1b-ps1olfactory receptor family 4 subfamily B member 1B, pseudogene 137630450576305430Rat
1333521Or4k42bolfactory receptor family 4 subfamily K member 42B39806802498068962Rat
1310208Bloc1s6biogenesis of lysosomal organelles complex 1 subunit 63109816397109826528Rat
1333491Or4f47olfactory receptor family 4 subfamily F member 4739886885598869805Rat
1333493Or4x11olfactory receptor family 4 subfamily X member 1137613119676132125Rat
1310978Cst5cystatin D3137573194137577754Rat
1308015Dnajc17DnaJ heat shock protein family (Hsp40) member C173106162197106195771Rat
1308023Ralgapa2Ral GTPase activating protein catalytic subunit alpha 23133658725133938821Rat
1308904Fam110afamily with sequence similarity 110, member A3140474484140485074Rat
1333867Or4f15olfactory receptor family 4 subfamily F member 1539855666798566115Rat
1333063Or4p18olfactory receptor family 4 subfamily P member 1837400022474001174Rat
1333066Or8k39olfactory receptor family 8 subfamily K member 3937164829671649231Rat
1333067Or4f14eolfactory receptor family 4 subfamily F member 14E39869389398694831Rat
1333774Or5al1olfactory receptor family 5 subfamily AL member 137115720771158148Rat
1309154Cst7cystatin F3139396830139405557Rat
1333136Or4f53bolfactory receptor family 4 subfamily F member 53B39786790297868840Rat
1333140Or4a47olfactory receptor family 4 subfamily A member 4737587397175874900Rat
1308385Scp2d1SCP2 sterol-binding domain containing 13132201979132202729Rat
1333925Or4k42-ps1olfactory receptor family 4 subfamily K member 42, pseudogene 139810532598106262Rat
1333928Or2ah1olfactory receptor family 2 subfamily AH member 137088634370887278Rat
1333159Or5ak26-ps1olfactory receptor family 5 subfamily AK member 26, pseudogene 137044035970441273Rat
1333160Olr565-psolfactory receptor pseudogene 56537282908772829973Rat
1333165Or5w12olfactory receptor family 5 subfamily W member 1237308733773088269Rat
1333086Or5ap2olfactory receptor family 5 subfamily AP member 237091749170918444Rat
1333087Or4c133-ps1olfactory receptor family 4 subfamily C member 133, pseudogene 137427393574274872Rat
1333089Or4a80olfactory receptor family 4 subfamily A member 8037572988075730833Rat
1333310Or5l13olfactory receptor family 5 subfamily L member 1337341584973416802Rat
1310753Syndig1synapse differentiation inducing 13138030995138234646Rat
1333510Or4p19olfactory receptor family 4 subfamily P member 1937401209374013031Rat
1334162Or4f7bolfactory receptor family 4 subfamily F member 7B39838881598394276Rat
1334169Or5m12b-ps1olfactory receptor family 5 subfamily M member 12B, pseudogene 137096616070967121Rat
1334170Or4af1-ps1olfactory receptor family 4 subfamily AF member 1, pseudogene 137555549775556072Rat
1333143Or4j1-ps1olfactory receptor family 4 subfamily J member 1, pseudogene 137426444074265208Rat
1333144Or5ak24olfactory receptor family 5 subfamily AK member 2437048713670488080Rat
1309772Api5apoptosis inhibitor 538037809680403259Rat
1309783Potefam1POTE ankyrin domain family member 139764125897826965Rat
1333264Or10ag2olfactory receptor family 10 subfamily AG member 237276375072764721Rat
1332822Or4a15bolfactory receptor family 4 subfamily A member 15B37540188975402836Rat
1333172Or4a2olfactory receptor family 4 subfamily A member 237543803475438951Rat
1332640Or4p20bolfactory receptor family 4 subfamily P member 20B37402216974023089Rat
1332647Or5m9olfactory receptor family 5 subfamily M member 937107264771073579Rat
1332674Or8k3olfactory receptor family 8 subfamily K member 337127546371276422Rat
1333586Or5w1d-ps1olfactory receptor family 5 subfamily W member 1D, pseudogene 137292845372929390Rat
1333587Olr553-psolfactory receptor pseudogene 55337257903172579321Rat
1333588Or4f14folfactory receptor family 4 subfamily F member 14F39853347698534414Rat
1334005Olr738-psolfactory receptor pseudogene 73837621968776220208Rat
1311592Rapsnreceptor-associated protein of the synapse37701507377024378Rat
1332942Or5w13olfactory receptor family 5 subfamily W member 1337317972373180655Rat
1332947Or4c3eolfactory receptor family 4 subfamily C member 3E37609911976100027Rat
621645Aplnrapelin receptor37021740770221052Rat
1309730Iftapintraflagellar transport associated protein38781206887906517Rat
1310458Zc3h8zinc finger CCCH type containing 83116176779116193752Rat
1333951Or4f60olfactory receptor family 4 subfamily F member 6039897573098976665Rat
1332686Or5w8bolfactory receptor family 5 subfamily W member 8B37366730073668232Rat
1332783Or4x6olfactory receptor family 4 subfamily X member 637617527876176207Rat
1333119Or4a77olfactory receptor family 4 subfamily A member 7737575270975753632Rat
1333154Or8ag1-ps1olfactory receptor family 8 subfamily AG member 1, pseudogene 137139611971396764Rat
1311292Rcn1reticulocalbin 139184105291855295Rat
1333092Or5w16olfactory receptor family 5 subfamily W member 1637323776673238701Rat
1333754Or4b1olfactory receptor family 4 subfamily B member 137627454376275469Rat
1333756Or4c116olfactory receptor family 4 subfamily C member 11637505977375060708Rat
1333758Or5w18olfactory receptor family 5 subfamily W member 1837328841773289349Rat
1333762Or4c114b-ps1olfactory receptor family 4 subfamily C member 114B, pseudogene 137501398475014915Rat
1333765Or5l14-ps1olfactory receptor family 5 subfamily L member 14, pseudogene 137344556973445837Rat
1306874Fsip1fibrous sheath interacting protein 13105074584105217180Rat
1333690Or5w23-ps1olfactory receptor family 5 subfamily W member 23, pseudogene 137312637173127283Rat
1332602Or4f61bolfactory receptor family 4 subfamily F member 61B39865753298658602Rat
1332602Or4f61bolfactory receptor family 4 subfamily F member 61B39865756498658502Rat
1332604Or10ag52bolfactory receptor family 10 subfamily AG member 52B37236242872363393Rat
1332611Or8k3b-ps1olfactory receptor family 8 subfamily K member 3B, pseudogene 137161123271612172Rat
1333624Or5g29olfactory receptor family 5 subfamily G member 2937068276170683705Rat
1333105Or4a73olfactory receptor family 4 subfamily A member 7337564469275645636Rat
1333099Or12e13-ps1olfactory receptor family 12 subfamily E member 13, pseudogene 137331095473311855Rat
1311278Sel1l2SEL1L2 adaptor subunit of SYVN1 ubiquitin ligase3127586031127713857Rat
1334176Or4c105olfactory receptor family 4 subfamily C member 10537458241774583346Rat
1334046Or4c29olfactory receptor family 4 subfamily C member 2937466059874661530Rat
1334047Or4k46olfactory receptor family 4 subfamily K member 4639819646698197404Rat
1334050Or8i2olfactory receptor family 8 subfamily I member 237211936772120299Rat
1332616Or5al5-ps1olfactory receptor family 5 subfamily AL member 5, pseudogene 137111945771120415Rat
1332650Or5be3olfactory receptor family 5 subfamily BE member 337212899872129936Rat
1332655Or4c58olfactory receptor family 4 subfamily C member 5837588253775883448Rat
1332656Or8i14-ps1olfactory receptor family 8 subfamily I member 14, pseudogene 137526061575261459Rat
1332657Or10ag59olfactory receptor family 10 subfamily AG member 5937206730572068249Rat
1332658Or9m1-ps1olfactory receptor family 9 subfamily M member 1, pseudogene 137348570873486641Rat
1310869Mallmal, T-cell differentiation protein-like3114927897114950840Rat
1333993Or4c52olfactory receptor family 4 subfamily C member 5237603410076035029Rat
1333999Or4c125olfactory receptor family 4 subfamily C member 12537535855475360555Rat
1333189Or4a78olfactory receptor family 4 subfamily A member 7837569054675691499Rat
1334023Olr623olfactory receptor 62337385017773851112Rat
1334025Or8k33olfactory receptor family 8 subfamily K member 3337155361971559885Rat
1334027Or12e10olfactory receptor family 12 subfamily E member 1037330141873302353Rat
1333773Or4c108olfactory receptor family 4 subfamily C member 10837477041474771984Rat
1333703Or12e9olfactory receptor family 12 subfamily E member 937271524172716185Rat
1333709Olr460-psolfactory receptor pseudogene 46037086908970869691Rat
1311144Dtwd1DTW domain containing 13113392402113409322Rat
1332829Or8k23olfactory receptor family 8 subfamily K member 2337136744071370914Rat
1332831Or5ai2-ps1olfactory receptor family 5 subfamily AI member 2, pseudogene 137043099370431653Rat
1333623Or5ar1olfactory receptor family 5 subfamily AR member 137090759270908524Rat
1311463Arl14epADP-ribosylation factor like GTPase 14 effector protein39344195293454282Rat
1333326Or4f58olfactory receptor family 4 subfamily F member 5839861003198610969Rat
1333330Olr589-psolfactory receptor pseudogene 58937327391773274388Rat
1333114Olr591-psolfactory receptor pseudogene 59137329952673300139Rat
1332600Or4c117bolfactory receptor family 4 subfamily C member 117B37509435475095289Rat
1303240Knstrnkinetochore-localized astrin/SPAG5 binding protein3105800762105820555Rat
1333526Or4k48olfactory receptor family 4 subfamily K member 4839822052098221458Rat
1333222Or5t7olfactory receptor family 5 subfamily T member 737159375371594685Rat
1333224Or12e7olfactory receptor family 12 subfamily E member 737284304272843986Rat
1333225Or8w1olfactory receptor family 8 subfamily W member 137305513573056061Rat
1311439Eif2ak4eukaryotic translation initiation factor 2 alpha kinase 43105356261105441630Rat
1333916Or8j3bolfactory receptor family 8 subfamily J member 3B37138285471383801Rat
1311344Dzank1double zinc ribbon and ankyrin repeat domains 13131855890131908217Rat
1333572Or5j12-ps1olfactory receptor family 5 subfamily J member 12, pseudogene 137214731272148231Rat
1333573Olr626-psolfactory receptor pseudogene 62637395630473957250Rat
1332807Or4k49olfactory receptor family 4 subfamily K member 4939823669298237630Rat
1332811Or4c117olfactory receptor family 4 subfamily C member 11737507768775078622Rat
1333364Or4c128-ps1olfactory receptor family 4 subfamily C member 128, pseudogene 137508876675089617Rat
1333365Or8k1olfactory receptor family 8 subfamily K member 1637125693971257889Rat
1560391Gabpb1GA binding protein transcription factor subunit beta 13113879972113924742Rat
1333275Or5aq6b-ps1olfactory receptor family 5 subfamily AQ member 6B, pseudogene 137240158072402517Rat
1333604Or4k35olfactory receptor family 4 subfamily K member 3539788026197881172Rat
1333606Or5w8olfactory receptor family 5 subfamily W member 837336600573366931Rat
1333607Olr732-psolfactory receptor pseudogene 73237612524576125428Rat
1332849Or4a66bolfactory receptor family 4 subfamily A member 66B37456906874569997Rat
1332850Or4k52olfactory receptor family 4 subfamily K member 5239834126098342198Rat
1332619Or8k31olfactory receptor family 8 subfamily K member 3137149379171494732Rat
1332626Or4k45olfactory receptor family 4 subfamily K member 4539816793598168873Rat
1332627Or4c119-ps1olfactory receptor family 4 subfamily C member 119, pseudogene 137512801475129149Rat
1308318Mrps5mitochondrial ribosomal protein S53114821046114837291Rat
1332749Or4k77olfactory receptor family 4 subfamily K member 7739801633898017255Rat
1310910Sema6dsemaphorin 6D3111883415111941100Rat
1307909Banf2BANF family member 23131387107131442837Rat
1310188Slc4a11solute carrier family 4 member 113117900223117912787Rat
1310190Snx5sorting nexin 53131621875131641127Rat
1310194Snrpb2small nuclear ribonucleoprotein polypeptide B23130399239130408821Rat
1333349Or8h9olfactory receptor family 8 subfamily H member 937202516572026109Rat
1333350Or4c1olfactory receptor family 4 subfamily C member 137527890875279834Rat
1333354Or4c103bolfactory receptor family 4 subfamily C member 103B37440063274401558Rat
1333355Or8i7-ps1olfactory receptor family 8 subfamily I member 7, pseudogene 137398687373987754Rat
1308658Pla2g4bphospholipase A2 group IVB3107004238107013853Rat
1310969Ino80INO80 complex ATPase subunit3106368455106465716Rat
1311652Slc5a12solute carrier family 5 member 1239717932697228405Rat
1311661Ttbk2tau tubulin kinase 23107691123107802911Rat
1311457HypkHuntingtin interacting protein K3108434997108436370Rat
1309417Tmem87atransmembrane protein 87A3107307726107353571Rat
1310247Stk35serine/threonine kinase 353117016819117049131Rat
1560542Prrg4proline rich and Gla domain 439121464691243347Rat
1333410Or8h7olfactory receptor family 8 subfamily H member 737199756071998501Rat
1333415Or4c103olfactory receptor family 4 subfamily C member 10337441582874416754Rat
1333417Or4c99olfactory receptor family 4 subfamily C member 9937389475873897788Rat
1305667Vsx1visual system homeobox 13139514270139521869Rat
1310905Emc4ER membrane protein complex subunit 439916971199174730Rat
1332795Or8k27olfactory receptor family 8 subfamily K member 2737143154871432489Rat
1332798Olr739-psolfactory receptor pseudogene 73937622859276228684Rat
1332799Or4c124bolfactory receptor family 4 subfamily C member 124B37532084175321776Rat
1309219Ctdspl2CTD small phosphatase like 23108915263108970620Rat
1309384Rnf24ring finger protein 243118520459118575213Rat
1306213Pak6p21 (RAC1) activated kinase 63105638248105674399Rat
1310565Slc24a5solute carrier family 24 member 53112319349112338889Rat
1308464Tcf15transcription factor 153140638984140644766Rat
1310699Sec23bSec23 homolog B, COPII coat complex component3131939011131981489Rat
1309969Prr5lproline rich 5 like38800195188173532Rat
1309463Slc35c1solute carrier family 35 member C137842192578429603Rat
1308591Tasp1taspase 13127176416127408039Rat
1309928Avenapoptosis and caspase activation inhibitor39929900999431635Rat
1311519Cfap61cilia and flagella associated protein 613133354400133633310Rat
1333962Or4c12olfactory receptor family 4 subfamily C member 1237594726675948186Rat
1333978Or4c129olfactory receptor family 4 subfamily C member 12937422953174230439Rat
1333980Or4k36olfactory receptor family 4 subfamily K member 3639794998297950899Rat
1307887Patl2PAT1 homolog 23109072958109087425Rat
1304978Mettl15methyltransferase 15, mitochondrial 12S rRNA N4-cytidine39558685595764392Rat
1304979Usp8ubiquitin specific peptidase 83113962136114009683Rat
1307539Angpt4angiopoietin 43140420389140454213Rat
1309406Ndufs3NADH:ubiquinone oxidoreductase core subunit S337687664676883824Rat
1308892Nop56NOP56 ribonucleoprotein3117476963117481847Rat
1304985Nkx2-4NK2 homeobox 43134514368134517243Rat
1306536Rrbp1ribosome binding protein 13131314996131376930Rat
1309904Prg3proteoglycan 3, pro eosinophil major basic protein 237007197070078103Rat
1306223Aqraquarius intron-binding spliceosomal factor3100874987100945026Rat
1309314Accs1-aminocyclopropane-1-carboxylate synthase37980525479820830Rat
1308039Tp53bp1tumor protein p53 binding protein 13108166574108270229Rat
1310218Xrn25'-3' exoribonuclease 23134436916134509308Rat
1333220Or4x11b-ps1olfactory receptor family 4 subfamily X member 11B, pseudogene 137609197076092807Rat
1308136Nphp1nephrocystin 13114960650115016234Rat
1306246Acss1acyl-CoA synthetase short-chain family member 13139450383139500325Rat
1308691Galk2galactokinase 23113110057113243014Rat
1308697Rmdn3regulator of microtubule dynamics 33106125961106146568Rat
1332801Or4x5olfactory receptor family 4 subfamily X member 537616715276168081Rat
1332802Or4c134-ps1olfactory receptor family 4 subfamily C member 134, pseudogene 137434313974344050Rat
1308142Chst1carbohydrate sulfotransferase 137855205978574740Rat
1305306Epb42erythrocyte membrane protein band 4.23107979709107997932Rat
1309616Wdr76WD repeat domain 763108456784108491528Rat
1311552Ppip5k1diphosphoinositol pentakisphosphate kinase 13108284120108327683Rat
1306618Prndprion like protein doppel3119213462119218742Rat
1309538Kat14lysine acetyltransferase 143131736430131781732Rat
1309540Cstpp1centriolar satellite-associated tubulin polyglutamylase complex regulator 137724739377416307Rat
1308745Pamr1peptidase domain containing associated with muscle regeneration 138888906188988615Rat
1308080Mtch2mitochondrial carrier 237683054976850189Rat
1309107Arhgap11aRho GTPase activating protein 11A3100590865100607146Rat
1311372Pex16peroxisomal biogenesis factor 1637834721278352603Rat
1332859Olr685-psolfactory receptor pseudogene 68537516466875165130Rat
1332860Or4k51olfactory receptor family 4 subfamily K member 5139831899998319937Rat
1306937Cpxm1carboxypeptidase X (M14 family), member 13117588532117595330Rat
1310073Tmc2transmembrane channel-like 23117396378117464336Rat
1309829Ndufaf5NADH:ubiquinone oxidoreductase complex assembly factor 53127507931127537477Rat
1307153Chac1ChaC glutathione-specific gamma-glutamylcyclotransferase 13106342302106345526Rat
1309327Nxt1nuclear transport factor 2-like export factor 13136108975136111897Rat
1311623Btbd3BTB domain containing 33125591427125621660Rat
1307101Lmo2LIM domain only 239035523490377970Rat
1310234Kbtbd4kelch repeat and BTB domain containing 437688367176889769Rat
1307846Ldlrad3low density lipoprotein receptor class A domain containing 338823952988481340Rat
1310146Kif16bkinesin family member 16B3129974692130254194Rat
1305764Nusap1nucleolar and spindle associated protein 13106603273106633428Rat
1310164Ddb2damage specific DNA binding protein 237718511477207650Rat
1308836Pced1aPC-esterase domain containing 1A3117600958117622992Rat
1306177Arfgap2ADP-ribosylation factor GTPase activating protein 237723630577248445Rat
1305950Mybpc3myosin binding protein C337709516577113406Rat
1306629Anapc1anaphase promoting complex subunit 13115850117115930259Rat
1306067Esf1ESF1 nucleolar pre-rRNA processing protein homolog3127454744127507941Rat
1306068Arhgap1Rho GTPase activating protein 137762137777643400Rat
1310685Atg13autophagy related 1337764706977681028Rat
1309238Fnbp4formin binding protein 437673301276763077Rat
1333128Or5g24olfactory receptor family 5 subfamily G member 2437069043970691383Rat
1333129Or8k20olfactory receptor family 8 subfamily K member 2037129446771295393Rat
1332692Or4p20olfactory receptor family 4 subfamily P member 2037392984973930784Rat
1332695Or8h10colfactory receptor family 8 subfamily H member 10C37204670672047671Rat
1332696Or4a77bolfactory receptor family 4 subfamily A member 77B37567436875675312Rat
1310654Rtf1Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)3106659363106718956Rat
1307706Commd9COMM domain containing 938817590988190427Rat
1307707Ext2exostosin glycosyltransferase 237966541479798077Rat
1307709Sdcbp2syndecan binding protein 23140060746140098063Rat
1307713Naa20N(alpha)-acetyltransferase 20, NatB catalytic subunit3133322036133336843Rat
1310282Ehfets homologous factor38963984589680061Rat
1309569Disp2dispatched RND transporter family member 23105762303105777826Rat
1332704Or5ak25olfactory receptor family 5 subfamily AK member 2537049755070498497Rat
1332707Or4c104olfactory receptor family 4 subfamily C member 10437455601774556949Rat
1332711Or8g56-ps1olfactory receptor family 8 subfamily G member 56, pseudogene 139484500094845914Rat
1332819Or5ap2bolfactory receptor family 5 subfamily AP member 2B37093188170932834Rat
1332820Or9g20olfactory receptor family 9 subfamily G member 2037085934570860274Rat
1332821Or5bi1-ps1olfactory receptor family 5 subfamily BI member 1, pseudogene 137075714870757580Rat
1332864Or4o1-ps1olfactory receptor family 4 subfamily O member 1, pseudogene 137541013375410569Rat
1332866Or5as2-ps1olfactory receptor family 5 subfamily AS member 2, pseudogene 137244611572446798Rat
1332868Or4f59olfactory receptor family 4 subfamily F member 5939861710398618065Rat
1333603Or4a69olfactory receptor family 4 subfamily A member 6937552691775529004Rat
1310131Fbln7fibulin 73116111581116145839Rat
1333430Or4c122olfactory receptor family 4 subfamily C member 12237521150475212439Rat
1333437Or5t9bolfactory receptor family 5 subfamily T member 9B37180971871810668Rat
1333439Or4s2olfactory receptor family 4 subfamily S member 237437749274378427Rat
1311556Vps18VPS18 core subunit of CORVET and HOPS complexes3106279444106290298Rat
1333830Or8k38-ps1olfactory receptor family 8 subfamily K member 38, pseudogene 137156869871569499Rat
1333831Or4a72b-ps1olfactory receptor family 4 subfamily A member 72B, pseudogene 137562798275628906Rat
1333833Or4c10bolfactory receptor family 4 subfamily C member 10B37590550175906430Rat
1333836Or5aq7olfactory receptor family 5 subfamily AQ member 737228839272289330Rat
1308873Ano3anoctamin 339723567197550090Rat
1308874Apmapadipocyte plasma membrane associated protein3139409021139437296Rat
1308877Trmt6tRNA methyltransferase 6 non-catalytic subunit3120074899120086639Rat
1308733Mrps26mitochondrial ribosomal protein S263117769220117770883Rat
1308735Spred1sprouty-related, EVH1 domain containing 13103983120104050321Rat
1307907Tmem87btransmembrane protein 87B3116061933116097421Rat
1308814MkksMKKS centrosomal shuttling protein3124201877124221142Rat
1305278Adam33ADAM metallopeptidase domain 333118262395118283456Rat
1309323Ltkleukocyte receptor tyrosine kinase3106734675106741552Rat
1310595Pla2g4ephospholipase A2, group IVE3107132540107198609Rat
1306147Rpusd2RNA pseudouridine synthase domain containing 23106017759106023010Rat
1306152Ninlninein-like3139748353139814683Rat
1333244Or5d16-ps1olfactory receptor family 5 subfamily D member 16, pseudogene 137341028073411227Rat
1333246Or8h10olfactory receptor family 8 subfamily H member 1037193413571935100Rat
1333254Or4c127olfactory receptor family 4 subfamily C member 12737601959176020520Rat
1333259Or8k40olfactory receptor family 8 subfamily K member 4037166467671665617Rat
1306853Traf6TNF receptor associated factor 638796351787988316Rat
1562279Astlastacin like metalloendopeptidase3114563135114580295Rat
1562702Eid1EP300 interacting inhibitor of differentiation 13112922961112924680Rat
1562705ShfSrc homology 2 domain containing F3109296517109316315Rat
1334422Olr621olfactory receptor 62137382438673825297Rat
628891Ppp1r14dprotein phosphatase 1, regulatory (inhibitor) subunit 14D3106205043106219290Rat
1566077Serinc4serine incorporator 43108428896108434778Rat
1334333Olr520olfactory receptor 52037189882671899752Rat
1334334Or4g17olfactory receptor family 4 subfamily G member 1739802668798027622Rat
1359731Alkbh3alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase37993951579972820Rat
1334377Or4a81olfactory receptor family 4 subfamily A member 8137582016475839914Rat
1564751Usp50ubiquitin specific peptidase 503114012104114035468Rat
1561442Vinac1vinculin/alpha-catenin family member 13116259951116285108Rat
1333782Or5w13bolfactory receptor family 5 subfamily W member 13B37315708173166736Rat
1333019Or12e13bolfactory receptor family 12 subfamily E member 13B37331860573319540Rat
1563711Fibinfin bud initiation factor homolog39694240596944676Rat
1559924Eif1l1eukaryotic translation initiation factor 1 like 13137070999137073720Rat
1561554Frmd5FERM domain containing 53108492099108763715Rat
1564603Fam98bfamily with sequence similarity 98, member B3104134803104164249Rat
1562551Ism1isthmin 13127023296127102228Rat
1334339Olr655olfactory receptor 65537450192174502850Rat
1334341Or4a72olfactory receptor family 4 subfamily A member 7237561332875614251Rat
1334350Olr543-psolfactory receptor pseudogene 54337231110372311420Rat
1564796Scrt2scratch family transcriptional repressor 23140581336140595273Rat
1561317Rpl31l6ribosomal protein L31-like 63117489763117490616Rat
1334356Or5w17olfactory receptor family 5 subfamily W member 1737325368373254618Rat
1559930Secisbp2lSECIS binding protein 2-like3112989613113036060Rat
1563415Rspo4R-spondin 43140357256140391780Rat
1564048Tmem74btransmembrane protein 74B3140219592140224208Rat
1560017Rpl17-ps17ribosomal protein L17, pseudogene 1739126717791267803Rat
1560583Ccdc34coiled-coil domain containing 3439655307496588310Rat
1564425Psmb3l2proteasome 20S subunit beta 3 like 23118672316118672933Rat
1563263Frey1Frey regulator of sperm-oocyte fusion 137835430378355055Rat
1563603Rad51RAD51 recombinase3106099753106125038Rat
1561224Ptbp1-ps6polypyrimidine tract binding protein 1, pseudogene 638632246986323963Rat
1334323Or4b13bolfactory receptor family 4 subfamily B member 13B37628657376287490Rat
1334360Or5w1olfactory receptor family 5 subfamily W member 137306879673069734Rat
1564263Oip5Opa interacting protein 53106593746106603281Rat
1561576Zfyve19zinc finger FYVE-type containing 193106195779106203969Rat
1561675Spdye4cspeedy/RINGO cell cycle regulator family, member E4C3115830999115838358Rat
1561831Tgm3transglutaminase 33117228661117264078Rat
1566059Or4f5olfactory receptor family 4 subfamily F member 539807644098080996Rat
1561276Or4f4bolfactory receptor family 4 subfamily F member 4B39805806198061955Rat
1562321Gzf1GDNF-inducible zinc finger protein 13136119004136131223Rat
1562326Ubr1ubiquitin protein ligase E3 component n-recognin 13107813721107921701Rat
1332991Or5m3olfactory receptor family 5 subfamily M member 337104857071049502Rat
1311013Lrrc4cleucine rich repeat containing 4C38230549583684039Rat
1560961Rfk-ps3riboflavin kinase, pseudogene 338651072986512353Rat
1359613Creb3l1cAMP responsive element binding protein 3-like 137795258977993513Rat
1563222C3h11orf91similar to human chromosome 11 open reading frame 9139047919690486592Rat
1333069Or5w14olfactory receptor family 5 subfamily W member 1437314047973141417Rat
1333805Or5w1c-ps1olfactory receptor family 5 subfamily W member 1C, pseudogene 137297296072973896Rat
1333807Or5w14b-ps1olfactory receptor family 5 subfamily W member 14B, pseudogene 137312433673125261Rat
1333808Olr673olfactory receptor 67337495581974956754Rat
1332720Olr716olfactory receptor 71637577785875778811Rat
1332723Or4c112bolfactory receptor family 4 subfamily C member 112B37499263574993570Rat
1332734Or4f6olfactory receptor family 4 subfamily F member 639859580298596740Rat
1332738Or5n2-ps1olfactory receptor family 5 subfamily N member 2, pseudogene 137162746471628353Rat
1332739Or9f1-ps1olfactory receptor family 9 subfamily F member 1, pseudogene 137072516570726066Rat
1334308Or8ah1-ps1olfactory receptor family 8 subfamily AH member 1, pseudogene 137137787171378591Rat
1334309Or10ag54olfactory receptor family 10 subfamily AG member 5437264813472649057Rat
1334311Olr551olfactory receptor 55137252600572526943Rat
1334313Or9g4olfactory receptor family 9 subfamily G member 437072796370728901Rat
1303138Spint1serine peptidase inhibitor, Kunitz type 13106231082106244121Rat
1334249Or4f60bolfactory receptor family 4 subfamily F member 60B39864183798642772Rat
1334252Or4c111olfactory receptor family 4 subfamily C member 11137487377374874708Rat
1334112Or5t5bolfactory receptor family 5 subfamily T member 5B37183985371840821Rat
1334114Or5t15-ps1olfactory receptor family 5 subfamily T member 15, pseudogene 137189882671899752Rat
1559448C3h20orf96similar to human chromosome 20 open reading frame 963140876987140907711Rat
1561323Rpl9-ps28ribosomal protein L9, pseudogene 283114670948114671735Rat
1333729Or12e7b-ps1olfactory receptor family 12 subfamily E member 7B, pseudogene 137281432172815092Rat
2057Adra2badrenoceptor alpha 2B3114585174114589220Rat
1334261Or4c101-ps1olfactory receptor family 4 subfamily C member 101, pseudogene 137428105674282171Rat
1334269Or5al5bolfactory receptor family 5 subfamily AL member 5B37113756171138502Rat
1334273Olr440olfactory receptor 44037046603970466986Rat
1333304Or4p24-ps1olfactory receptor family 4 subfamily P member 24, pseudogene 137383586773836743Rat
1333305Or4p22eolfactory receptor family 4 subfamily P member 22E37414724574148186Rat
1333454Or8ai1-ps1olfactory receptor family 8 subfamily AI member 1, pseudogene 137149861471499252Rat
1333455Or8j3olfactory receptor family 8 subfamily J member 337124134571242292Rat
1333456Or4p4olfactory receptor family 4 subfamily P member 437435255074353485Rat
1333461Or4x13olfactory receptor family 4 subfamily X member 1337634087476341803Rat
1333471Or8h6b-ps1olfactory receptor family 8 subfamily H member 6B, pseudogene 137187810271879049Rat
1334032Olr765olfactory receptor 76539811874498121011Rat
1334035Or5t17-ps1olfactory receptor family 5 subfamily T member 17, pseudogene 137210804472108995Rat
1334011Or4f7olfactory receptor family 4 subfamily F member 739848289598483833Rat
1332745Or5m11olfactory receptor family 5 subfamily M member 1137101756471018538Rat
1311032Cst9lcystatin 9-like3136288093136290906Rat
1311037Crls1cardiolipin synthase 13120119822120138674Rat
1311177Lpcat4lysophosphatidylcholine acyltransferase 439904472999052963Rat
1311821Dtd1D-aminoacyl-tRNA deacylase 13131995870132158646Rat
1332987Or4a39-ps1olfactory receptor family 4 subfamily A member 39, pseudogene 137543000675430958Rat
1333985Or4c15olfactory receptor family 4 subfamily C member 1537469200674694901Rat
1333986Or8j10-ps1olfactory receptor family 8 subfamily J member 10, pseudogene 137130792671308820Rat
1333988Or5t5olfactory receptor family 5 subfamily T member 537170396971704934Rat
1312021Tnks1bp1tankyrase 1 binding protein 137013533570160071Rat
1311953Siglec1sialic acid binding Ig like lectin 13118287988118307125Rat
1333789Or5aq1olfactory receptor family 5 subfamily AQ member 1B37219659972197537Rat
1333795Or4k44olfactory receptor family 4 subfamily K member 4439813755298138490Rat
2617Fkbp1aFKBP prolyl isomerase 1A3140040359140060107Rat
1311267Spef1sperm flagellar 13118390659118396842Rat
1333533Or5w22b-ps1olfactory receptor family 5 subfamily W member 22B, pseudogene 137299278672993439Rat
1333537Or5m13bolfactory receptor family 5 subfamily M member 13B37099035470991277Rat
1333538Or5w19olfactory receptor family 5 subfamily W member 1937337530273376234Rat
1333540Or8k53b-ps1olfactory receptor family 8 subfamily K member 53B, pseudogene 137135931071360233Rat
1333542Olr683-psolfactory receptor pseudogene 68337514541775145825Rat
1333472Or8k16bolfactory receptor family 8 subfamily K member 16B37133837571339316Rat
1333473Or5d47olfactory receptor family 5 subfamily D member 4737346535073466307Rat
2359Grem1gremlin 1, DAN family BMP antagonist3100512317100524001Rat
1332993Or4p8olfactory receptor family 4 subfamily P member 837464981874650744Rat
1332997Or4a77colfactory receptor family 4 subfamily A member 77C37570851175709455Rat
1311052Nup160nucleoporin 16037666578676729296Rat
1334095Or4c31f-ps1olfactory receptor family 4 subfamily C member 31F, pseudogene 137396579973966710Rat
1334185Or4c107b-ps1olfactory receptor family 4 subfamily C member 107B, pseudogene 137481959174820221Rat
1334187Or8k24olfactory receptor family 8 subfamily K member 2437139126571392206Rat
1334192Or5d20olfactory receptor family 5 subfamily D member 2037361066273611612Rat
1563001Sppl2asignal peptide peptidase-like 2A3114149337114193408Rat
1311061Zc3h6zinc finger CCCH type containing 63116203466116254186Rat
1311739Adisspadipose secreted signaling protein3118364730118378881Rat
1333883Or5d45-ps1olfactory receptor family 5 subfamily D member 45, pseudogene 137371019373711117Rat
1333887Olr548-psolfactory receptor pseudogene 54837243323072433790Rat
1333594Or4a77eolfactory receptor family 4 subfamily A member 77E37566397375664917Rat
1333598Or5g27bolfactory receptor family 5 subfamily G member 27B37067001370670957Rat
1334285Or5w22olfactory receptor family 5 subfamily W member 2237290756372908492Rat
1311335Slc12a6solute carrier family 12, member 639907157799170266Rat
1312004Hspa12bheat shock protein family A (Hsp70) member 12B3118346372118364374Rat
1312009Pak5p21 (RAC1) activated kinase 53123395678123703967Rat
1359517Adaladenosine deaminase-like3108101857108119557Rat
1561120Snrnp200small nuclear ribonucleoprotein U5 subunit 2003114428854114458194Rat
1334144Or4a68olfactory receptor family 4 subfamily A member 6837550259475503583Rat
1334434Or4a66colfactory receptor family 4 subfamily A member 66C37443211874433047Rat
1334286Or4a77dolfactory receptor family 4 subfamily A member 77D37579681575797765Rat
1334287Or4b1dolfactory receptor family 4 subfamily B member 1D37620784376208769Rat
1334084Or8w5-ps1olfactory receptor family 8 subfamily W member 5, pseudogene 137291437172915132Rat
1334085Or4p25-ps1olfactory receptor family 4 subfamily P member 25, pseudogene 137403868274039256Rat
1333859Or8u9olfactory receptor family 8 subfamily U member 937117538971176333Rat
1332979Or5d40olfactory receptor family 5 subfamily D member 4037367839273679342Rat
1334227Or8k22olfactory receptor family 8 subfamily K member 2237135040271351340Rat
1334115Or8h11olfactory receptor family 8 subfamily H member 1137211242472113365Rat
1334116Or4a66olfactory receptor family 4 subfamily A member 6637447501374475942Rat
1334118Or4k38-ps1olfactory receptor family 4 subfamily K member 38, pseudogene 139798488997985362Rat
1334121Or10ag58olfactory receptor family 10 subfamily AG member 5837279131972792275Rat
1334405Or8h6olfactory receptor family 8 subfamily H member 637197071071971657Rat
1334408Or4f57olfactory receptor family 4 subfamily F member 5739854460298545564Rat
1560612Phf21aPHD finger protein 21A37815876078331903Rat
1334069Or4c120olfactory receptor family 4 subfamily C member 12037517655575177490Rat
1334071Or4b1colfactory receptor family 4 subfamily B member 1C37631806676318989Rat
1332907Or5ak4olfactory receptor family 5 subfamily AK member 437041889870419827Rat
1332911Or8k30bolfactory receptor family 8 subfamily K member 30B37146931771470258Rat
1332919Or4f52olfactory receptor family 4 subfamily F member 5239782819497829132Rat
1332922Or5aq1bolfactory receptor family 5 subfamily AQ member 1B37250376272504700Rat
1332926Or8u10olfactory receptor family 8 subfamily U member 1037108197671082941Rat
1333685Olr503-psolfactory receptor pseudogene 50337147755671478153Rat
1333686Or10ag57olfactory receptor family 10 subfamily AG member 5737273758872738568Rat
1333687Or5d41bolfactory receptor family 5 subfamily D member 41B37364831973649275Rat
1334412Or4c105bolfactory receptor family 4 subfamily C member 105B37445828074459209Rat
1334414Or8k17-ps1olfactory receptor family 8 subfamily K member 17, pseudogene 137128248971283427Rat
1359607Spi1Spi-1 proto-oncogene37705974477093730Rat
1311224Fads2bfatty acid desaturase 2B37053573570575163Rat
1333049Or8w1bolfactory receptor family 8 subfamily W member 1B37290049972901425Rat
1333052Or4c31olfactory receptor family 4 subfamily C member 3137405594774056858Rat
1333053Or4p22dolfactory receptor family 4 subfamily P member 22D37407239574073336Rat
1333545Or4k37olfactory receptor family 4 subfamily K member 3739797611097977027Rat
1333550Or5g28olfactory receptor family 5 subfamily G member 2837067746070678404Rat
1333552Or9g19olfactory receptor family 9 subfamily G member 1937081788370818797Rat
1333556Or5m10bolfactory receptor family 5 subfamily M member 10B37093671770937664Rat
1333558Or9g8-ps1olfactory receptor family 9 subfamily G member 8, pseudogene 137082563770826563Rat
1333480Or4a15olfactory receptor family 4 subfamily A member 1537538249375383416Rat
1333692Or9g10olfactory receptor family 9 subfamily G member 1037079470670795641Rat
1333693Or4c15bolfactory receptor family 4 subfamily C member 15B37523224875233183Rat
1332935Or5w1e-ps1olfactory receptor family 5 subfamily W member 1E, pseudogene 137301769873018635Rat
1332937Or5w20olfactory receptor family 5 subfamily W member 2037338303773383969Rat
1332940Or5g27olfactory receptor family 5 subfamily G member 2737065392870654872Rat
1332941Or4p18bolfactory receptor family 4 subfamily P member 18B37525400375254953Rat
1334379Or4f53olfactory receptor family 4 subfamily F member 5339785359197854529Rat
1334383Or4p19b-ps1olfactory receptor family 4 subfamily P member 19B, pseudogene 137379700073797929Rat
628824Rhovras homolog family member V3106260774106270009Rat
1333038Or10ag52olfactory receptor family 10 subfamily AG member 5237262453372625513Rat
1333042Or4c114olfactory receptor family 4 subfamily C member 11437496394274964877Rat
1561009Exd1exonuclease 3'-5' domain containing 13106507839106535922Rat
1332719Or4b13-ps1olfactory receptor family 4 subfamily B member 13, pseudogene 137624982776250944Rat
1334218Or4c109olfactory receptor family 4 subfamily C member 10937484150774842442Rat
1334372Or5w11olfactory receptor family 5 subfamily W member 1137304824573049174Rat
1564710Dnajc24DnaJ heat shock protein family (Hsp40) member C2439245063192486004Rat
1334210Or4c35olfactory receptor family 4 subfamily C member 3537599342675994358Rat
1333007Olr525-psolfactory receptor pseudogene 52537192872571929021Rat
1334426Or9g3olfactory receptor family 9 subfamily G member 337080336370804298Rat
1334429Or4p7olfactory receptor family 4 subfamily P member 737378030673781277Rat
1564158Itpripl1ITPRIP like 13114403123114407917Rat
1332892Or5d37olfactory receptor family 5 subfamily D member 3737360013373601113Rat
1333660Or4c121olfactory receptor family 4 subfamily C member 12137518303175183963Rat
1333663Or8k32olfactory receptor family 8 subfamily K member 3237151528071516221Rat
1333671Or5i1olfactory receptor family 5 subfamily I member 137326761673268560Rat
1561852Ap5s1adaptor related protein complex 5 subunit sigma 13118429618118432929Rat
1334294Or4f14dolfactory receptor family 4 subfamily F member 14D39883942998840367Rat
1560411Tspan18tetraspanin 1837916006079299907Rat
1303293Tbc1d20TBC1 domain family, member 203140768537140787010Rat
1332956Or4c31colfactory receptor family 4 subfamily C member 31C37416666974167598Rat
1333815Or5m13olfactory receptor family 5 subfamily M member 1337098502370985961Rat
1333817Or4c110olfactory receptor family 4 subfamily C member 11037486027974861214Rat
1333821Or4f56olfactory receptor family 4 subfamily F member 5639850331798505239Rat
1359583C3h15orf48similar to human chromosome 15 open reading frame 483109719952109723505Rat
1333744Or4g16olfactory receptor family 4 subfamily G member 1639792584997926781Rat
1332977Olr703olfactory receptor 70337547957375480520Rat
1563136Cst2lcystatin 2 like3137116122137122502Rat
1562313Tcp11l1t-complex 11 like 139104700691092687Rat
1334276Or8u8olfactory receptor family 8 subfamily U member 837122830571229264Rat
1334278Or8k25olfactory receptor family 8 subfamily K member 2537145006671451019Rat
1334280Or4c31bolfactory receptor family 4 subfamily C member 31B37409453374095462Rat
1334281Olr726olfactory receptor 72637600808576012081Rat
1334282Or5t16olfactory receptor family 5 subfamily T member 1637209698172097916Rat
1332963Or5bo1-ps1olfactory receptor family 5 subfamily BO member 1, pseudogene 137366298573663686Rat
1311804Qser1glutamine and serine rich 139113751691202426Rat
1332896Or4f58c-ps1olfactory receptor family 4 subfamily F member 58C, pseudogene 139893305398933777Rat
1333746Or4p22olfactory receptor family 4 subfamily P member 2237419514374196084Rat
1333747Or4a70olfactory receptor family 4 subfamily A member 7037554826575549185Rat
1333748Or4x11colfactory receptor family 4 subfamily X member 11C37614045576141384Rat
3344Plcb1phospholipase C beta 13122059988122772896Rat
1332951Or5d14olfactory receptor family 5 subfamily D member 1437357743973578389Rat
1332952Or4c31eolfactory receptor family 4 subfamily C member 31E37422200774222936Rat
1332964Or4g7olfactory receptor family 4 subfamily G member 739805524198056179Rat
1332967Or8u3olfactory receptor family 8 subfamily U member 337110738771108346Rat
1359452Fam227bfamily with sequence similarity 227, member B3113226662113392396Rat
1333682Or9m1bolfactory receptor family 9 subfamily M member 1B37356548073566421Rat
1585049Or4f54olfactory receptor family 4 subfamily F member 5439790700497907942Rat
1566383Cyssl3cystatin S like 33137470409137473857Rat
1566233Dppa3-ps1developmental pluripotency-associated 3, pseudogene 13106480217106482060Rat
1565348Tgm6transglutaminase 63117324268117355674Rat
1585105Slc25a5-ps9solute carrier family 25 member 5, pseudogene 939665614596657368Rat
1583955C3h15orf62similar to human chromosome 15 open reading frame 623106164179106167404Rat
1586408Rpl18-ps9ribosomal protein L18, pseudogene 93134407050134408065Rat
1586409Or5d3olfactory receptor family 5 subfamily D member 337373409173759208Rat
1564873Cst13cystatin 133136267070136276860Rat
1359414Vps16VPS16 core subunit of CORVET and HOPS complexes3117622534117644041Rat
1565840Eif3meukaryotic translation initiation factor 3, subunit M39142475491442358Rat
1584007Harbi1harbinger transposase derived 137768143177689749Rat
1586443Or5d45olfactory receptor family 5 subfamily D member 4537369729973700236Rat
1582771Katnbl1katanin regulatory subunit B1 like 139918374899225789Rat
1587382Gapdh-ps97Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 9739834580998346810Rat
1564504Sqorsulfide quinone oxidoreductase3109841225109886724Rat
1587301Cdca7l-ps2cell division cycle associated 7 like, pseudogene 23139094276139095488Rat
1587302Eno1-ps30enolase 1, pseudogene 303135055218135056527Rat
1587304Pcbp2-ps6poly(rC) binding protein 2, pseudogene 63126118114126177008Rat
1583644Shc4SHC adaptor protein 43112880598112974216Rat
1586461Bcl2l12-ps1Bcl2 like 12, pseudogene 13134152509134153252Rat
1359371Mavsmitochondrial antiviral signaling protein3118451650118466094Rat
1585023Chst14carbohydrate sulfotransferase 143105916481105918538Rat
1587528Psmf1proteasome inhibitor subunit 13140235371140260546Rat
1583213Rtkn-ps1rhotekin, pseudogene 13122050907122052916Rat
1563839Fastkd5FAST kinase domains 53117830219117847707Rat
1587557Rad21l1RAD21 cohesin complex component like 13140160128140188324Rat
1562507Rps8-ps16ribosomal protein S8, pseudogene 1639799909497999712Rat
1563120Slx4ipSLX4 interacting protein3124220215124396797Rat
1563127Bahd1bromo adjacent homology domain containing 13105891207105914414Rat
1565299Rps3a-ps4ribosomal protein S3a, pseudogene 43118676553118678148Rat
1561726Lrrc55leucine rich repeat containing 5537026990870280651Rat
1563596Ckap5cytoskeleton associated protein 537749119577593300Rat
1562221Dcdc1-ps1doublecortin domain containing 1, pseudogene 139248605492896696Rat
1566226Sirpb3signal-regulatory protein beta 33116678935116763246Rat
1565946Pramel6preferentially expressed antigen in melanoma-like 637288501872888490Rat
1566320Smim26small integral membrane protein 263131990147131991779Rat
1582780Nop10NOP10 ribonucleoprotein39906685799067942Rat
1582782Rps25-ps11ribosomal protein S25, pseudogene 113107278950107280025Rat
1566052Elp4elongator acetyltransferase complex subunit 439216227192385251Rat
1562570Abhd12abhydrolase domain containing 12, lysophospholipase3139659315139719529Rat
1562246Gins1GINS complex subunit 13139724513139745930Rat
1562232Mfap1amicrofibrillar-associated protein 1A3108440163108456744Rat
1561740Kif18akinesin family member 18A39576438895824756Rat
1566332Pdhxpyruvate dehydrogenase complex, component X38937224889431779Rat
1560628Duoxa2dual oxidase maturation factor 23109245337109249055Rat
1565990Pramel7preferentially expressed antigen in melanoma-like 737287076372873735Rat
1566202Phgr1proline, histidine and glycine rich 13105742822105760835Rat
1566283Zfp133zinc finger protein 1333131829404131847552Rat
1565536Ccdc9bcoiled-coil domain containing 9B3105736120105745039Rat
1566005Flrt3fibronectin leucine rich transmembrane protein 33127994491128008137Rat
1562529Spg11SPG11 vesicle trafficking associated, spatacsin3109007658109072904Rat
1565143Galk1l1galactokinase 1 like 13139345180139365440Rat
1561597MgaMAX dimerization protein MGA3106851216106942908Rat
1565066Rpl38l2ribosomal protein L38 like 238177463881774955Rat
1565109Cyssl1cystatin S like 13137484098137489304Rat
1564529Nutm1NUT midline carcinoma, family member 139905351099064311Rat
1563448Ccdc73coiled-coil domain containing 7339128291991424269Rat
1563674Fahd2afumarylacetoacetate hydrolase domain containing 2A3114657176114665349Rat
1563680Cdin1CDAN1 interacting nuclease 13102441553102646935Rat
1561237Tmco5btransmembrane and coiled-coil domains 5B3100055744100083303Rat
1565648S100a11l2S100 calcium binding protein A11 like 23138989652138992491Rat
1564664C3h11orf96similar to human chromosome 11 open reading frame 9637992012579921368Rat
1564562ApipAPAF1 interacting protein38943196489458000Rat
1565206Tmco5atransmembrane and coiled-coil domains 5A3103732936103746242Rat
1562199Ap4e1adaptor related protein complex 4 subunit epsilon 13114272997114339484Rat
1586322Nrsn2neurensin 23140838813140847291Rat
1589750Hao1hydroxyacid oxidase 13121757400121828721Rat
1589751Itpainosine triphosphatase3117885464117897247Rat
1586313Sox12SRY-box transcription factor 123140859499140860518Rat
1593644Zfp106zinc finger protein 1063107459232107510507Rat
1589783Ptpmt1protein tyrosine phosphatase, mitochondrial 137688992276899427Rat
1589473Rpl12-ps5ribosomal protein L12, pseudogene 53117059318117085889Rat
1589146Or8k16olfactory receptor family 8 subfamily K member 1637074374670744687Rat
1586187Eef2-ps2eukaryotic translation elongation factor 2, pseudogene 23110340830110343575Rat
1590585Rpl22l2ribosomal protein L22-like 23116994156116994620Rat
1588523Sord-ps5sorbitol dehydrogenase, pseudogene 53100487786100491340Rat
1592203Aldoa-ps9aldolase, fructose-bisphosphate A, pseudogene 938677064886804751Rat
1590781Hsp90ab1-ps19heat shock protein 90 alpha family class B member 1, pseudogene 1938483409484836215Rat
1590225Spindoc-ps1spindlin interactor and repressor of chromatin binding, pseudogene 137272522572729783Rat
1589686Slc25a39-ps1solute carrier family 25 member 39, pseudogene 137004606570047832Rat
1592450Tmem239transmembrane 2393117604765117605978Rat
1589649NapbNSF attachment protein beta3136132248136179280Rat
1588548Pax1paired box 13134792330134801637Rat
1585192Eef1g-ps17eukaryotic translation elongation factor 1 gamma, pseudogene 1737691534676916860Rat
1585203Zcchc3zinc finger CCHC-type containing 33140872460140875292Rat
1584704Fam98b-ps3family with sequence similarity 98, member B, pseudogene 33118644247118645571Rat
1589864Muc15mucin 15, cell surface associated39729472897308641Rat
1588455Thbs1thrombospondin 13105056293105071445Rat
1565616Dnaaf9dynein axonemal assembly factor 93117918047118052641Rat
1586299Hint1-ps4histidine triad nucleotide binding protein 1, pseudogene 439341464893415233Rat
1589892Rpsa-ps6ribosomal protein SA, pseudogene 63139368299139380092Rat
1585000Galk1-ps4galactokinase 1, pseudogene 43139360447139361681Rat
1585001Tead2-ps1TEA domain transcription factor 2, pseudogene 13138583467138585546Rat
1585002Amd1-ps3adenosylmethionine decarboxylase 1, pseudogene 33134533682134535868Rat
1587010Nelfa-ps1negative elongation factor complex member A, pseudogene 137052263470525853Rat
1586246Rps6-ps12ribosomal protein S6, pseudogene 1239551722895517667Rat
1590891Rpap1RNA polymerase II associated protein 13106746642106768182Rat
2434Cst8cystatin 83136244586136255412Rat
1587441Immp1linner mitochondrial membrane peptidase subunit 139238532992449559Rat
1590645Ckap2lcytoskeleton associated protein 2-like3116497186116524302Rat
1586250Rpl7-ps2ribosomal protein L7, pseudogene 239543723395437977Rat
1589647Nfkb2-ps1nuclear factor kappa B subunit 2, pseudogene 13139964528139967770Rat
1588215Ebf4EBF family member 43117498186117566566Rat
1588496Ahcy-ps8adenosylhomocysteinase, pseudogene 83111306794111307688Rat
1588500Ahcy-ps7adenosylhomocysteinase, pseudogene 739600873296009992Rat
1588501Rpl6-ps11ribosomal protein L6, pseudogene 1139173947691741626Rat
1588503Rps8-ps15ribosomal protein S8, pseudogene 1538925028289255154Rat
1588504Myl12b-ps1myosin light chain 12B, pseudogene 138487283384873338Rat
1588505Vps26c-ps1VPS26 endosomal protein sorting factor C, pseudogene 138310296783141840Rat
1593433Fbxo3F-box protein 339041726290449557Rat
1597982Shld1shieldin complex subunit 13119938695120011068Rat
1593599Tra2b-ps3transformer 2 beta, pseudogene 33109634622109636026Rat
1596174Fth1-ps5ferritin heavy chain 1, pseudogene 53136914889136915757Rat
1592240Hsp90ab1-ps24heat shock protein 90 alpha family class B member 1, pseudogene 2438591628385918458Rat
1592252Necap1-ps1NECAP endocytosis associated 1, pseudogene 138544977285453693Rat
1591768Mthfd1-ps1methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1, pseudogene 13116195791116198973Rat
1595990Afg2bAFG2 AAA ATPase homolog B3109694739109708356Rat
1596924Dpp3l1dipeptidylpeptidase 3 like 13136920237136922858Rat
1594965Or5d18olfactory receptor family 5 subfamily D member 1837351652273517463Rat
1594971Or5d35olfactory receptor family 5 subfamily D member 3537351026673511198Rat
1595007Or9m1l1olfactory receptor family 9 subfamily M member 1 like 137339172173392674Rat
1593370Pla2g4fphospholipase A2, group IVF3107249053107266201Rat
1593372Pla2g4dphospholipase A2 group IVD3107220973107242224Rat
1594601Gabarap-ps2GABA type A receptor-associated protein, pseudogene 23106839998106840386Rat
1593334Terb2telomere repeat binding bouquet formation protein 23109138343109156700Rat
1593338Eif3jeukaryotic translation initiation factor 3, subunit J3108985103109007341Rat
1593345Strcstereocilin3108335920108355114Rat
1593350Tgm5transglutaminase 53108008087108044013Rat
1594832Cyssl2cystatin S like 23137328443137333183Rat
1594833Serpinb1a-ps1serpin family B member 1A, pseudogene 137486199474862665Rat
1596039Accsl1-aminocyclopropane-1-carboxylate synthase-like37982646479841163Rat
1593360Stard9StAR-related lipid transfer domain containing 93107581097107672746Rat
1591076Mcl1-ps1MCL1 apoptosis regulator, BCL2 family member, pseudogene 13138869221138871032Rat
1596799Ncaphnon-SMC condensin I complex, subunit H3114371937114399178Rat
1597283Zfp770zinc finger protein 7703100963430100971663Rat
1590196St13-ps7ST13, Hsp70 interacting protein, pseudogene 737274006372741653Rat
1588365Pycr3-ps1pyrroline-5-carboxylate reductase 3, pseudogene 13131654565131656473Rat
1588366Dstndestrin, actin depolymerizing factor3131284647131311361Rat
1588368Serf2small EDRK-rich factor 23108426960108430736Rat
1588370Or4f62olfactory receptor family 4 subfamily F member 6239891296298913924Rat
1588371Riox2-ps5ribosomal oxygenase 2, pseudogene 537911599679118672Rat
1588372Rad21-ps1RAD21 cohesin complex component, pseudogene 137324366573247680Rat
1588621Them7thioesterase superfamily member 739166614491834783Rat
1597330Prdm11PR/SET domain 1137892565479005495Rat
1591313Or4p23olfactory receptor family 4 subfamily P member 2337453238974533315Rat
1591318Macrod2mono-ADP ribosylhydrolase 23127720066129737511Rat
1590104Or4c124olfactory receptor family 4 subfamily C member 12437530108875302047Rat
1597027Ldha-ps10lactate dehydrogenase A, pseudogene 103127091593127092669Rat
1594334Bex4-ps1brain expressed X-linked 4, pseudogene 137476402874764725Rat
1595953Ankrd63ankyrin repeat domain 633105675148105679970Rat
1597405Cstdc2cystatin domain containing 23136302588136336782Rat
2290039Jmjd7jumonji domain containing 73106998454107004538Rat
2318583Znf408zinc finger protein 40837761559577621325Rat
2319932Wac-ps2WW domain containing adaptor with coiled-coil, pseudogene 23114996917114998457Rat
2319335C1h9orf85-ps1similar to human chromosome 9 open reading frame 85, pseudogene 138433888884339352Rat
2318156Timm23-ps8translocase of inner mitochondrial membrane 23, pseudogene 838003605180037343Rat
2318201Or5d14l1olfactory receptor family 5 subfamily D member 14 like 137352753873528482Rat
2320108Actg1l1actin, gamma 1 like 137297776772979691Rat
2320129Wbp4-ps1WW domain binding protein 4, pseudogene 13130893186130894522Rat
2320137Slc25a5-ps2solute carrier family 25 member 5, pseudogene 23126797239126798867Rat
2319534Rrp8-ps1ribosomal RNA processing 8, pseudogene 138308598883099873Rat
2320277Hmgn2l1high mobility group nucleosomal binding domain 2 like 13126570438126573173Rat
2320314Gapdh-ps49Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 493126310113126311401Rat
2318489LOC100362296protein S100-A11-like3138537579138539300Rat
2320328Mrpl47-ps2mitochondrial ribosomal protein L47, pseudogene 23126190337126191320Rat
2320350Rplp1-ps2ribosomal protein lateral stalk subunit P1, pseudogene 23124192239124192965Rat
2321296Zscan5b-ps1zinc finger and SCAN domain containing 5B, pseudogene 13120342424120353794Rat
2320789Rpl32-ps1ribosomal protein L32, pseudogene 13112494978112495501Rat
2322993Rps8-ps17ribosomal protein S8, pseudogene 1739858610998586784Rat
2323045Cbx3-ps2chromobox 3, pseudogene 239849921098499603Rat
2321715Rps12l12ribosomal protein S12-like 123117490998117491509Rat
2323164Hnrnph1-ps2heterogeneous nuclear ribonucleoprotein H1, pseudogene 23140311910140336606Rat
2322673Tfdp1-ps1transcription factor Dp-1, pseudogene 137299230272994057Rat
2323331Hspa9-ps1heat shock protein family A (Hsp70) member 9, pseudogene 137185894871862626Rat
2323360Tmem74bostransmembrane 74B, opposite strand3140197773140204953Rat
2323539Ranbp3-ps1RAN binding protein 3, pseudogene 137149909571505092Rat
2324275Ppp3r1-ps2protein phosphatase 3, regulatory subunit B, alpha, pseudogene 23138924775138926246Rat
2323648Hmgn2-ps3high mobility group nucleosomal binding domain 2, pseudogene 339999074399991003Rat
2323669Prelid1-ps1PRELI domain containing 1, pseudogene 139901965499024330Rat
2323858Cstf3-ps1cleavage stimulation factor subunit 3, pseudogene 139901004299010499Rat
2323964D430041D05RiklRIKEN cDNA D430041D05 gene like39050655990782427Rat
2325492Mir674microRNA 6743104053133104053209Rat
2325507Mir147microRNA 1473109722692109722770Rat
2325612Mir129-2microRNA 129-238020204480202140Rat
6492495Pias2-ps1protein inhibitor of activated STAT, 2, pseudogene 137621631976229747Rat
6493462Rpl6-ps12ribosomal protein L6, pseudogene 123121885601121891992Rat
6486258Insm1INSM transcriptional repressor 13133640030133642963Rat
6487743Rpl19-ps1ribosomal protein L19, pseudogene 139731648097318945Rat
6496122Oip5-as1OIP5 antisense RNA 13106578309106591845Rat
6497629Srsf3-ps4serine and arginine rich splicing factor 3, pseudogene 439506089495145150Rat
6500739Or4c10olfactory receptor family 4 subfamily C member 1037592887275930939Rat
6500748LOC100909998zinc finger protein 2-like3114793783114818395Rat
6500810Atp5mc1-ps3ATP synthase membrane subunit c locus 1, pseudogene 337990528579908374Rat
7499004Phb2-ps2prohibitin 2, pseudogene 23108841197108843373Rat
7489028Mir103a2microRNA 103a-23118510194118510279Rat
75244363300002I08Rikl1RIKEN cDNA 3300002I08 gene like 13138835647138983464Rat
7525020LOC102552075uncharacterized LOC10255207539036239190366122Rat
7504683LOC102555661uncharacterized LOC1025556613139302498139325804Rat
7541619LOC102554820uncharacterized LOC1025548203138812737138837689Rat
7509526LOC102554505uncharacterized LOC1025545053129787752129844601Rat
7531281LOC102551977uncharacterized LOC10255197739034334690350105Rat
7532501LOC102547276uncharacterized LOC1025472763118105557118110171Rat
7533201Smokxl3sperm motility kinase x like 33138846516138851436Rat
7513945LOC102550049uncharacterized LOC1025500493118575112118610817Rat
7536034Rps4x-ps2ribosomal protein S4, X-linked, pseudogene 23108672163108673023Rat
7536035LOC102552950uncharacterized LOC1025529503102223143102232648Rat
7539539LOC102549766uncharacterized LOC10254976638113790181152786Rat
7520429LOC102549662uncharacterized LOC1025496623135584899135588967Rat
7631496LOC102551848uncharacterized LOC1025518483137910697137956233Rat
7631560Wdr12-ps1WD repeat domain 12, pseudogene 13100073403100074186Rat
7632234LOC102549184uncharacterized LOC10254918439019021790263371Rat
7662975Atp5mc1-ps1ATP synthase membrane subunit c locus 1, pseudogene 137792215677933684Rat
7664087LOC102547911uncharacterized LOC1025479113124901646124968413Rat
7615199Tgm7transglutaminase 73108051890108068116Rat
7635188LOC102549265uncharacterized LOC1025492653116448610116456120Rat
7636000LOC102552951uncharacterized LOC1025529513119891578119909584Rat
7574865LOC102548897zinc finger protein 844-like3136218562136219077Rat
7625660LOC102546895uncharacterized LOC10254689537876463778790315Rat
7656316LOC102547396uncharacterized LOC1025473963139500272139521248Rat
7587343LOC102547081uncharacterized LOC1025470813134516091134524752Rat
7643344LOC102552722uncharacterized LOC1025527223119284683119302115Rat
7617590LOC102548210uncharacterized LOC1025482103126677895126702104Rat
7571782LOC102555365uncharacterized LOC1025553653133311274133322017Rat
7597217Abt1-ps2activator of basal transcription 1, pseudogene 23139733866139736658Rat
7572515LOC102555822uncharacterized LOC1025558223114910231114924485Rat
7544371LOC102555456uncharacterized LOC1025554563102959088102971208Rat
7579074LOC102555599olfactory receptor 5L1-like37344479973445737Rat
7547607ZNF69lzinc finger protein 69 like3138545521138560500Rat
7547984LOC102553090uncharacterized LOC1025530903102232706102238710Rat
7562764LOC102548045uncharacterized LOC1025480453105704400105714041Rat
7551590Zfp442zinc finger protein 4423138655982138675874Rat
7605010LOC102550304uncharacterized LOC1025503043131522575131526274Rat
7607903Tmf1-ps1TATA element modulatory factor 1, pseudogene 13113022599113027243Rat
7691208LOC102548278uncharacterized LOC1025482783139874129139907159Rat
7735873Snrpf-ps3small nuclear ribonucleoprotein polypeptide F, pseudogene 33115420800115423872Rat
7751632LOC102555576uncharacterized LOC1025555763115424504115507561Rat
7694064LOC102548446uncharacterized LOC1025484463139968512139978326Rat
7751921Rack1-ps3receptor for activated C kinase 1, pseudogene 33132057645132058996Rat
7694271LOC102555600uncharacterized LOC10255560037664321876665885Rat
7678100Cks2-ps1CDC28 protein kinase regulatory subunit 2, pseudogene 13104998500105012016Rat
7684934LOC10255119760S ribosomal protein L19-like39918359799198224Rat
7689509LOC102548575uncharacterized LOC1025485753140037968140040907Rat
7726691LOC102554852uncharacterized LOC1025548523120385353120408304Rat
7727044LOC102556271uncharacterized LOC1025562713114766560114769026Rat
7690189LOC102555070uncharacterized LOC1025550703111988107111993983Rat
7738850LOC102546693uncharacterized LOC10254669337839610678414091Rat
7717583LOC102555217zinc finger protein 120-like3138595665138627247Rat
7742870LOC102549488uncharacterized LOC1025494883138980916139033402Rat
7743163LOC102548892uncharacterized LOC10254889238981242089824719Rat
7718425LOC102552721uncharacterized LOC1025527213101344132101516024Rat
7747897Zfp120zinc finger protein 1203138763244138791042Rat
7709640LOC102547655uncharacterized LOC1025476553124631974124666366Rat
7681354LOC102550367uncharacterized LOC1025503673115713494115795134Rat
9076375Dll4l1delta like canonical Notch ligand 4 like 13106311472106317974Rat
9145171LOC103691916uncharacterized LOC1036919163135994960136042640Rat
9153540LOC103691883uncharacterized LOC1036918833114528697114529457Rat
9106594LOC103691857prohibitin-2 pseudogene39744309897444431Rat
9163856P22k15-ps1cystatin related protein 2, pseudogene 13136534719136631118Rat
9165094LOC103691852gamma-aminobutyric acid receptor-associated protein-like 2 pseudogene39152789891540529Rat
9209512LOC103691847uncharacterized LOC10369184737801233878013177Rat
9354787LOC103691849uncharacterized LOC10369184938769980387711037Rat
9277103LOC103691860uncharacterized LOC1036918603100607628100667327Rat
9282085LOC103691897uncharacterized LOC1036918973121755209121758182Rat
9250626Haus2HAUS augmin like complex subunit 23107553146107565982Rat
9302596Ervv-2endogenous retrovirus group V member 2, envelope3119129119119135004Rat
9261493LOC103691844uncharacterized LOC10369184437664746776650894Rat
9463287LOC103691911uncharacterized LOC1036919113131577961131591149Rat
9388772LOC103691856uncharacterized LOC10369185639491833294929236Rat
9390404LOC103691839olfactory receptor 5M3-like37106604471066988Rat
9432037LOC103691864uncharacterized LOC1036918643102953525102954651Rat
94760121810024B03RiklRIKEN cDNA 1810024B03 gene like3139125202139171387Rat
9459076Gsta4-ps3glutathione S-transferase alpha 4, pseudogene 33118059138118069958Rat
11355719LOC108350566heterogeneous nuclear ribonucleoproteins A2/B1 pseudogene3118679416118680923Rat
11366792Eif4a1-ps3eukaryotic translation initiation factor 4A1, pseudogene 33133493365133494262Rat
11455941Rps26-ps9ribosomal protein S26, pseudogene 937677321576773918Rat
10401149Mtlnmitoregulin3115018810115019668Rat
11448890LOC10835060640S ribosomal protein S28 pseudogene39843050798430716Rat
11433440Rps29-ps15ribosomal protein S29, pseudogene 153140488269140488605Rat
11436885LOC108350585uncharacterized LOC10835058539968916699690876Rat
11445349LOC108350417uncharacterized LOC10835041737846585678494535Rat
11459092LOC108350458uncharacterized LOC1083504583114769516114793766Rat
11446767LOC108350462uncharacterized LOC1083504623117137843117180099Rat
11448031LOC108350426uncharacterized LOC10835042639041443190417376Rat
11361547Inafm2InaF motif containing 23105728208105733766Rat
11450983LOC108350455uncharacterized LOC1083504553112271347112275444Rat
11429098LOC108350564glycine cleavage system H protein, mitochondrial pseudogene3106154314106157906Rat
11430655Rpl35al6ribosomal protein L35A like 639236974192370081Rat
11440623LOC108350484uncharacterized LOC1083504843133074431133086736Rat
11440632LOC108350490uncharacterized LOC1083504903134823759134827977Rat
11453203LOC108350483probable rRNA-processing protein EBP2 pseudogene3133160018133161377Rat
11414648LOC108350499uncharacterized LOC1083504993139537657139575790Rat
11414657LOC108350559alpha-enolase pseudogene37281684372817685Rat
11426867LOC108350486uncharacterized LOC1083504863133710823133715862Rat
11407687Trnah-gug7transfer RNA histidine (anticodon GUG) 73109323124109323195Rat
11409438Cpne8l1copine 8 like 137512316575124523Rat
11400029Rnaset2-ps1ribonuclease T2, pseudogene 13138600084138600943Rat
11378802Trnas-gcu4transfer RNA serine (anticodon GCU) 43106029258106029339Rat
11390742LOC108350474uncharacterized LOC1083504743124346668124352305Rat
11391622Smokl-ps2sperm motility kinase like, pseudogene 23139235422139238434Rat
11392957LOC108350422uncharacterized LOC10835042238872774188733580Rat
11382618LOC108350494UPF0472 protein C16orf72 homolog pseudogene3138736034138749614Rat
11476027Trnah-gug9transfer RNA histidine (anticodon GUG) 93109325246109325317Rat
11501358LOC108350480glyceraldehyde-3-phosphate dehydrogenase pseudogene3131933978131936843Rat
11477246LOC108350415low molecular weight phosphotyrosine protein phosphatase pseudogene37755665177560912Rat
11503373LOC108350469uncharacterized LOC1083504693120626945120631997Rat
11504008LOC108350601uncharacterized LOC10835060137249395372507941Rat
11495800Smokxl-ps4sperm motility kinase X like, pseudogene 43139056925139057765Rat
11507744LOC108350472uncharacterized LOC1083504723123833102124042494Rat
11496245Trnah-gug8transfer RNA histidine (anticodon GUG) 83109324630109324701Rat
11497432LOC108350459uncharacterized LOC1083504593114844866114849140Rat
11483653LOC108350487uncharacterized LOC1083504873133969341133998166Rat
11484255LOC108350428uncharacterized LOC10835042839248601992546067Rat
11518089LOC108350445uncharacterized LOC1083504453107380534107408993Rat
11487974LOC108350489uncharacterized LOC1083504893134664020134683310Rat
11490080LOC10835044440S ribosomal protein S20 pseudogene3106636402106639571Rat
41380011LOC120101629uncharacterized LOC1201016293101212971101241464Rat
41110845Trnaa-agc76transfer RNA alanine (anticodon AGC) 7637758347877583559Rat
41112066LOC120101704uncharacterized LOC1201017043125747891125756388Rat
41167816LOC120102056small nucleolar RNA SNORA173116105515116105641Rat
41203361Trnat-agu15transfer RNA threonine (anticodon AGU) 153133229015133229095Rat
41204131Grb7-ps1growth factor receptor bound protein 7, pseudogene 139567454195676044Rat
41276602LOC120101649uncharacterized LOC1201016493112609056112611665Rat
41276891Snord17small nucleolar RNA, C/D box 173131636460131636698Rat
41281400LOC120101661uncharacterized LOC1201016613116889857116899563Rat
41355606LOC120102069small nucleolar RNA SNORA1739846812998468259Rat
41381369LOC120101611uncharacterized LOC12010161139018278190188854Rat
41381402LOC120102016small nucleolar RNA SNORA2137820850478208636Rat
41088749LOC12010165040S ribosomal protein S14-like3112838842112839309Rat
41112624LOC120101593uncharacterized LOC12010159337100253871014287Rat
41113166LOC120101643sodium/nucleoside cotransporter 2-like3109505640109535183Rat
41139445LOC120101648uncharacterized LOC1201016483111840429111871313Rat
41139969LOC120101618uncharacterized LOC12010161839242265192441625Rat
41284146LOC120101747uncharacterized LOC1201017473139704462139719166Rat
41284298Eif1-ps6eukaryotic translation initiation factor 1, pseudogene 63136905975136915055Rat
41357829LOC120101941U6 spliceosomal RNA3127769125127769231Rat
41088816LOC120101727uncharacterized LOC1201017273135551775135567986Rat
41114246LOC120101453uncharacterized LOC12010145338926395089270379Rat
41114726LOC120102037small nucleolar RNA SNORA483106034295106034427Rat
41114814Dmdl1dystrophin like 13110282105110284854Rat
41141334LOC120101637uncharacterized LOC1201016373105220427105224274Rat
41170365LOC120101678uncharacterized LOC1201016783122855153122862617Rat
41206203LOC120101948U6 spliceosomal RNA3108403290108403396Rat
41284704Rnu105cRNA, U105C small nucleolar3108399872108400075Rat
41358242Cox4i1-ps1cytochrome c oxidase subunit 4i1, pseudogene 139027532090276023Rat
41206601LOC120101606uncharacterized LOC12010160638840142488413464Rat
41280229LOC120101467cystatin-S-like3137300845137312492Rat
41172918LOC120101644sodium/nucleoside cotransporter 2-like3109577556109593992Rat
41209037LOC120101638uncharacterized LOC1201016383105479444105487982Rat
41260013Trnaa-ggc3transfer RNA alanine (anticodon GGC) 339587068095870752Rat
41119407LOC120101733uncharacterized LOC1201017333138389404138405290Rat
41119604Dnajb6-ps7DnaJ heat shock protein family (Hsp40) member B6, pseudogene 73139095867139098394Rat
41147450LOC120101652uncharacterized LOC1201016523112807157112814132Rat
41147582LOC120101654mitochondrial fission regulator 1-like3114286751114293220Rat
41261678LOC120102051small nucleolar RNA SNORA1739095445990954588Rat
41328988LOC120101934U6 spliceosomal RNA3118057755118057861Rat
41329094LOC120101609uncharacterized LOC12010160938987468189900390Rat
41330244LOC120101722uncharacterized LOC1201017223131481568131487131Rat
41095689LOC120102045small nucleolar RNA SNORA1739452680394526933Rat
41096059LOC120101721uncharacterized LOC1201017213131396632131400429Rat
41119918LOC120101464cystatin-S-like3137205417137228473Rat
41148559LOC120101598uncharacterized LOC12010159837855911578561802Rat
41187367Zscan29-ps1zinc finger and SCAN domain containing 29, pseudogene 13108136468108140431Rat
41211223S100a11-ps3S100 calcium binding protein A11, pseudogene 33139245086139246190Rat
41262294Smokxl-ps6sperm motility kinase X like, pseudogene 63138463218138465215Rat
41339341LOC120102127U4 spliceosomal RNA38551434785514473Rat
41364680LOC120101972U6 spliceosomal RNA3113775940113776054Rat
41096965LOC120101996U7 small nuclear RNA38862063088620693Rat
41097361LOC120102115U2 spliceosomal RNA3119557611119557671Rat
41150898Smokxl-ps7sperm motility kinase X like, pseudogene 73139079155139079993Rat
41189848LOC120102020small nucleolar RNA SNORA5537056510270565233Rat
41212619LOC120102013small nucleolar RNA SNORA4437672882376728928Rat
41098665LOC120101949U6 spliceosomal RNA3139543541139543645Rat
41098980LOC120102060small nucleolar RNA SNORA173130325643130325780Rat
41123014LOC120101660uncharacterized LOC1201016603116555888116568213Rat
41288053LOC120101714glyceraldehyde-3-phosphate dehydrogenase-like3126349641126350664Rat
41343396LOC120101698uncharacterized LOC1201016983125347840125378621Rat
41343713LOC120102061small nucleolar RNA SNORA1739402097194021100Rat
41367619Rnu6-383RNA, U6 small nuclear 38337450439974504503Rat
41368639LOC120101605uncharacterized LOC12010160538550759585531319Rat
41395566Rps10-ps19ribosomal protein S10, pseudogene 1938991129689911949Rat
41099731Snora51small nucleolar RNA, H/ACA box 513117478742117478873Rat
41156540Rnu6-841RNA, U6 small nuclear 84138133842281338524Rat
41193039LOC120101914uncharacterized LOC1201019143107696606107714056Rat
41215235LOC120101647oogenesin-3-like3109926856109927633Rat
41288477Rnu6-107RNA, U6 small nuclear 10737243977872439879Rat
41289263Scarna4l2small Cajal body-specific RNA 4 like 23123674265123674392Rat
41396104Trnaa-agc54transfer RNA alanine (anticodon AGC) 543134357728134357802Rat
41126259LOC120102095small nucleolar RNA SNORA1139930499799305125Rat
41157710LOC120093166protein-glutamine gamma-glutamyltransferase 5-like3108028742108048946Rat
41158921LOC120101950U6 spliceosomal RNA3133775907133776009Rat
41183431LOC120102029small nucleolar RNA SNORA483136282679136282826Rat
41290327LOC120102010small nucleolar RNA SNORA153107415211107415319Rat
41346969Rnu6-1089RNA, U6 small nuclear 108937223844172238547Rat
41127869LOC120102104small nucleolar RNA U853135571162135571451Rat
41160055LOC120101659uncharacterized LOC1201016593116391390116393379Rat
41160367LOC120101912uncharacterized LOC12010191237747311277476085Rat
41184129LOC120101599uncharacterized LOC12010159937845666578462854Rat
41184973LOC120101466cystatin-S-like3137268963137273711Rat
41195488LOC120101600uncharacterized LOC12010160037874042878767369Rat
41271028LOC120101670uncharacterized LOC1201016703119756587119762871Rat
41291997LOC120101612uncharacterized LOC12010161239002848490060741Rat
41292422Anp32e-ps1acidic nuclear phosphoprotein 32 family member E, pseudogene 13140155661140159968Rat
41348066LOC120101636uncharacterized LOC1201016363105049041105052980Rat
41348658LOC120101686uncharacterized LOC1201016863124333829124338856Rat
41372959LOC120101613uncharacterized LOC12010161338995319089954869Rat
41071997LOC120101597uncharacterized LOC12010159737813429878153037Rat
41072169LOC120102128U4 spliceosomal RNA3109433925109434099Rat
41105165Rnu6-434RNA, U6 small nuclear 43438946836889468474Rat
41105213LOC120102106U2 spliceosomal RNA39242263292422822Rat
41197209LOC120101748uncharacterized LOC1201017483139954705139964363Rat
41229593LOC120101622uncharacterized LOC12010162239683402496859796Rat
41294038LOC120101749uncharacterized LOC1201017493139891547139936867Rat
41081935Galk1-ps3galactokinase 1, pseudogene 33139074227139079172Rat
41163706LOC120101716uncharacterized LOC1201017163127209267127212053Rat
41199054Nsa2-ps5NSA2 ribosome biogenesis factor, pseudogene 53122162700122163365Rat
41231371LOC120102071small nucleolar RNA SNORA173130137075130137194Rat
41272284LOC120101666uncharacterized LOC1201016663119150650119159816Rat
41272986LOC120102042small nucleolar RNA SNORA173102077660102077791Rat
41295610Rpl9-ps5ribosomal protein L9, pseudogene 537305870673059260Rat
41401869LOC120101681olfactory receptor 4A16-like37544536175446344Rat
41083699LOC120101961U6 spliceosomal RNA37231755172317654Rat
41132131LOC120101462uncharacterized LOC1201014623135737056135740540Rat
41164137Rpl7-ps19ribosomal protein L7, pseudogene 193110312211110312971Rat
41200055LOC120101603uncharacterized LOC12010160337972968479741304Rat
41232419Snord110small nucleolar RNA, C/D box 1103117477945117478013Rat
41274074LOC120101454uncharacterized LOC12010145439998760999989479Rat
41320428Gapdh-ps87Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 873127431140127432363Rat
41377247LOC120101634uncharacterized LOC1201016343104739185104768591Rat
41377672Rnu6-45RNA, U6 small nuclear 453117917815117917917Rat
41084667Snord56small nucleolar RNA, C/D box 563117480197117480266Rat
41109379H2az2-ps1H2A.Z variant histone 2, pseudogene 13105553551105557545Rat
41165495Akr1b1-ps6aldo-keto reductase family 1 member B, pseudogene 63105453204105456990Rat
41166556LOC120102097U6atac minor spliceosomal RNA37387989073880015Rat
41201670Chp1-ps1calcineurin-like EF-hand protein 1, pseudogene 13125069990125070498Rat
41232979Galk1-ps1galactokinase 1, pseudogene 13138465217138468099Rat
41233677LOC120101936U6 spliceosomal RNA3135194918135195023Rat
41234200Snord57small nucleolar RNA, C/D box 573117480517117480588Rat
40971044Cct8-ps4chaperonin containing Tcp1, subunit 8 (theta), pseudogene 43121667549121680078Rat
40972321LOC120101646uncharacterized LOC1201016463109917153109919854Rat
41015933LOC120101626uncharacterized LOC1201016263100090853100100922Rat
40974503LOC120102033small nucleolar RNA SNORA4839995498199955113Rat
41341385LOC120101685uncharacterized LOC1201016853124143576124157473Rat
40953006LOC120102047small nucleolar RNA SNORA173136056090136056221Rat
40976983LOC120101913uncharacterized LOC12010191339955234199560547Rat
40977179Eno1-ps31enolase 1, pseudogene 3138676747386768066Rat
41012882LOC120101723uncharacterized LOC1201017233132778720132796217Rat
41013566LOC120102028small nucleolar RNA SNORA483110656354110656498Rat
40954948LOC120101725uncharacterized LOC1201017253135364107135467677Rat
40927741Rnu6-603RNA, U6 small nuclear 6033106276929106277024Rat
40955557LOC120101662uncharacterized LOC1201016623118315987118319330Rat
40955793LOC120101970U6 spliceosomal RNA3123329939123330048Rat
40980031Hnrnph1-ps1heterogeneous nuclear ribonucleoprotein H1, pseudogene 139476387394768031Rat
40998754LOC120102099small nucleolar RNA U133103775219103775328Rat
40999887LOC120101919uncharacterized LOC1201019193122153798122157189Rat
41000018Snphl1syntaphilin like 13140136868140139247Rat
40929690LOC120101465cystatin-S-like3137241240137245990Rat
40957643LOC120101621uncharacterized LOC12010162139655833696598221Rat
41001010LOC120102023U1 spliceosomal RNA3105017369105017530Rat
40931098LOC120101459uncharacterized LOC1201014593126395727126396666Rat
40959111Trnaa-agc34transfer RNA alanine (anticodon AGC) 3437716137077161444Rat
40982723LOC120101754uncharacterized LOC1201017543140478638140482705Rat
41003609LOC120102008small nucleolar RNA SNORA36 family3131699975131700105Rat
40933111LOC120102122U4 spliceosomal RNA3133102492133102574Rat
40984830LOC120101993U7 small nuclear RNA38449983684499900Rat
40984840Dnajb6-ps9DnaJ heat shock protein family (Hsp40) member B6, pseudogene 93138437900138439108Rat
41005833LOC120102134U6 spliceosomal RNA37183475771834863Rat
40960957Mrto4-ps4mRNA turnover 4, ribosome maturation factor, pseudogene 43100458801100476903Rat
40961474LOC120101915barrier-to-autointegration factor-like3108698917108699164Rat
40985490LOC120102004small nucleolar RNA SNORA64/SNORA10 family38065855380658689Rat
40962922LOC120102093small Cajal body-specific RNA 2139042836690428504Rat
40963061LOC120101909uncharacterized LOC12010190937706457177091751Rat
40939342LOC120102063small nucleolar RNA SNORA1739849302998493156Rat
40939444LOC120101744uncharacterized LOC1201017443139175955139241065Rat
40939791Brcc3-ps3BRCA1/BRCA2-containing complex, subunit 3, pseudogene 339882057498821258Rat
40965090LOC120101715uncharacterized LOC1201017153126818605126936623Rat
40965212LOC120101615uncharacterized LOC12010161539033404890337821Rat
40991209Cycs-ps4cytochrome c, somatic, pseudogene 43119184668119185773Rat
40966033LOC120101452olfactory receptor 4A15-like37549099175491908Rat
40966702LOC120101719uncharacterized LOC1201017193130524370130574657Rat
40992335Tk1-ps2thymidine kinase 1, pseudogene 23109191206109192343Rat
40941813LOC120102064small nucleolar RNA SNORA1739434073894340864Rat
40967222LOC120101916uncharacterized LOC1201019163108610335108612905Rat
40944166Rnu6-722RNA, U6 small nuclear 7223139747792139747893Rat
41075492LOC120102027small nucleolar RNA SNORA4837030782370307964Rat
41050347Rpl12-ps12ribosomal protein L12, pseudogene 123118339360118342238Rat
41246379LOC120101602uncharacterized LOC12010160237933748679342517Rat
41316947LOC120102055small nucleolar RNA SNORA173117295470117295602Rat
41027581LOC120101738uncharacterized LOC1201017383138491426138549109Rat
41079124Eno1-ps25enolase 1, pseudogene 253104028008104029277Rat
41248306LOC120102129U6 spliceosomal RNA3118319647118319753Rat
41029490Snord86small nucleolar RNA, C/D box 863117479698117479783Rat
41135936LOC120102116U2 spliceosomal RNA37736323077363387Rat
41053904LOC120101628uncharacterized LOC1201016283100775166100787590Rat
41255595LOC120101973U6 spliceosomal RNA37717341177173516Rat
41338255LOC120102043small nucleolar RNA SNORA1738061644080616571Rat
41055206Andpro-ps1androgen regulated protein, pseudogene 13136862196136879373Rat
41055476LOC120102036small nucleolar RNA SNORA483113905684113905826Rat
41056854Trnaa-agc45transfer RNA alanine (anticodon AGC) 453116086177116086257Rat
41317548LOC120101705uncharacterized LOC1201017053125935521125965953Rat
41058592LOC120102054small nucleolar RNA SNORA173139854323139854450Rat
41222800LOC120101639uncharacterized LOC1201016393105625378105634875Rat
41223283LOC120101718uncharacterized LOC1201017183129991230130019643Rat
41298797LOC120102030small nucleolar RNA SNORA483103045835103045977Rat
41299235Rnu6-886RNA, U6 small nuclear 88637622041576220521Rat
41060366LOC120101756uncharacterized LOC1201017563140515978140541284Rat
41337677LOC120101753uncharacterized LOC1201017533140405557140414036Rat
41035097Ankrd40-ps3ankyrin repeat domain 40, pseudogene 33138893278138895202Rat
41225295LOC120101692uncharacterized LOC1201016923124971230124981753Rat
41225358LOC120101726uncharacterized LOC1201017263135472358135477469Rat
41225679Snord67small nucleolar RNA, C/D box 6737757338077573489Rat
41227463LOC120102073small nucleolar RNA SNORA173132960051132960169Rat
41038490LOC120101966U6 spliceosomal RNA3119971782119971889Rat
41236200LOC120101717uncharacterized LOC1201017173129895901129961517Rat
41018009Rnu1-39RNA, U1 small nuclear 393136257921136258086Rat
41238482LOC120102132U6 spliceosomal RNA3105111125105111231Rat
41305975LOC120101910uncharacterized LOC12010191037734257777357711Rat
41019236LOC120102118small nucleolar RNA U33117407488117407574Rat
41044559LOC120102025small nucleolar RNA SNORA4839473313494733277Rat
41046177Rnu6-897RNA, U6 small nuclear 8973121508617121508711Rat
41073926LOC120101729uncharacterized LOC1201017293138178349138187949Rat
41309304Rpl30-ps15ribosomal protein L30, pseudogene 1537035037270350850Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)689762877106752806Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)658632962103632962Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)673463459109394713Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)682523650110548006Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)67222764181132889Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)672202632117202632Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
2293088Iddm28Insulin dependent diabetes mellitus QTL 285.21blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)66304056271636266Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
2312560Pur20Proteinuria QTL 202.10.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6125628133137801795Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)672202632115200186Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)657730540104085867Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)683190345106747639Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)671201409116201409Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)661747639106747639Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)657730540104085867Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
1300076Glom8Glomerulus QTL 879e-09kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6122549046137801795Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)667262953112262953Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
4889848Pur25Proteinuria QTL 25140.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)65672856290198260Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)689762877106752806Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)658632962103632962Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)673463459109394713Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)682523650110548006Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)67222764181132889Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)672202632117202632Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
2293088Iddm28Insulin dependent diabetes mellitus QTL 285.21blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)66304056271636266Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
2312560Pur20Proteinuria QTL 202.10.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6125628133137801795Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)672202632115200186Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)657730540104085867Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)683190345106747639Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)671201409116201409Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)661747639106747639Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)657730540104085867Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
1300076Glom8Glomerulus QTL 879e-09kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6122549046137801795Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)667262953112262953Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
4889848Pur25Proteinuria QTL 25140.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)65672856290198260Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)689762877106752806Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)658632962103632962Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)673463459109394713Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)682523650110548006Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)67222764181132889Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)672202632117202632Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)672202632115200186Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)657730540104085867Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)761074194106074194Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)671201409116201409Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
1300076Glom8Glomerulus QTL 879e-09kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)753612714103945643Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)768938720113886318Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
4889848Pur25Proteinuria QTL 25140.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)65672856290198260Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)768938720113886318Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)72940968374409683Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)768938720113886318Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)762004452101773158Rat
738030Anxrr8Anxiety related response QTL 84.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)74659007091590070Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)73429328279293282Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
2300178Bmd54Bone mineral density QTL 545.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)74765143992651439Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
2293088Iddm28Insulin dependent diabetes mellitus QTL 285.21blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)66304056271636266Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
2312560Pur20Proteinuria QTL 202.10.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6125628133137801795Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)683190345106747639Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)762004452101773158Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)661747639106747639Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)657730540104085867Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
2293685Bmd21Bone mineral density QTL 214.20.0003femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)74765143992651439Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6122549046137801795Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)667262953112262953Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
2293644Bmd29Bone mineral density QTL 295.40.0001femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)74765143992651439Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73111283276112832Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
2293696Bmd32Bone mineral density QTL 325.10.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)74765143992651439Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)73429328279293282Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
2293707Bss32Bone structure and strength QTL 327.640.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)74765143992651439Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)74486753389867533Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
61444Strs2Sensitivity to stroke QTL 24.7cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)5135929696166875058Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)146875779683368335Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
70156Niddm30Non-insulin dependent diabetes mellitus QTL 303.98blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)5129132447151006154Rat
1358361Sradr5Stress Responsive Adrenal Weight QTL 55.55adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)743747012108555253Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
7794791Mcs33Mammary carcinoma susceptibility QTL 331.93mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)5131345754166875058Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
1331725Bp212Blood pressure QTL 2123.52475arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)693701310128713626Rat
1549838Bss4Bone structure and strength QTL 49.2femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)5106906205151906205Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
1331722Thshl1Thyroid stimulating hormone level QTL 111.70.0001blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)689762877106752806Rat
8657050Bw146Body weight QTL 14619.840.001body mass (VT:0001259)body weight gain (CMO:0000420)5108938288153938288Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
70176Mcsm1Mammary carcinoma susceptibility modifier QTL 1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)658632962103632962Rat
8694437Bw167Body weight QTL 16722.460.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)391797474136797474Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
724525Bp147Blood pressure QTL 1474.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5126424772166875058Rat
724524Uae2Urinary albumin excretion QTL 22.70.0005urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)673463459109394713Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)35378111291609953Rat
737827Hcar11Hepatocarcinoma resistance QTL 114.4liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)682523650110548006Rat
631841Niddm39Non-insulin dependent diabetes mellitus QTL 393.36blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)394856903159898684Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
7207488Bss110Bone structure and strength QTL 18.4femur strength trait (VT:0010010)femur stiffness (CMO:0001674)5106906205151906205Rat
8694441Bw169Body weight QTL 16917.610.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)5111416838156416838Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
7207491Bss112Bone structure and strength QTL 1127femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)5106906205151906205Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)67222764181132889Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
8694453Bw172Body weight QTL 1728.330.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)162432551369325513Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
724536Uae7Urinary albumin excretion QTL 73.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)672202632130729475Rat
70196BpQTLcluster7Blood pressure QTL cluster 76.82arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)672202632117202632Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
1331758Bp207Blood pressure QTL 2072.848arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)3112287552135181505Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
724532Cm17Cardiac mass QTL 172heart mass (VT:0007028)calculated heart weight (CMO:0000073)395735366140735366Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
1331797Bp213Blood pressure QTL 2133.291arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6104085867128713626Rat
1331799Bp211Blood pressure QTL 2113.66407arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)672202632130919985Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32793691972936919Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)33945463789115240Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2302057Pia29Pristane induced arthritis QTL 293.60.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)162173597566735975Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32846857173468571Rat
2298477Eau4Experimental allergic uveoretinitis QTL 40.0011uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)3137398739169034231Rat
1331803Rf32Renal function QTL 322.798kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)5129132428143070159Rat
7207486Bss109Bone structure and strength QTL 109femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)5106906205151906205Rat
7207481Bss106Bone structure and strength QTL 1067.9femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5106906205151906205Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)33945463789115240Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
1331789Rf37Renal function QTL 373.224kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)672202632115200186Rat
1558641Cm47Cardiac mass QTL 472.90.001heart mass (VT:0007028)heart wet weight (CMO:0000069)657730540104085867Rat
619618Rf3Renal disease susceptibility QTL 36.50.001urine albumin amount (VT:0002871)urine albumin excretion rate to body weight ratio (CMO:0001270)3107693393152693393Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
5686842Rf59Renal function QTL 59urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)3140069424146976080Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)147341532392554092Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
2293837Kiddil1Kidney dilation QTL 13.7kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
2293842Kiddil3Kidney dilation QTL 34.3kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)681132889104393926Rat
1298529Arunc1Aerobic running capacity QTL 14exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)163195152060148445Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1298528Bp169Blood pressure QTL 1690.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)761074194106074194Rat
1300075Glom7Glomerulus QTL 75.60.0000002kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)671201409116201409Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
1300076Glom8Glomerulus QTL 879e-09kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)686894788131894788Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
8552960Pigfal15Plasma insulin-like growth factor 1 level QTL 15blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5111416838156416838Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1578653Vnigr3Vascular neointimal growth QTL 33.1artery morphology trait (VT:0002191)artery neointimal hyperplastic lesion area (CMO:0001414)3130656562169034231Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
1300122Wbc1White blood cell count QTL 12.75leukocyte quantity (VT:0000217)total white blood cell count (CMO:0000365)5125392826139989768Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
1582216Bw65Body weight QTL 656.3body mass (VT:0001259)body weight (CMO:0000012)3102200529115665732Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582219Bw63Body weight QTL 633.80.001body mass (VT:0001259)body weight (CMO:0000012)396127817115665732Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532392554092Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32824968773249687Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
1300151Bp181Blood pressure QTL 1813.36arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)753612714103945643Rat
1300149Cm6Cardiac mass QTL 64.09heart mass (VT:0007028)heart left ventricle weight to body weight ratio (CMO:0000530)743747099102228765Rat
2303620Vencon4Ventilatory control QTL 43.9respiration trait (VT:0001943)tidal volume (CMO:0000222)3127162703168026850Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
1300159Kidm4Kidney mass QTL 43.83kidney mass (VT:0002707)right kidney wet weight to body weight ratio (CMO:0001953)3121056165157309487Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
2316947Rf58Renal function QTL 587.8kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)768938720113886318Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)147341532395876975Rat
4889848Pur25Proteinuria QTL 25140.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)65672856290198260Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
1298087Iddm18Insulin dependent diabetes mellitus QTL 180.0001urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)6116506292130245370Rat
1582252Sual1Serum uric acid level QTL 13.40.0123blood uric acid amount (VT:0010302)blood uric acid level (CMO:0000501)396127817102200699Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)147341532392554092Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
2316955Stl24Serum triglyceride level QTL 247.1blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)768938720113886318Rat
1578656Vnigr2Vascular neointimal growth QTL 24.2artery morphology trait (VT:0002191)lesioned artery residual lumen area (CMO:0001417)3130656562169034231Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)72940968374409683Rat
1298089Scl14Serum cholesterol level QTL 145.80.0004blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)5108845856153845856Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
2316952Pur22Proteinuria QTL 225.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)768938720113886318Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
10053720Scort26Serum corticosterone level QTL 262.060.0147blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)5124965598166875058Rat
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34382736490905114Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat
2317035Aia16Adjuvant induced arthritis QTL 162.71joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)759238038104238038Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
631505Bp103Blood pressure QTL 1033.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5132717196165560427Rat
631504Cm27Cardiac mass QTL 273.45heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)744421311118198041Rat
1300173Rf11Renal function QTL 113.38renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)3121056165145956249Rat
1559283Emca4Estrogen-induced mammary cancer QTL 43.7mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)762004452101773158Rat
738030Anxrr8Anxiety related response QTL 84.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)74659007091590070Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)73429328279293282Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)33851780383517803Rat
738018Anxrr4Anxiety related response QTL 45.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)5130130159166875058Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
8694389Bw160Body weight QTL 1606.170.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)5111416838156416838Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32824968773249687Rat
738034Anxrr5Anxiety related response QTL 55.9exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)684130881129130881Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
631541Bp81Blood pressure QTL 814arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3124122556169034231Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
631562Apr2Acute phase response QTL 23.7blood murinoglobulin 1 amount (VT:0010597)plasma murinoglobulin 1 level (CMO:0001931)5135927956166875058Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1578754Stresp16Stress response QTL 1640.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)3112681431157681431Rat
8694169Bw148Body weight QTL 14850.001body mass (VT:0001259)body weight gain (CMO:0000420)5128506074166875058Rat
10755461Coatc16Coat color QTL 16coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)3122438700167438700Rat
2317056Wbc3White blood cell count QTL 32.510.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)5105999803150999803Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32824968773249687Rat
2300178Bmd54Bone mineral density QTL 545.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)74765143992651439Rat
8694198Abfw3Abdominal fat weight QTL 316.130.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)5111416838156416838Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33142640370668733Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33142640370668733Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33142640370668733Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33142640370668733Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33142640370668733Rat
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
2293088Iddm28Insulin dependent diabetes mellitus QTL 285.21blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)66304056271636266Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33370334778196190Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32846857173468571Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
8552908Pigfal4Plasma insulin-like growth factor 1 level QTL 46.6blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)5128506074166875058Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
2312560Pur20Proteinuria QTL 202.10.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6125628133137801795Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33068464275684642Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)373376539118376539Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
10054138Gmadr3Adrenal mass QTL 33.680.00045adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)685140138130140138Rat
1598847Cm62Cardiac mass QTL 623.4heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5108845856153845856Rat
1354611Despr2Despair related QTL 23.030.0028locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)397084464142084464Rat
631649Bp123Blood pressure QTL 1233.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)389772419134772419Rat
1358204Insglur1Insulin/glucose ratio QTL 13.8blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)3115638168135181505Rat
1576306Schws3Schwannoma susceptibility QTL 30.001nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)3118839124163839124Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
631673Iddm13Insulin dependent diabetes mellitus QTL 131.30.663blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)3130193298161695983Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)341874578104104347Rat
10054123Srcrt6Stress Responsive Cort QTL 62.50.0043blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)685140138130140138Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32824968773249687Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1576302Schws4Schwannoma susceptibility QTL 40.0078nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)683190345106747639Rat
1576303Ept7Estrogen-induced pituitary tumorigenesis QTL 73.7pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)762004452101773158Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333703347104104347Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
8552952Pigfal13Plasma insulin-like growth factor 1 level QTL 13blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)3138799500169034231Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
1598819Bp292Blood pressure QTL 2924.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5127798274166875058Rat
12801471Schws9Schwannoma susceptibility QTL 9nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)661747639106747639Rat
6893332Cm74Cardiac mass QTL 740.40.64heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)657730540104085867Rat
2293087Iddm27Insulin dependent diabetes mellitus QTL 272.68blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)397551417147415807Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
2293667Bss42Bone structure and strength QTL 427.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)74765143992651439Rat
1598877Bp285Blood pressure QTL 2851.50.03arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)3120538241165538241Rat
2302373Gluco39Glucose level QTL 395.01blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)398535386161695835Rat
2293678Bss24Bone structure and strength QTL 246.710.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)74765143992651439Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1598861Cm64Cardiac mass QTL 642.9heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)5127798274166875058Rat
6903294Stl30Serum triglyceride level QTL 302.60.0013blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)162515279370152793Rat
2293685Bmd21Bone mineral density QTL 214.20.0003femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)74765143992651439Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6122549046137801795Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
2293642Bss37Bone structure and strength QTL 374.640.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)5120740824151018848Rat
1641904Alcrsp4Alcohol response QTL 4response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)667262953112262953Rat
631200Cm25Cardiac mass QTL 254.80.0001heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)36113434889115068Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33068464275684642Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
2293644Bmd29Bone mineral density QTL 295.40.0001femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)74765143992651439Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35318469289878207Rat
2312673Scl63Serum cholesterol level QTL 630.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)398535255168026850Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
634330Pia16Pristane induced arthritis QTL 163.9joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)645790088104200226Rat
1641920Colcs1Colorectal carcinoma susceptibility QTL 12.990.0055intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)5121846814166846814Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73111283276112832Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
1581510Cm54Cardiac mass QTL 543.40.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)5120740824143608494Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
9589106Insul23Insulin level QTL 2313.860.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)3131635904169034231Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
2293696Bmd32Bone mineral density QTL 325.10.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)74765143992651439Rat
1581563Uae33Urinary albumin excretion QTL 33urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)672227641130729205Rat
634349Bp139Blood pressure QTL 1390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)5128924607166875058Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)73429328279293282Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
2293707Bss32Bone structure and strength QTL 327.640.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)74765143992651439Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32824968773249687Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)33035677398535386Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
2312659Slep7Serum leptin concentration QTL 70.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)398535255168026850Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
61428Scl3Serum cholesterol level QTL 33.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)74486753389867533Rat
1581550Pur8Proteinuria QTL 8urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)672227641130729205Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33142640370668733Rat
2312670Bw94Body weight QTL 940.01inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)398535255168026850Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 366602 UniSTS
UniSTS 217029 UniSTS