RH133657 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: RH133657

Symbol:

RH133657

Previously known as:

AI502713;

RGD ID:

5049744

Expected Size:

183 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	2	182,788,905 - 182,789,088 (+)	MAPPER	mRatBN7.2
mRatBN7.2	10	71,405,085 - 71,405,261 (+)	MAPPER	mRatBN7.2
mRatBN7.2	10	71,405,078 - 71,405,261 (+)	MAPPER	mRatBN7.2
mRatBN7.2	2	182,788,912 - 182,789,088 (+)	MAPPER	mRatBN7.2
Rnor_6.0	2	196,386,053 - 196,386,235	NCBI	Rnor6.0
Rnor_6.0	10	73,902,032 - 73,902,214	NCBI	Rnor6.0
Rnor_5.0	10	76,197,168 - 76,197,350	UniSTS	Rnor5.0
Rnor_5.0	2	215,882,523 - 215,882,705	UniSTS	Rnor5.0
RGSC_v3.4	2	190,121,004 - 190,121,186	UniSTS	RGSC3.4
RGSC_v3.4	10	74,864,322 - 74,864,504	UniSTS	RGSC3.4
Celera	10	70,326,197 - 70,326,379	UniSTS
Celera	2	175,322,649 - 175,322,831	UniSTS

Is Marker For:

Genes: Mir21

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	CAGTTACGACTCTGACGACTACCC
Reverse Primer	GGATCTTTCATCTGACCATCCA

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1565234	Gabpb2	GA binding protein transcription factor subunit beta 2	2	182755304	182795368	Rat
70367	Vmp1	vacuole membrane protein 1	10	71405058	71505045	Rat
2325598	Mir21	microRNA 21	10	71405257	71405348	Rat

Nucleotide Sequences


GenBank Nucleotide	FT200114	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1578648	Bss11	Bone structure and strength QTL 11	4.7		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	2	114837527	211674221	Rat
1358356	Srcrt1	Stress Responsive Cort QTL1	3.66		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	2	161699179	222436696	Rat
1331734	Bp204	Blood pressure QTL 204	3.61192		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	168358098	223265385	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118463	226797303	Rat
1354649	Kidm17	Kidney mass QTL 17	2.9		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	2	81754530	227146641	Rat
10755499	Bp389	Blood pressure QTL 389	2.61		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	18960362	228801039	Rat
1298076	Bp166	Blood pressure QTL 166		0.0009	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	136445150	202447032	Rat
152025245	Scl81	Serum cholesterol level QTL 81	3.49		blood cholesterol amount (VT:0000180)		2	122609194	206936711	Rat
70162	Bp63	Blood pressure QTL 63	5.64		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	2	169745596	214745596	Rat
1554319	Bmd2	Bone mineral density QTL 2	13.4	0.0001	lumbar vertebra area (VT:0010570)	lumbar vertebra cross-sectional area (CMO:0001689)	2	114837675	212549332	Rat
12879836	Kidm61	Kidney mass QTL 61		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	152413072	185122374	Rat
1581569	Uae32	Urinary albumin excretion QTL 32		0.0001	urine protein amount (VT:0005160)	urine albumin excretion rate (CMO:0000757)	2	78665619	219826953	Rat
10043136	Iddm54	Insulin dependent diabetes mellitus QTL 54	3.4	0.0001	blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	143657411	190602963	Rat
12879837	Am2	Aortic mass QTL 2		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	2	152413072	185122374	Rat
12879838	Cm86	Cardiac mass QTL 86		0.002	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	152413072	185122374	Rat
1302793	Bw16	Body weight QTL 16	5	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	2	157142209	202446871	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	43154682	202446871	Rat
12879839	Cm85	Cardiac mass QTL 85		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	2	152413072	185122374	Rat
61469	Bp16	Blood pressure QTL 16	5.64		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	2	169745596	214745596	Rat
70175	BpQTLCluster3	Blood pressure QTL cluster 3	4.128		arterial blood pressure trait (VT:2000000)	absolute change in systolic blood pressure (CMO:0000607)	2	135552573	202446871	Rat
1549833	Bp257	Blood pressure QTL 257		0.003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	168354880	185122374	Rat
1358900	Bw48	Body weight QTL 48	4.88		body mass (VT:0001259)	body weight (CMO:0000012)	2	157142078	211086598	Rat
1359030	Bp277	Blood pressure QTL 277			arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	114837527	185876470	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	56043031	202447032	Rat
12879840	Bw179	Body weight QTL 179		0.005	body mass (VT:0001259)	body weight (CMO:0000012)	2	152413072	185122374	Rat
1581502	Esta3	Estrogen-induced thymic atrophy QTL 3			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	2	136916935	189599348	Rat
9589044	Scfw1	Subcutaneous fat weight QTL 1	5.8	0.001	subcutaneous adipose mass (VT:1000472)	abdominal subcutaneous fat pad weight (CMO:0002069)	2	182171407	227171407	Rat
8694435	Bw166	Body weight QTL 166	14.08	0.001	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	2	182171407	227171407	Rat
1359032	Hrtrt18	Heart rate QTL 18			heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	2	157142078	192625452	Rat
2301966	Bp322	Blood pressure QTL 322	3.58		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	150540301	202447032	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118275	202447032	Rat
8662832	Vetf7	Vascular elastic tissue fragility QTL 7	3.5		aorta elastin amount (VT:0003905)	aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)	2	81689826	221035911	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
8694194	Abfw1	Abdominal fat weight QTL 1	11.7	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	2	182171407	227171407	Rat
1359022	Ppulsi1	Prepulse inhibition QTL 1	3.63		prepulse inhibition trait (VT:0003088)	acoustic startle response measurement (CMO:0001519)	2	136916935	213594495	Rat
1641891	Alcrsp17	Alcohol response QTL 17			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	149559561	249053267	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	78665619	249053267	Rat
61374	Edpm2	Estrogen-dependent pituitary mass QTL 2	4.42	0.86	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	76539322	202447032	Rat
2300189	Bmd48	Bone mineral density QTL 48	5.8	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	2	179335906	224335906	Rat
8662843	Vetf9	Vascular elastic tissue fragility QTL 9	2.05		thoracic aorta molecular composition trait (VT:0010568)	aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)	2	157142078	226277316	Rat
631501	Bp101	Blood pressure QTL 101	2.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	150341684	202446871	Rat
2307174	Activ3	Activity QTL 3	4.83	0.000058	locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	2	168594495	213594495	Rat
1331794	Bp202	Blood pressure QTL 202	3.66819		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	141194931	223265385	Rat
71113	Cari2	Carrageenan-induced inflammation QTL 2	2.7	0.009	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	2	141596551	202447032	Rat
1331805	Cm29	Cardiac mass QTL 29	3.50746		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	2	141194931	223265385	Rat
634308	Sach6	Saccharin preference QTL 6	4.9		taste sensitivity trait (VT:0001986)	saccharin intake volume to total fluid intake volume ratio (CMO:0001601)	2	112456140	212696837	Rat
1598805	Memor8	Memory QTL 8	3		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	2	150341585	189039377	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
724568	Uae13	Urinary albumin excretion QTL 13	4.4		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	2	143157029	210020885	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1300165	Rf9	Renal function QTL 9	3.28		kidney glomerulus integrity trait (VT:0010546)	index of glomerular damage (CMO:0001135)	2	133914684	202447032	Rat
61401	Niddm2	Non-insulin dependent diabetes mellitus QTL 2	4.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	144599348	189599348	Rat
631507	Bp105	Blood pressure QTL 105		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	112456140	212696837	Rat
1641925	Alcrsp2	Alcohol response QTL 2			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	149559561	221167075	Rat
1354609	Niddm62	Non-insulin dependent diabetes mellitus QTL 62	4.72	0.000006	insulin secretion trait (VT:0003564)	plasma insulin level (CMO:0000342)	2	150540301	202447032	Rat
1598833	Bp295	Blood pressure QTL 295	3.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	147798556	192798556	Rat
61417	Cia10	Collagen induced arthritis QTL 10	3.4		joint integrity trait (VT:0010548)	experimental arthritis severity measurement (CMO:0001459)	2	179946951	224946951	Rat
1354622	Kidm16	Kidney mass QTL 16	3		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	2	81754530	222436696	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	46123260	202447032	Rat
631522	Bp74	Blood pressure QTL 74		0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	172710921	184114403	Rat
8694383	Bw158	Body weight QTL 158	7.69	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	2	182171407	227171407	Rat
7488927	Bp365	Blood pressure QTL 365		0.008	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	162765032	207765032	Rat
1598838	Bp290	Blood pressure QTL 290	1.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	166539266	211539266	Rat
7488925	Bp364	Blood pressure QTL 364		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	160564068	205564068	Rat
2306901	Bp337	Blood pressure QTL 337		0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	164073756	227146641	Rat
1354605	Rf48	Renal function QTL 48	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	2	74786664	206665859	Rat
6903312	Bw112	Body weight QTL 112	3.2	0.0013	body mass (VT:0001259)	body weight (CMO:0000012)	2	143657569	184114274	Rat
1354601	Slep1	Serum leptin concentration QTL 1	5.39		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	2	43171017	184114403	Rat
2293084	Iddm26	Insulin dependent diabetes mellitus QTL 26	2.9		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	174930955	213594495	Rat
1358356	Srcrt1	Stress Responsive Cort QTL1	3.66		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	2	161699179	222436696	Rat
1549846	Scl47	Serum cholesterol level QTL 47	3.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	50574707	95574707	Rat
1331734	Bp204	Blood pressure QTL 204	3.61192		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	168358098	223265385	Rat
1578779	Tcas10	Tongue tumor susceptibility QTL 10	3.12		tongue integrity trait (VT:0010553)	number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)	10	31297439	76297439	Rat
631565	Hcuc4	Hepatic copper content QTL 4	4.15		liver copper amount (VT:0003065)	liver copper weight to liver dry weight ratio (CMO:0001512)	10	66941813	73452992	Rat
61449	Ciaa2	CIA Autoantibody QTL 2	7.1		blood autoantibody amount (VT:0003725)	calculated serum anti-type 2 collagen antibody titer (CMO:0001279)	10	63221094	107211142	Rat
631552	Vetf2	Vascular elastic tissue fragility QTL 2	4.5	0.0002	aorta elastic tissue integrity trait (VT:0010556)	artery internal elastic lamina non-tumorous lesion count (CMO:0001913)	10	41142633	86142633	Rat
631557	Bp136	Blood pressure QTL 136		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	30632053	75632053	Rat
10755499	Bp389	Blood pressure QTL 389	2.61		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	18960362	228801039	Rat
1549831	Bss6	Bone structure and strength QTL 6	4		lumbar vertebra strength trait (VT:0010574)	vertebra ultimate force (CMO:0001678)	10	57576521	102576521	Rat
70162	Bp63	Blood pressure QTL 63	5.64		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	2	169745596	214745596	Rat
12902615	Bw185	Body weight QTL 185		0.01	body mass (VT:0001259)	body weight (CMO:0000012)	10	71115217	72606468	Rat
70164	Bw21	Body weight QTL 21	4.36	0.00005	body mass (VT:0001259)	body weight (CMO:0000012)	10	53797494	98952626	Rat
61463	Bp12	Blood pressure QTL 12	6.3	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	41333258	86333258	Rat
12879836	Kidm61	Kidney mass QTL 61		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	2	152413072	185122374	Rat
1581569	Uae32	Urinary albumin excretion QTL 32		0.0001	urine protein amount (VT:0005160)	urine albumin excretion rate (CMO:0000757)	2	78665619	219826953	Rat
12879837	Am2	Aortic mass QTL 2		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	2	152413072	185122374	Rat
2300218	Hpcl2	Hepatic cholesterol level QTL 2			liver cholesterol amount (VT:0010498)	liver cholesterol level (CMO:0001597)	10	45029650	95600334	Rat
8694173	Bw149	Body weight QTL 149	4.38	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	10	44441699	89441699	Rat
12879838	Cm86	Cardiac mass QTL 86		0.002	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	2	152413072	185122374	Rat
1302793	Bw16	Body weight QTL 16	5	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	2	157142209	202446871	Rat
70171	Cari1	Carrageenan-induced inflammation QTL 1	4.9	0.0005	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	10	53797385	107211142	Rat
61467	Bp14	Blood pressure QTL 14	2.2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	43154682	202446871	Rat
12879839	Cm85	Cardiac mass QTL 85		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	2	152413072	185122374	Rat
61469	Bp16	Blood pressure QTL 16	5.64		arterial blood pressure trait (VT:2000000)	blood pressure measurement (CMO:0000003)	2	169745596	214745596	Rat
70175	BpQTLCluster3	Blood pressure QTL cluster 3	4.128		arterial blood pressure trait (VT:2000000)	absolute change in systolic blood pressure (CMO:0000607)	2	135552573	202446871	Rat
1549833	Bp257	Blood pressure QTL 257		0.003	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	168354880	185122374	Rat
1358900	Bw48	Body weight QTL 48	4.88		body mass (VT:0001259)	body weight (CMO:0000012)	2	157142078	211086598	Rat
1331760	Bp206	Blood pressure QTL 206	3.62454		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	56043031	202447032	Rat
12879840	Bw179	Body weight QTL 179		0.005	body mass (VT:0001259)	body weight (CMO:0000012)	2	152413072	185122374	Rat
724527	Bp148	Blood pressure QTL 148		0.0001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	28453136	73453136	Rat
8694435	Bw166	Body weight QTL 166	14.08	0.001	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight to body weight ratio (CMO:0000635)	2	182171407	227171407	Rat
2300171	Bmd58	Bone mineral density QTL 58	4.9	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	26944628	71944628	Rat
2301967	Cm73	Cardiac mass QTL 73	4.55		heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	14487011	89062041	Rat
2301966	Bp322	Blood pressure QTL 322	3.58		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	150540301	202447032	Rat
70188	BpQTLcluster1	Blood pressure QTL cluster 1	4.864		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	42323132	87323132	Rat
2300172	Bmd57	Bone mineral density QTL 57	9.8	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	10	69738412	107211142	Rat
1357344	Bp249	Blood pressure QTL 249		0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	66743655	98003205	Rat
8694194	Abfw1	Abdominal fat weight QTL 1	11.7	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	2	182171407	227171407	Rat
70198	BpQTLcluster9	Blood pressure QTL cluster 9	2.94		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	42323132	87323132	Rat
724534	Uae6	Urinary albumin excretion QTL 6	10		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	2	78665619	249053267	Rat
2300189	Bmd48	Bone mineral density QTL 48	5.8	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	2	179335906	224335906	Rat
2307174	Activ3	Activity QTL 3	4.83	0.000058	locomotor behavior trait (VT:0001392)	number of entries into a discrete space in an experimental apparatus (CMO:0000960)	2	168594495	213594495	Rat
1331794	Bp202	Blood pressure QTL 202	3.66819		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	141194931	223265385	Rat
724556	Pur2	Proteinuria QTL 2	5.5		urine protein amount (VT:0005160)	urine protein level (CMO:0000591)	10	22427500	90627625	Rat
1331805	Cm29	Cardiac mass QTL 29	3.50746		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	2	141194931	223265385	Rat
1598805	Memor8	Memory QTL 8	3		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	2	150341585	189039377	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat
1358917	Cm42	Cardiac mass QTL 42	2.82		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
2298481	Eau9	Experimental allergic uveoretinitis QTL 9		0.0169	uvea integrity trait (VT:0010551)	experimental autoimmune uveitis score (CMO:0001504)	10	65927233	82565079	Rat
724568	Uae13	Urinary albumin excretion QTL 13	4.4		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	2	143157029	210020885	Rat
1358913	Cm41	Cardiac mass QTL 41	2.73		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	2	25413423	203928301	Rat
1331791	Cm31	Cardiac mass QTL 31	3.84606		heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	29299504	107211142	Rat
6893366	Bw106	Body weight QTL 106	0.3	0.47	body mass (VT:0001259)	body weight (CMO:0000012)	10	70199100	107211142	Rat
2289985	Bp305	Blood pressure QTL 305			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	67502108	73579767	Rat
1354608	Cm33	Cardiac mass QTL 33	2.8		heart left ventricle mass (VT:0007031)	heart left ventricle wet weight (CMO:0000071)	10	54809292	99809292	Rat
1558643	Cm44	Cardiac mass QTL 44	4.8	0.0000368	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	10	61345276	99703528	Rat
1354609	Niddm62	Non-insulin dependent diabetes mellitus QTL 62	4.72	0.000006	insulin secretion trait (VT:0003564)	plasma insulin level (CMO:0000342)	2	150540301	202447032	Rat
1576319	Cia29	Collagen induced arthritis QTL 29			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	33973921	78973921	Rat
1598833	Bp295	Blood pressure QTL 295	3.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	147798556	192798556	Rat
1354622	Kidm16	Kidney mass QTL 16	3		kidney mass (VT:0002707)	left kidney wet weight (CMO:0000083)	2	81754530	222436696	Rat
1576308	Schws1	Schwannoma susceptibility QTL 1		0.0041	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	40035094	102359817	Rat
1598838	Bp290	Blood pressure QTL 290	1.9		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	166539266	211539266	Rat
1576311	Pia26	Pristane induced arthritis QTL 26			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	31224026	75632053	Rat
6893336	Cm75	Cardiac mass QTL 75	0.1	0.87	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	61345276	99703528	Rat
2306901	Bp337	Blood pressure QTL 337		0.01	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	164073756	227146641	Rat
6893342	Cm78	Cardiac mass QTL 78	0.1	0.88	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	10	42876766	79813922	Rat
1354605	Rf48	Renal function QTL 48	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	2	74786664	206665859	Rat
6903312	Bw112	Body weight QTL 112	3.2	0.0013	body mass (VT:0001259)	body weight (CMO:0000012)	2	143657569	184114274	Rat
1354601	Slep1	Serum leptin concentration QTL 1	5.39		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	2	43171017	184114403	Rat
2293084	Iddm26	Insulin dependent diabetes mellitus QTL 26	2.9		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	174930955	213594495	Rat
1578648	Bss11	Bone structure and strength QTL 11	4.7		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	2	114837527	211674221	Rat
1298069	Bp168	Blood pressure QTL 168	5.5		blood pressure trait (VT:0000183)	systolic blood pressure (CMO:0000004)	10	26521957	98003205	Rat
2293669	Bmd33	Bone mineral density QTL 33	4.5	0.0001	femur strength trait (VT:0010010)	femoral neck polar moment of inertia (CMO:0001670)	10	49444551	81709989	Rat
152025224	Bw193	Body weight QTL 193	6.47		body mass (VT:0001259)		10	51663405	75085664	Rat
1298074	Bp164	Blood pressure QTL 164		0.003	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
12903245	Cm110	Cardiac mass QTL 110		0.001	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	10	71115217	72606468	Rat
12903246	Cm111	Cardiac mass QTL 111		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	10	71115217	72606468	Rat
12903247	Cm112	Cardiac mass QTL 112		0.001	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	10	71115217	72606468	Rat
1354648	Bp239	Blood pressure QTL 239		0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118463	226797303	Rat
1354649	Kidm17	Kidney mass QTL 17	2.9		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	2	81754530	227146641	Rat
61325	Aia5	Adjuvant induced arthritis QTL 5		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
1298078	Stresp5	Stress response QTL 5	2.99	0.00025	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	10	42045676	104670812	Rat
2293679	Bmd30	Bone mineral density QTL 30	3.5	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
1298076	Bp166	Blood pressure QTL 166		0.0009	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	136445150	202447032	Rat
152025245	Scl81	Serum cholesterol level QTL 81	3.49		blood cholesterol amount (VT:0000180)		2	122609194	206936711	Rat
12903248	Am14	Aortic mass QTL 14		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	10	71115217	72606468	Rat
12903249	Kidm68	Kidney mass QTL 68		0.02	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	10	71115217	72606468	Rat
1579918	Bp279	Blood pressure QTL 279		0.01	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	71115217	72606468	Rat
1554319	Bmd2	Bone mineral density QTL 2	13.4	0.0001	lumbar vertebra area (VT:0010570)	lumbar vertebra cross-sectional area (CMO:0001689)	2	114837675	212549332	Rat
10043136	Iddm54	Insulin dependent diabetes mellitus QTL 54	3.4	0.0001	blood glucose amount (VT:0000188)	age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)	2	143657411	190602963	Rat
1554317	Bmd4	Bone mineral density QTL 4	9.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	10	19816042	99406971	Rat
1359030	Bp277	Blood pressure QTL 277			arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	2	114837527	185876470	Rat
1581502	Esta3	Estrogen-induced thymic atrophy QTL 3			thymus mass (VT:0004954)	thymus wet weight (CMO:0000855)	2	136916935	189599348	Rat
9589044	Scfw1	Subcutaneous fat weight QTL 1	5.8	0.001	subcutaneous adipose mass (VT:1000472)	abdominal subcutaneous fat pad weight (CMO:0002069)	2	182171407	227171407	Rat
61354	Pia10	Pristane induced arthritis QTL 10		0.01	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
1359032	Hrtrt18	Heart rate QTL 18			heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	2	157142078	192625452	Rat
2293646	Bss25	Bone structure and strength QTL 25	10.96	0.0001	femur morphology trait (VT:0000559)	femur cross-sectional area (CMO:0001661)	10	69738412	107211142	Rat
2313103	Bss80	Bone structure and strength QTL 80	2	0.0001	tibia strength trait (VT:1000284)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	10	62057807	107057807	Rat
2303118	Mamtr7	Mammary tumor resistance QTL 7		0.003	mammary gland integrity trait (VT:0010552)	mammary tumor growth rate (CMO:0000344)	10	9658275	104670812	Rat
2313105	Bss79	Bone structure and strength QTL 79	1.8	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	10	62057807	107057807	Rat
1298080	Bp163	Blood pressure QTL 163		0.02	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	66118275	202447032	Rat
8662832	Vetf7	Vascular elastic tissue fragility QTL 7	3.5		aorta elastin amount (VT:0003905)	aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)	2	81689826	221035911	Rat
9589030	Epfw9	Epididymal fat weight QTL 9	19.24	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	10	44441699	89441699	Rat
10402859	Bp381	Blood pressure QTL 381		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
1298085	Bp165	Blood pressure QTL 165		0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	42804607	202447032	Rat
2293652	Bmd22	Bone mineral density QTL 22	4.9	0.0001	femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	10	49444551	81709989	Rat
2316949	Gluco60	Glucose level QTL 60	3.7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	14487011	107057807	Rat
2306970	Anxrr22	Anxiety related response QTL 22	5.95		fear/anxiety-related behavior trait (VT:1000241)	number of periods of voluntary immobility (CMO:0001045)	10	61345276	98211570	Rat
1359022	Ppulsi1	Prepulse inhibition QTL 1	3.63		prepulse inhibition trait (VT:0003088)	acoustic startle response measurement (CMO:0001519)	2	136916935	213594495	Rat
1641891	Alcrsp17	Alcohol response QTL 17			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	149559561	249053267	Rat
2293663	Bss33	Bone structure and strength QTL 33	9.34	0.0001	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	10	69738412	107211142	Rat
1359017	Hrtrt21	Heart rate QTL 21	2.4		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	10	51772940	96772940	Rat
61374	Edpm2	Estrogen-dependent pituitary mass QTL 2	4.42	0.86	pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	2	76539322	202447032	Rat
8662843	Vetf9	Vascular elastic tissue fragility QTL 9	2.05		thoracic aorta molecular composition trait (VT:0010568)	aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)	2	157142078	226277316	Rat
7387312	Bw125	Body weight QTL 125	3	0.0047	retroperitoneal fat pad mass (VT:0010430)	retroperitoneal fat pad weight (CMO:0000356)	10	64890616	107211142	Rat
2312672	Insul15	Insulin level QTL 15		0.01	blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	10	57134272	102134272	Rat
631501	Bp101	Blood pressure QTL 101	2.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	150341684	202446871	Rat
2317029	Aia19	Adjuvant induced arthritis QTL 19	2.98		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	66978955	107211142	Rat
71113	Cari2	Carrageenan-induced inflammation QTL 2	2.7	0.009	hypodermis integrity trait (VT:0010550)	inflammatory exudate volume (CMO:0001429)	2	141596551	202447032	Rat
8662860	Vetf10	Vascular elastic tissue fragility QTL 10			artery integrity trait (VT:0010639)	number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)	10	6154182	73453136	Rat
61387	Bp1	Blood pressure QTL 1	5.1		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	10	51770177	107211142	Rat
2317039	Aia6	Adjuvant induced arthritis QTL 6	4.31		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	66978955	107211142	Rat
634308	Sach6	Saccharin preference QTL 6	4.9		taste sensitivity trait (VT:0001986)	saccharin intake volume to total fluid intake volume ratio (CMO:0001601)	2	112456140	212696837	Rat
2317043	Aia7	Adjuvant induced arthritis QTL 7	3.82		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	10	37565079	82565079	Rat
2317042	Aia20	Adjuvant induced arthritis QTL 20	3.38		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	10	37565079	82565079	Rat
61396	Bp9	Blood pressure QTL 9	4.8	0.0001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	68420376	107211142	Rat
1300165	Rf9	Renal function QTL 9	3.28		kidney glomerulus integrity trait (VT:0010546)	index of glomerular damage (CMO:0001135)	2	133914684	202447032	Rat
61401	Niddm2	Non-insulin dependent diabetes mellitus QTL 2	4.54		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	2	144599348	189599348	Rat
631507	Bp105	Blood pressure QTL 105		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	112456140	212696837	Rat
70363	Bp71	Blood pressure QTL 71		0.04	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	61345276	81714865	Rat
61402	Niddm3	Non-insulin dependent diabetes mellitus QTL 3	4.58		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	10	61345413	82564856	Rat
10450500	Bp385	Blood pressure QTL 385		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	71115217	71966743	Rat
1641925	Alcrsp2	Alcohol response QTL 2			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	2	149559561	221167075	Rat
70364	Bp72	Blood pressure QTL 72			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	51121100	96121100	Rat
10450498	Bp384	Blood pressure QTL 384		0.002	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	67750049	107211142	Rat
2293698	Bss43	Bone structure and strength QTL 43	5.33	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	10	59209888	104209888	Rat
631530	Tls3	T-lymphoma susceptibility QTL 3	0	0.0001	thymus integrity trait (VT:0010555)	percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)	10	51774612	95600334	Rat
631535	Cm51	Cardiac mass QTL 51	3		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	10	51786282	91669536	Rat
8552805	Bw145	Body weight QTL 145	2.2		body mass (VT:0001259)	change in body weight to body weight ratio (CMO:0002216)	10	41944526	78307017	Rat
61417	Cia10	Collagen induced arthritis QTL 10	3.4		joint integrity trait (VT:0010548)	experimental arthritis severity measurement (CMO:0001459)	2	179946951	224946951	Rat
631267	Cia20	Collagen induced arthritis QTL 20	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	23444813	104060283	Rat
631266	Bp132	Blood pressure QTL 132		0.0005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	46123260	202447032	Rat
631522	Bp74	Blood pressure QTL 74		0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	2	172710921	184114403	Rat
8694383	Bw158	Body weight QTL 158	7.69	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	2	182171407	227171407	Rat
2293705	Bmd25	Bone mineral density QTL 25	7.1	0.0001	femur mineral mass (VT:0010011)	compact volumetric bone mineral density (CMO:0001730)	10	49444551	81709989	Rat
631269	Cia22	Collagen induced arthritis QTL 22	8.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
7488927	Bp365	Blood pressure QTL 365		0.008	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	162765032	207765032	Rat
631268	Cia21	Collagen induced arthritis QTL 21	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	14487011	104060283	Rat
7207811	Bmd90	Bone mineral density QTL 90	5.2		femur size trait (VT:1000369)	femoral neck cross-sectional area (CMO:0001697)	10	49444551	81709989	Rat
7488925	Bp364	Blood pressure QTL 364		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	2	160564068	205564068	Rat
631270	Cia23	Collagen induced arthritis QTL 23	3.9		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	40035094	104060283	Rat
7411614	Foco18	Food consumption QTL 18		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	44441699	89441699	Rat
631547	Bp87	Blood pressure QTL 87	4.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	47369470	92369470	Rat
61427	Cia16	Collagen induced arthritis QTL 16	3.2		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	6357896	96121100	Rat
2312662	Slep8	Serum leptin concentration QTL 8		0.05	blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	10	57134272	102134272	Rat
2292439	Bp309	Blood pressure QTL 309			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	71115217	71966743	Rat
2292441	Bp308	Blood pressure QTL 308			arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	10	27606468	72606468	Rat
1642980	Bp300	Blood pressure QTL 300			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	68383129	107211142	Rat
2312668	Scl65	Serum cholesterol level QTL 65		0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	10	57134272	102134272	Rat
631542	Bp82	Blood pressure QTL 82	6.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	26521957	98952741	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	100314000	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: RH133657