RH133224 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH133224

Symbol: RH133224
Previously known as: AI136945; 
RGD ID: 5048992
Expected Size: 405 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81777,245,785 - 77,246,190 (+)Marker Load Pipeline
mRatBN7.21772,336,426 - 72,336,832 (+)MAPPERmRatBN7.2
Rnor_6.01776,287,818 - 76,288,222NCBIRnor6.0
Rnor_5.01777,925,812 - 77,926,216UniSTSRnor5.0
RGSC_v3.41783,377,757 - 83,378,161UniSTSRGSC3.4
Celera1771,791,657 - 71,792,061UniSTS
RH 3.4 Map17717.6UniSTS
Cytogenetic Map17q12.3UniSTS
Is Marker For: Genes:   Upf2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATTTCAACACGAATCGGAGGT
Reverse Primer GTTCGAGGAGGCAAAGTCTGAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308092Dhtkd1dehydrogenase E1 and transketolase domain containing 1177724251277316074Rat

Nucleotide Sequences
GenBank Nucleotide JH619090.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)173310464578104645Rat
12904736Cm121Cardiac mass QTL 1210.043heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)174238816487388164Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)174238816487388164Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)174605012691050126Rat
631502Cm26Cardiac mass QTL 263.71heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)177061350286062352Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175819406487388164Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)173310464578104645Rat
1354654Spl7Serum phospholipid level QTL 75.5blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)173803135483031354Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175560459793006569Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)175482950393515804Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)174265489587654895Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)173768787782687877Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174096801789341781Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172723344583975845Rat
1300131Bp193Blood pressure QTL 1933.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)176855004093515804Rat
1354629Scl31Serum cholesterol level QTL 314.1blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)173803135483031354Rat
7488963Bp369Blood pressure QTL 3690.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)176369714782818564Rat
1300129Rf25Renal function QTL 253.03blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)174106235286062352Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173219953486201342Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)173803135483031354Rat
61466Niddm12Non-insulin dependent diabetes mellitus QTL 123.20.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)176515487293515804Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173604553781045537Rat
2302365Gluco40Glucose level QTL 404.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)176456982086954580Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173803135483031354Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 361271 UniSTS