RH130577 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Marker: RH130577

Symbol: RH130577
Previously known as: AI030584; 
RGD ID: 5044394
Expected Size: 214 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81526,488,558 - 26,488,772 (+)Marker Load Pipeline
mRatBN7.21524,015,001 - 24,015,215 (+)MAPPERmRatBN7.2
Rnor_6.01527,720,317 - 27,720,530NCBIRnor6.0
Rnor_5.01531,552,742 - 31,552,955UniSTSRnor5.0
RGSC_v3.41526,771,195 - 26,771,408UniSTSRGSC3.4
Celera1524,334,494 - 24,334,707UniSTS
Cytogenetic Map15p14UniSTS
Is Marker For: Genes:   Ccnb1ip1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGCATCAAATTGCACTTCCAG
Reverse Primer TTGTATTTACATGGCGCTTTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1561930Ccnb1ip1cyclin B1 interacting protein 1152648846226504167Rat

Nucleotide Sequences
RefSeq Transcripts NM_001025141 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC091423 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)15231575947315759Rat
5684946Bss98Bone structure and strength QTL 983.90.0026tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)15139411584Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15144836456Rat
738017Hcas7Hepatocarcinoma susceptibility QTL 72.91liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)15231575953331089Rat
10755503Bp391Blood pressure QTL 3912.37arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)152272835342072050Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1525285835104695021Rat
2324620Coatc3Coat color QTL 3coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)152233635152597086Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)1525285835104695021Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151915576287086765Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)15278592347785923Rat
1354657Despr13Despair related QTL 130.0022locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)15132342855Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151492659471614418Rat
631550Bw7Body weight QTL 73.6body mass (VT:0001259)body weight (CMO:0000012)152233635167336351Rat
5685002Bss103Bone structure and strength QTL 1032.8tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)151691152132439851Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)1525285835104695021Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 498492 UniSTS