RH129529 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH129529

Symbol: RH129529
Previously known as: AA964618; 
RGD ID: 5042594
Expected Size: 197 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21826,860,469 - 26,860,666 (+)MAPPERmRatBN7.2
mRatBN7.2468,142,479 - 68,142,676 (+)MAPPERmRatBN7.2
Rnor_6.01828,055,526 - 28,055,722NCBIRnor6.0
Rnor_6.0467,151,734 - 67,151,930NCBIRnor6.0
Rnor_5.0466,958,195 - 66,958,391UniSTSRnor5.0
Rnor_5.01827,765,629 - 27,765,825UniSTSRnor5.0
RGSC_v3.41827,768,920 - 27,769,116UniSTSRGSC3.4
RGSC_v3.4466,874,768 - 66,874,964UniSTSRGSC3.4
Celera1826,595,712 - 26,595,908UniSTS
Cytogenetic Map4q22UniSTS
Cytogenetic Map18p11UniSTS
Is Marker For: Genes:   Slc37a3   Ctnna1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGGAAGCATGTTCTGATTACAG
Reverse Primer AACTGTGTGAGAAAGAAGGTCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359485Ctnna1catenin alpha 1182672824626860911Rat
1310346Slc37a3solute carrier family 37, member 346810931468153590Rat

Nucleotide Sequences
RefSeq Transcripts NM_001007145 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC085789 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
1331735Rf44Renal function QTL 442.981urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181823456431359530Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182654808246969551Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182654808246969551Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
12904669Cm125Cardiac mass QTL 1250.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)182654808246969551Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182206624252293055Rat
12904670Cm126Cardiac mass QTL 1260.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)182654808246969551Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
12904677Kidm72Kidney mass QTL 720.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)182654808246969551Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
12904673Cm127Cardiac mass QTL 1270.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)182654808246969551Rat
12904675Am19Aortic mass QTL 190.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)182654808246969551Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
1331775Bp235Blood pressure QTL 2353.201arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181823456431359530Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
1331735Rf44Renal function QTL 442.981urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181823456431359530Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658103194791Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)457486946102486946Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182654808246969551Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711470578881294Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658115089733Rat
12904669Cm125Cardiac mass QTL 1250.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)182654808246969551Rat
12904670Cm126Cardiac mass QTL 1260.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)182654808246969551Rat
12904677Kidm72Kidney mass QTL 720.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)182654808246969551Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
12904673Cm127Cardiac mass QTL 1270.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)182654808246969551Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
12904675Am19Aortic mass QTL 190.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)182654808246969551Rat
2317577Eae24Experimental allergic encephalomyelitis QTL 24nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)46699318572752834Rat
1331775Bp235Blood pressure QTL 2353.201arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181823456431359530Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2300179Bmd50Bone mineral density QTL 505.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)460928534105928534Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)462933508114921294Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
1578657Bss12Bone structure and strength QTL 128.9femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)460220938105220938Rat
1578658Bss13Bone structure and strength QTL 138femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)460220938105220938Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)45664777678882945Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)45664777678882945Rat
6478684Anxrr30Anxiety related response QTL 300.00087defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)45664777678882945Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182654808246969551Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)45664777678882945Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)45711443281266970Rat
2306547Iddm38Insulin dependent diabetes mellitus QTL 38blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)46738666970362197Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
6478772Anxrr49Anxiety related response QTL 490.15488defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182206624252293055Rat
2312569Pur19Proteinuria QTL 193.40.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)46588210796130297Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)46293350882490359Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
631651Bp124Blood pressure QTL 1243arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)462879517107879517Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45843213392991462Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711443291360801Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
6478743Anxrr40Anxiety related response QTL 400.83076defecation behavior trait (VT:0010462)defecation rate (CMO:0000998)462753847107753847Rat
7394826Bw126Body weight QTL 1260.002body mass (VT:0001259)body weight gain (CMO:0000420)46293326987483707Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45863587778886137Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 307505 UniSTS
  312255 UniSTS
UniSTS 212831 UniSTS