RH128340 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH128340

Symbol: RH128340
Previously known as: AA899397; 
RGD ID: 5040536
Expected Size: 197 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2166,494,214 - 66,494,411 (+)MAPPERmRatBN7.2
mRatBN7.21174,245,808 - 174,246,005 (+)MAPPERmRatBN7.2
Rnor_6.0169,526,628 - 69,526,826NCBIRnor6.0
Rnor_6.01189,626,589 - 189,626,785NCBIRnor6.0
Rnor_5.0170,924,813 - 70,925,011UniSTSRnor5.0
Rnor_5.01196,560,952 - 196,561,148UniSTSRnor5.0
RGSC_v3.41178,171,062 - 178,171,258UniSTSRGSC3.4
RGSC_v3.4164,889,053 - 64,889,249UniSTSRGSC3.4
Celera164,251,527 - 64,251,723UniSTS
Celera1171,995,244 - 171,995,440UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGAACAGGCAGGAGATAGTCA
Reverse Primer TTAAGAAGATGCCAGGGAGCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2324101Dcun1d3-ps1defective in cullin neddylation 1 domain containing 3, pseudogene 116649543566497050Rat
1565786Vom2r28vomeronasal 2 receptor, 2816652757166556896Rat
9081781LOC103691055proteasome activator complex subunit 3 pseudogene16653349566534237Rat
1311663Zfp418zinc finger protein 41816658140666594247Rat
1626018Vom2r-ps46vomeronasal 2 receptor, pseudogene 4616660995266610070Rat
1587451LOC691135similar to zinc finger protein 41816663811266649875Rat
9412479Znf416l-ps1zinc finger protein 416 like, pseudogene 116665663466658453Rat
2316430Vom1r-ps42vomeronasal 1 receptor pseudogene 4216667521266676158Rat
1308782Zfp772zinc finger protein 77216670262866709395Rat
11386709LOC108349540uncharacterized LOC10834954016674244966775540Rat
2291792Hiat1-ps1hippocampus abundant gene transcript 1, pseudogene 116675619366758919Rat
1305281Hiatl3hippocampus abundant transcript-like 316675619366758919Rat
2291792Hiat1-ps1hippocampus abundant gene transcript 1, pseudogene 116675619366758919Rat
1563793Zfp773-ps1zinc finger protein 773, pseudogene 116676407366769897Rat
1561308Zfp954zinc finger protein 95416677627966782224Rat
7581812LOC102547517uncharacterized LOC10254751716678158566789811Rat
7559893Znf773zinc finger protein 77316678993066802405Rat
9306139Znf805l-ps1zinc finger protein 805 like, pseudogene 116682832566843533Rat
1309573Aurkcaurora kinase C16684365366864348Rat
9467041LOC103690204uncharacterized LOC10369020416686430766883924Rat
6499280Zim3zinc finger imprinted 316686944166870364Rat
1306648Usp29ubiquitin specific peptidase 2916687421667097731Rat
7489040Mir3099microRNA 309916702398967024117Rat
41105862LOC120100463small nucleolar RNA SNORA4016705588267056015Rat
2323590Peg3paternally expressed 316709787467124692Rat
1563921Apeg3antisense paternally expressed gene 316712140267122333Rat
1310930Zim1zinc finger, imprinted 116713207667157843Rat
7529293LOC102548092uncharacterized LOC10254809216717312667196223Rat
1333236Olr2-psolfactory receptor pseudogene 216725198767252453Rat
41039060Envl-ps2MLV-related proviral Env polyprotein-like, pseudogene 216727516467280464Rat
1332869Or10am5olfactory receptor family 10 subfamily AM member 516733505467336007Rat
1332771Or6z1olfactory receptor family 6 subfamily Z member 116735338867354326Rat
1333445Olr5olfactory receptor 516736398067364918Rat
1332761Or6z7olfactory receptor family 6 subfamily Z member 716738201667382954Rat
1333093Or6z5olfactory receptor family 6 subfamily Z member 516738596167386902Rat
1333700Or6z3olfactory receptor family 6 subfamily Z member 316739625767397201Rat
9210095LOC103691061olfactory receptor 56-like16741750467418469Rat
1559613Smim17small integral membrane protein 1716744227067493140Rat
7679103Zfp28zinc finger protein 2816749486267510801Rat
1586242Zfp78zinc finger protein 7816750862767524972Rat
7617005Znf829l-ps1zinc finger protein 829 like, pseudogene 116752819167554970Rat
1562044Zfp583zinc finger protein 58316757585467594476Rat
1359114Zfp667zinc finger protein 66716760180367622041Rat
9080077Eddm13epididymal protein 1316763090567656404Rat
1559143Zscan5bzinc finger and SCAN domain containing 5B16766668467674238Rat
620187Galpgalanin-like peptide16768402367703121Rat
1304847Zfp444zinc finger protein 44416770905267729283Rat
1310536Zfp787zinc finger protein 78716774570267771132Rat
1307446Nlrp5NLR family, pyrin domain containing 516777803767810946Rat
1563529Nlrp4NLR family, pyrin domain containing 416808932168132429Rat
1564651RGD1564651similar to oocyte specific homeobox 316813268368153057Rat
1585094Smokxl-ps1sperm motility kinase X like, pseudogene 116816871168169929Rat
1585091LOC691325similar to oocyte specific homeobox 316818272568184559Rat
1307972Obox2oocyte specific homeobox 216819123868199383Rat
41181416LOC120098145homeobox protein ceh-37-like16819961668204251Rat
41244685LOC120098147homeobox protein Hox-C6a-like16821681268219145Rat
2316429Vom1r-ps43vomeronasal 1 receptor pseudogene 4316822803768229030Rat
1359734Vom1r32vomeronasal 1 receptor 3216827615868277075Rat
1308981Nlrp9NLR family, pyrin domain containing 916829118068341512Rat
2324726Ppp1cb-ps2protein phosphatase 1 catalytic subunit beta, pseudogene 216835582668356778Rat
2316471Vom1r39vomeronasal 1 receptor 3916838813468389051Rat
41365103Casp3-ps3caspase 3, pseudogene 316840682568407654Rat
1598358Casp3-ps2caspase 3, pseudogene 216842148168422311Rat
1585068Cct6a-ps6chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 616843217068434148Rat
41203168LOC120099323vomeronasal type-1 receptor 4-like16843535068436306Rat
11369651LOC10834984160S ribosomal protein L7a pseudogene16844561568446323Rat
1585057Cct6a-ps14chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 1416844889968450882Rat
4108498Vom1r34vomeronasal 1 receptor 3416845247768453394Rat
5491045Vom1r-ps44vomeronasal 1 receptor Vom1r-ps44 pseudogene16845294468453492Rat
41173557LOC120099328retinal homeobox protein Rx3-like16847746868483714Rat
9318609Envl-ps16MLV-related proviral Env polyprotein-like, pseudogene 1616849416868496174Rat
6491062Smokxl-ps8sperm motility kinase X like, pseudogene 816849755268506036Rat
1359552Vom1r35vomeronasal 1 receptor 3516856686568567906Rat
41220342LOC120093107vomeronasal type-1 receptor 1-like16857401068576391Rat
1359659Vom1r36vomeronasal 1 receptor 3616862428968625461Rat
1359340Vom1r37vomeronasal 1 receptor 3716865145068652448Rat
2316428Vom1r-ps45vomeronasal 1 receptor pseudogene 4516866604968667012Rat
1359541Vom1r38vomeronasal 1 receptor 3816867305368674000Rat
1561122Vom2r-ps47vomeronasal 2 receptor, pseudogene 4716869458068709322Rat
2314256Rasl2-9RAS-like, family 2, locus 916872087968734930Rat
1307409Rfpl4aret finger protein-like 4A16872896468735423Rat
619772Epn1Epsin 116874249168760507Rat
1310690U2af2U2 small nuclear RNA auxiliary factor 216876091168779730Rat
1566222Ccdc106coiled-coil domain containing 10616877988268791140Rat
1306892Zfp580zinc finger protein 58016878711868789286Rat
41399003LOC120100122U6 spliceosomal RNA16879109768791203Rat
1565545Zfp865zinc finger protein 86516880530268809780Rat
6494165Znf865zinc finger protein 86516881066468824652Rat
1306359Fiz1FLT3-interacting zinc finger 116882274168835723Rat
1565485Zfp524zinc finger protein 52416882480368828363Rat
1308475Zfp579zinc finger protein 57916884754768850751Rat
1583965Sbk3SH3 domain binding kinase family, member 316886784768873249Rat
1563279Sbk2SH3 domain binding kinase family, member 216887408168881918Rat
1565772Ssc5dscavenger receptor cysteine rich family member with 5 domains16889194268910462Rat
1565991Nat14N-acetyltransferase 1416891059968913452Rat
2323809Zfp628zinc finger protein 62816891360068921186Rat
1586703LOC684792hypothetical protein LOC68479216892917968937113Rat
1592677Isoc2aisochorismatase domain containing 2A16894017768957225Rat
1598357Atp6v0c-ps2ATPase H+ transporting V0 subunit C, pseudogene 216896317268963648Rat
1309062Isoc2bisochorismatase domain containing 2b16897296068993760Rat
1583944Shisa7shisa family member 716899390069012943Rat
1564746Ube2subiquitin-conjugating enzyme E2S16902885369032914Rat
621193Rpl28ribosomal protein L2816905214869054735Rat
1565210Tmem238transmembrane protein 23816905708369062474Rat
1583927Tmem190transmembrane protein 19016906270969064938Rat
621475Il11interleukin 1116906982969076129Rat
1310169Garin5bgolgi associated RAB2 interactor family member 5B16907683969093877Rat
1591896Cox6b2cytochrome c oxidase subunit 6B216909400969095312Rat
1305226Kmt5clysine methyltransferase 5C16909953169107145Rat
41389608LOC120099388uncharacterized LOC12009938816910617869108979Rat
41242622LOC120100203U6 spliceosomal RNA16910862069108678Rat
1306181Tmem150btransmembrane protein 150B16912494369134617Rat
1563268Brsk1BR serine/threonine kinase 116913416669159947Rat
11425087LOC108349434uncharacterized LOC10834943416916050069162688Rat
628677Hspbp1HSPA (Hsp70) binding protein 116916539469189062Rat
1311409Ppp6r1protein phosphatase 6, regulatory subunit 116919085669217598Rat
1593455Tmem86btransmembrane protein 86B16921810969220474Rat
620553Ptprhprotein tyrosine phosphatase, receptor type, H16924370469276294Rat
11359443LOC108349515uncharacterized LOC10834951516926747069279017Rat
3806Syt5synaptotagmin 516927735169285071Rat
2323487Dnaaf3dynein, axonemal, assembly factor 316929130069299365Rat
62052Tnni3troponin I3, cardiac type16929990069303582Rat
621852Tnnt1troponin T1, slow skeletal type16930636269316721Rat
1584883Ppp1r12cprotein phosphatase 1, regulatory subunit 12C16932024069343200Rat
1311146Eps8l1EPS8-like 116934320269359778Rat
1304959Rdh13retinol dehydrogenase 1316937301469401454Rat
1589130Gp6glycoprotein VI16942923269492709Rat
1589140Nlrp2NLR family pyrin domain containing 216951550569554689Rat
1584931Fgd4-ps1FYVE, RhoGEF and PH domain containing 4, pseudogene 116956760369589473Rat
621288Ncr1natural cytotoxicity triggering receptor 116961474469622570Rat
1303082FcarFc alpha receptor16962645869660558Rat
11459912LOC108349720thioredoxin domain-containing protein 11 pseudogene16964389469645166Rat
727836Kir3dl1killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 116971552969754050Rat
41326158Mospd1-ps1motile sperm domain containing 1, pseudogene 116979987569802192Rat
1359090Lilrb4leukocyte immunoglobulin like receptor B416980502069810628Rat
41380461Lilrb4-ps1leukocyte immunoglobulin like receptor B4, pseudogene 116983514569835898Rat
1566307Lilrb3leukocyte immunoglobulin like receptor B316992894869939461Rat
1582781Lilra5leukocyte immunoglobulin like receptor A516997329269978750Rat
40952347Odc1-ps7ornithine decarboxylase 1, pseudogene 716997820170005577Rat
1308382Cdc42ep5CDC42 effector protein 517003592170038990Rat
6488215Leng9leukocyte receptor cluster member 917003909970041559Rat
1306180Leng8leukocyte receptor cluster member 817004078570052662Rat
1310103Ttyh1tweety family member 117005331270071872Rat
1560048Lair1leukocyte-associated immunoglobulin-like receptor 117006857170187851Rat
41260332LOC120100223U1 spliceosomal RNA17008906670089236Rat
1559894Nlrp4bNLR family, pyrin domain containing 4B17042602170457919Rat
1626017Vom2r-ps48vomeronasal 2 receptor, pseudogene 4817049113970491308Rat
1582754Vom2r29vomeronasal 2 receptor, 2917052219370542510Rat
2316427Vom1r-ps46vomeronasal 1 receptor pseudogene 4617056819570569130Rat
1626060Vom2r-ps49vomeronasal 2 receptor, pseudogene 4917057181670576977Rat
7692619Vmn2r116l-ps28vomeronasal 2, receptor 116 like, pseudogene 2817057187970632554Rat
1626016Vom2r-ps51vomeronasal 2 receptor, pseudogene 5117069379270693938Rat
1565248Vom2r-ps52vomeronasal 2 receptor, pseudogene 5217074224470761439Rat
11494815Gapdh-ps21Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 2117076473170765421Rat
2316426Vom1r-ps47vomeronasal 1 receptor pseudogene 4717078531770786202Rat
1593127Vom2r-ps53vomeronasal 2 receptor, pseudogene 5317083178670855837Rat
1582732Vom2r-ps54vomeronasal 2 receptor, pseudogene 5417087880470896261Rat
11390829LOC108349751glyceraldehyde-3-phosphate dehydrogenase pseudogene17090506570905980Rat
1582722LOC691592similar to acid phosphatase 1 isoform b17091776470918195Rat
1584930Gapdh-ps111Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 11117096571670976124Rat
1561133Vom2r30vomeronasal 2 receptor, 3017098442671006924Rat
2319700Nlrp4b-ps2NLR family, pyrin domain containing 4B, pseudogene 217101090271056467Rat
1626057Vom2r-ps55vomeronasal 2 receptor, pseudogene 5517110749171132846Rat
41139857Gapdh-ps58Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5817117889271183244Rat
708412Vom2r31vomeronasal 2 receptor, 3117118305571211273Rat
1597276Gapdh-ps104Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 10417126884571277907Rat
6491558Gapdh-ps50Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5017129324671297525Rat
41255497Vmn2r116l-ps14vomeronasal 2, receptor 116 like, pseudogene 1417129757171332969Rat
1626056Vom2r-ps57vomeronasal 2 receptor, pseudogene 5717140278871416085Rat
1589241Vmn2r116l-ps23vomeronasal 2, receptor 116 like, pseudogene 2317143036371453097Rat
41252286Trnap-agg19transfer RNA proline (anticodon AGG) 1917145050871450588Rat
7497887Mark3-ps1microtubule affinity regulating kinase 3, pseudogene 117153773971542589Rat
2316425Vom1r-ps48vomeronasal 1 receptor pseudogene 4817158426471584852Rat
7677185LOC102551504vomeronasal type-1 receptor 4-like17161010871611022Rat
708398Vom2r32vomeronasal 2 receptor, 3217167422071693744Rat
1359462Vom1r41vomeronasal 1 receptor 4117176866571769585Rat
1590388Vom1r4-ps1vomeronasal 1 receptor 4, pseudogene 117186870771869669Rat
1588463Vom2r78vomeronasal 2 receptor, 7817190788171954622Rat
41054609Rps21-ps8ribosomal protein S21, pseudogene 817201995872022913Rat
41126118Sbk1-ps1SH3 domain binding kinase 1, pseudogene 117205484372057618Rat
1590429Mtdh-ps1metadherin, pseudogene 117205854272061303Rat
2316375Vom1r-ps108vomeronasal 1 receptor pseudogene 10817207214372073118Rat
2318927LOC100362054mCG114696-like17207362872092260Rat
2316424Vom1r-ps49vomeronasal 1 receptor pseudogene 4917209816172098365Rat
41053833Rsl1d1-ps2ribosomal L1 domain containing 1, pseudogene 217209914772104148Rat
2316423Vom1r-ps50vomeronasal 1 receptor pseudogene 5017210443872105320Rat
1597249Yipf5-ps1Yip1 domain family, member 5, pseudogene 117210581372106575Rat
1549734Vom1r42vomeronasal 1 receptor 4217211063072140964Rat
40979290LOC120099765uncharacterized LOC12009976517214975272155565Rat
9406093Zscan4l-ps1zinc finger and SCAN domain containing 4 like, pseudogene 117219335372197254Rat
1359095Vom1r43vomeronasal 1 receptor 4317221891072219833Rat
1359382Vom1r44vomeronasal 1 receptor 4417224981872250935Rat
1359121Vom1r45vomeronasal 1 receptor 4517229069272291637Rat
1597218Vom1r-ps51vomeronasal 1 receptor pseudogene 5117233212372333075Rat
1359306Vom1r46vomeronasal 1 receptor 4617235982372360773Rat
1359700Vom1r47vomeronasal 1 receptor 4717239840272402091Rat
2316422Vom1r-ps52vomeronasal 1 receptor pseudogene 5217243197672432887Rat
2316421Vom1r-ps53vomeronasal 1 receptor pseudogene 5317243448372435219Rat
11394442LOC108348146vomeronasal type-1 receptor 3-like17245083772457833Rat
41328983LOC120099763uncharacterized LOC12009976317247451772487833Rat
1359673Vom1r49vomeronasal 1 receptor 4917250178772502731Rat
1564617RGD1564617similar to large subunit ribosomal protein L36a17250502172505474Rat
1359168Vom1r50vomeronasal 1 receptor 5017251151172515762Rat
2316420Vom1r-ps54vomeronasal 1 receptor pseudogene 5417253147872532127Rat
1592780Zfp551zinc finger protein 55117254381572554060Rat
2316419Vom1r-ps55vomeronasal 1 receptor pseudogene 5617266314772664066Rat
11378088LOC108349838vomeronasal type-1 receptor 1-like17267561572676568Rat
2316418Vom1r-ps56vomeronasal 1 receptor pseudogene 5617270786672708726Rat
2316417Vom1r-ps57vomeronasal 1 receptor pseudogene 5717274397072744343Rat
2316416Vom1r-ps58vomeronasal 1 receptor pseudogene 5817278111172782110Rat
1597196Vom1r-ps59vomeronasal 1 receptor pseudogene 5917280242172803373Rat
41371028Vom1r4-ps3vomeronasal 1 receptor 4, pseudogene 317280459172813839Rat
1359524Vom1r53vomeronasal 1 receptor 5317282707972828032Rat
2316414Vom1r-ps61vomeronasal 1 receptor pseudogene 6117283983672840007Rat
1308663Vom1r54vomeronasal 1 receptor 5417284374172844664Rat
2316413Vom1r-ps62vomeronasal 1 receptor pseudogene 6217285136472852272Rat
2316412Vom1r-ps63vomeronasal 1 receptor pseudogene 6317286494672865812Rat
2316411Vom1r-ps64vomeronasal 1 receptor pseudogene 6417287790672879059Rat
1564471Vom2r-ps59vomeronasal 2 receptor, pseudogene 5917296084472961764Rat
41283372LOC120099764uncharacterized LOC12009976417297766372984952Rat
1309810Zfp606zinc finger protein 60617298192073022423Rat
41217149LOC120099762uncharacterized LOC12009976217300417773012469Rat
1595996C1h19orf18similar to human chromosome 19 open reading frame 1817302232473049934Rat
1561380Vom2r-ps60vomeronasal 2 receptor, pseudogene 6017307408873077556Rat
1595960Vom2r33vomeronasal 2 receptor, 3317313753673156082Rat
1595956Vom2r34vomeronasal 2 receptor, 3417316704173188440Rat
11442878LOC108348434cytochrome c, somatic pseudogene17319309473193582Rat
1559147Vom2r35vomeronasal 2 receptor, 3517321041773227703Rat
1560365Vom2r36vomeronasal 2 receptor, 3617326879573294065Rat
4108497Mir295-2microRNA 295-217327996673280046Rat
1560671Zscan18zinc finger and SCAN domain containing 1817333288373349846Rat
1565029Zfp329zinc finger protein 32917340306773498349Rat
1306339Zfp110zinc finger protein 11017344530373461112Rat
41193534Znf8zinc finger protein 817349849373511929Rat
7606541Zscan22zinc finger and SCAN domain containing 2217351633573527766Rat
3601Rps5ribosomal protein S517353877673543073Rat
1561909Rnf225ring finger protein 22517354359873546269Rat
7667004LOC102552901KH homology domain-containing protein 1-like17355069073552469Rat
1306631Zfp324zinc finger protein 32417359141173600601Rat
7612453Zfp446zinc finger protein 44617359495373612685Rat
7591865LOC102552250uncharacterized LOC10255225017359941073601547Rat
708535Slc27a5solute carrier family 27 member 517361655673627149Rat
11369034Snrpf-ps1small nuclear ribonucleoprotein polypeptide F, pseudogene 117362200273622385Rat
11394751LOC108348449uncharacterized LOC10834844917362739573628936Rat
1310920Zbtb45zinc finger and BTB domain containing 4517363489573639802Rat
620289Trim28tripartite motif-containing 2817365244173659388Rat
1305050Chmp2acharged multivesicular body protein 2A17366004573662894Rat
1307614Ube2mubiquitin-conjugating enzyme E2M17366257673666113Rat
1308391Mzf1myeloid zinc finger 117367052273682885Rat
1595934Vom1r55vomeronasal 1 receptor 5517372349273724388Rat
41300746Vom1r2-ps1vomeronasal 1 receptor 2, pseudogene 117375036473751592Rat
2319808LOC100365062eukaryotic translation initiation factor 3, subunit 6 48kDa-like17377449173775984Rat
41212614LOC120097724vomeronasal type-1 receptor 2-like17378586173786983Rat
1359419Vom1r56vomeronasal 1 receptor 5617386710373868131Rat
1359484Vom1r57vomeronasal 1 receptor 5717388793173888815Rat
2316410Vom1r-ps65vomeronasal 1 receptor pseudogene 6517393410173934877Rat
1359358Vom1r58vomeronasal 1 receptor 5817398458973991005Rat
2316409Vom1r-ps66vomeronasal 1 receptor pseudogene 6617400069074000806Rat
1564801RGD1564801similar to hepatic multiple inositol polyphosphate phosphatase17401724874019633Rat
1359709Vom1r59vomeronasal 1 receptor 5917403142474032371Rat
2316470Vom1r60vomeronasal 1 receptor 6017405859574059542Rat
1359582Vom1r61vomeronasal 1 receptor 6117410655174110046Rat
1359608Vom1r62vomeronasal 1 receptor 6217413566974140709Rat
1310257Zswim9zinc finger SWIM-type containing 917414481874165804Rat
621424Lig1DNA ligase 117416568874204400Rat
1594658Pla2g4cphospholipase A2 group IVC17424968874272133Rat
1587424Peli1-ps1pellino 1, pseudogene 117429829574300674Rat
1308108Cabp5calcium binding protein 517435081174363830Rat
1594649Bsph1binder of sperm protein homolog 117441397674450117Rat
2321883LOC100360574alcohol sulfotransferase-like17466230074719434Rat
41276304LOC120100453small nucleolar RNA SNORA1717479720174797324Rat
7632840Ncl-ps5nucleolin, pseudogene 517481943974846832Rat
2324781Sult2a1-ps1sulfotransferase family 2A member 1, pseudogene 117484178374903941Rat
3727Sult2a6sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 617491109774962239Rat
6486637Sult2a2-ps1sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2, pseudogene 117529970375379824Rat
41056946Trnag-acc2transfer RNA glycine (anticodon ACC) 217532427475324346Rat
41397456LOC120100123U6 spliceosomal RNA17532856675328672Rat
1306075Srp72-ps1signal recognition particle 72, pseudogene 117538412775387772Rat
41004698Ncl-ps3nucleolin, pseudogene 317540379475405022Rat
621337Sult2a1sulfotransferase family 2A member 117545117875508142Rat
6501805Ncl-ps2nucleolin, pseudogene 217556182876001703Rat
1306542Sult2a2sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 217590958575976600Rat
40939961Trnag-acc5transfer RNA glycine (anticodon ACC) 517593415375934225Rat
41246900LOC120100121U6 spliceosomal RNA17593843675938542Rat
41180804LOC120099767signal recognition particle subunit SRP72-like17598236675984490Rat
41102250LOC120099768sulfotransferase 2A1-like17605855676077447Rat
1565590RGD1565590similar to Wolf-Hirschhorn syndrome candidate 1 protein isoform 317623003776239579Rat
41229824Rpl9-ps10ribosomal protein L9, pseudogene 1017637467876389638Rat
41084452Rpl9-ps3ribosomal protein L9, pseudogene 317645960676460290Rat
7510102LOC102554917homeobox protein goosecoid-like17646536976466555Rat
1594617Obox1oocyte specific homeobox 117648603376487471Rat
1594613Rpl35-ps12ribosomal protein L35, pseudogene 1217649258076492951Rat
9421086LOC103691042transcription elongation factor B polypeptide 2 pseudogene17651675076517202Rat
11445112Rpl23a-ps5ribosomal protein L23a, pseudogene 517653642876537155Rat
620511Crxcone-rod homeobox17654014176545818Rat
7574103LOC102553890paired box protein Pax-7-like17657782776580677Rat
1565487Crxos1Crx opposite strand transcript 117657782776580677Rat
1565487Crxos1Crx opposite strand transcript 117658312476585490Rat
41027146Ass1-ps1argininosuccinate synthase 1, pseudogene 117658619176590160Rat
3661Selenowselenoprotein W17659944176604514Rat
2321315LOC100360843ribosomal protein S19-like17661007576610605Rat
2321033LOC100364427ribosomal protein S12-like17661655676617067Rat
2321003Rpl9-ps30ribosomal protein L9, pseudogene 3017662257576623293Rat
1303085Nop53NOP53 ribosome biogenesis factor17662908476636902Rat
41052366Snord23small nucleolar RNA, C/D box 2317662999876630106Rat
1560856Ehd2EH-domain containing 217663956876658747Rat
1306385BicraBRD4 interacting chromatin remodeling complex associated protein17666189776736146Rat
9069429LOC103691043uncharacterized LOC10369104317666272776667219Rat
1310756Zfp541zinc finger protein 54117675023676786567Rat
620855NapaNSF attachment protein alpha17678703676805869Rat
1310341Kptnkaptin (actin binding protein)17680873776809531Rat
620194Slc8a2solute carrier family 8 member A217681658376852928Rat
1308532Meis3Meis homeobox 317686126776872691Rat
1584452Dhx34DExH-box helicase 3417688086776905148Rat
41343305LOC120098270transmembrane protein 64-like17691260176931575Rat
1303027C5ar2complement C5a receptor 217693038176945432Rat
1584430Dync1li1-ps1dynein cytoplasmic 1 light intermediate chain 1, pseudogene 117694635976948484Rat
70553C5ar1complement C5a receptor 117694862276959826Rat
2301983Inafm1InaF-motif containing 117697680876978292Rat
1584422Ccdc9coiled-coil domain containing 917697831276991673Rat
631434Bbc3Bcl-2 binding component 317701328177022509Rat
1306098Sae1SUMO1 activating enzyme subunit 117703096177086937Rat
41231025Ftl1-ps12ferritin light chain 1, pseudogene 1217708689677095834Rat
1596943Zc3h4zinc finger CCCH-type containing 417710630977143827Rat
1564549Tmem160transmembrane protein 16017716444877167156Rat
1310040Npas1neuronal PAS domain protein 117716737577187887Rat
1308738Arhgap35Rho GTPase activating protein 3517720243677319298Rat
11485321Gng5-ps3G protein subunit gamma 5, pseudogene 317729203377292502Rat
7714566LOC102550403carcinoembryonic antigen-related cell adhesion molecule 3-like17735436477356099Rat
41288659LOC120099769uncharacterized LOC12009976917735777777363250Rat
11382285LOC108349752carcinoembryonic antigen-related cell adhesion molecule 3-like17736837677373343Rat
70954Ceacam9CEA cell adhesion molecule 917740561977410154Rat
620188Ap2s1adaptor related protein complex 2 subunit sigma 117741749677428903Rat
1584794LOC679748similar to Macrophage migration inhibitory factor (MIF) (Phenylpyruvate tautomerase) (Glycosylation-inhibiting factor) (GIF) (Delayed early response protein 6) (DER6)17743257777433425Rat
41368644LOC120099772uncharacterized LOC12009977217745003177453815Rat
708512Slc1a5solute carrier family 1 member 517745684977470952Rat
1305852Fkrpfukutin related protein17747964177486954Rat
1307030Strn4striatin 417748226777511862Rat
1308054Prkd2protein kinase D217751362577542386Rat
41294864Trnap-cgg4transfer RNA proline (anticodon CGG) 317751777877517852Rat
1563892Dact3dishevelled-binding antagonist of beta-catenin 317754690077558631Rat
620808Gng8G protein subunit gamma 817756451277568371Rat
1310890Ptgirprostaglandin I2 receptor17757959677581979Rat
2259Calm3calmodulin 317759066877597776Rat
1560435Pnma8bPNMA family member 8B17762228777626525Rat
1310803Pnma8aPNMA family member 8A17762927277643156Rat
9248289LOC10369104560S ribosomal protein L32 pseudogene17762928777629680Rat
41176426Rpl28-ps12ribosomal protein L28, pseudogene 1217766506477665567Rat
41282558LOC120099771uncharacterized LOC12009977117766692177668985Rat
41230706Pnma8cPNMA family member 8C17766904077671531Rat
1359717Ccdc8coiled-coil domain containing 817767952177682849Rat
68415Ppp5cprotein phosphatase 5, catalytic subunit17769020377714507Rat
70332Hif3ahypoxia inducible factor 3 subunit alpha17771811077750448Rat
1307652Cgm4carcinoembryonic antigen gene family 417777644777789408Rat
1563849Psg16pregnancy specific glycoprotein 1617780629677821775Rat
2333Ceacam3CEA cell adhesion molecule 317786390777876441Rat
727932Psgb1pregnancy-specific beta 1-glycoprotein17792317077932053Rat
1565741Psg29pregnancy-specific glycoprotein 2917797484977997680Rat
41027479LOC120098290pregnancy-specific glycoprotein 22-like17802717378037254Rat
7692144LOC102550682carcinoembryonic antigen-related cell adhesion molecule 5-like17806595378100726Rat
1559593Ceacam11CEA cell adhesion molecule 1117813882278145058Rat
1306754Ceacam12CEA cell adhesion molecule 1217821647178223526Rat
41065025LOC120098300uncharacterized LOC12009830017831040778327651Rat
7563852Rpl7-ps5ribosomal protein L7, pseudogene 517837109578372025Rat
1311714Mill1MHC I like leukocyte 117837213878398932Rat
7751312Crx-ps1cone-rod homeobox, pseudogene 117837455378376427Rat
41041174LOC120099773uncharacterized LOC12009977317839293978408647Rat
41306400LOC120099774uncharacterized LOC12009977417840858578414690Rat
1597185Phgdh-ps2phosphoglycerate dehydrogenase, pseudogene 217841878278420350Rat
2334Psg19pregnancy specific glycoprotein 1917842118378431449Rat
7698003LOC102557319carcinoembryonic antigen-related cell adhesion molecule 3-like17843978478449990Rat
41288306Dstn-ps1destrin, actin depolymerizing factor, pseudogene 117846878278469741Rat
7730631Fkbp1a-ps1FKBP prolyl isomerase 1A, pseudogene 117847001278471461Rat
1594536Wdr13-ps1WD repeat domain 13, pseudogene 117847144378473151Rat
2323908Hnrnpk-ps7heterogeneous nuclear ribonucleoprotein K, pseudogene 717848529778491177Rat
1564508MicbMHC class I polypeptide-related sequence B17849577978513030Rat
41030208LOC120099776uncharacterized LOC12009977617852228578530274Rat
621429Pglyrp1peptidoglycan recognition protein 117853181578537001Rat
1307390Ccdc61coiled-coil domain containing 6117853749478557686Rat
1308032Nova2NOVA alternative splicing regulator 217857225378613703Rat
1562436Nanos2nanos C2HC-type zinc finger 217863566878637128Rat
1565160MypopMyb-related transcription factor, partner of profilin17863969478650555Rat
1308312Irf2bp1interferon regulatory factor 2 binding protein 117865273678655437Rat
2809Foxa3forkhead box A317866206778672321Rat
1306735Sympksymplekin scaffold protein17867232678700684Rat
1306786Rsph6aradial spoke head 6 homolog A17870072778720444Rat
41211843Trnag-acc6transfer RNA glycine (anticodon ACC) 617870434578704425Rat
11393200LOC108349062uncharacterized LOC10834906217871240878722549Rat
1594179DmwdDM1 locus, WD repeat containing17872243678729224Rat
1309825DmpkDM1 protein kinase17873025578740585Rat
1305040Six5SIX homeobox 517874081278745890Rat
7528935Meiosinmeiosis initiator17874450478768104Rat
1308393Fbxo46F-box protein 4617877005978786582Rat
1308128Qpctlglutaminyl-peptide cyclotransferase-like17878673078797956Rat
1593018Snrpd2small nuclear ribonucleoprotein D2 polypeptide17879837778801227Rat
2689Giprgastric inhibitory polypeptide receptor17880428778814462Rat
621066Eml2EMAP like 217882759578859343Rat
2325620Mir330microRNA 33017883317878833274Rat
1311604Gpr4G protein-coupled receptor 417886537678877126Rat
1309147Opa3outer mitochondrial membrane lipid metabolism regulator OPA317887961278910453Rat
1309147Opa3outer mitochondrial membrane lipid metabolism regulator OPA317888139278899549Rat
41258259LOC120100200U1 spliceosomal RNA17889518178895335Rat
1311542Vaspvasodilator-stimulated phosphoprotein17891000978925791Rat
1562091Ppm1nprotein phosphatase, Mg2+/Mn2+ dependent 1N17892935078934435Rat
1303245Rtn2reticulon 217893505678948069Rat
40942998Trnastop-ucatransfer RNA opal suppressor (anticodon UCA)17895260178952687Rat
1308198FosbFosB proto-oncogene, AP-1 transcription factor subunit17895431278961492Rat
9215275LOC103691049uncharacterized LOC10369104917895617878957297Rat
1306992Ercc1ERCC excision repair 1, endonuclease non-catalytic subunit17897131079007963Rat
1591707Polr1gRNA polymerase I subunit G17900749079010766Rat
1593681Ppp1r13lprotein phosphatase 1, regulatory subunit 13 like17901099779030714Rat
1309109Ercc2ERCC excision repair 2, TFIIH core complex helicase subunit17903334279047102Rat
2317875Mir343microRNA 34317903845479038546Rat
621432Klc3kinesin light chain 317904584279055809Rat
2358Ckmcreatine kinase, M-type17906139079071721Rat
1591792Mark4microtubule affinity regulating kinase 417907535379108882Rat
41401158LOC120100211U1 spliceosomal RNA17911101179111155Rat
1592539Exoc3l2exocyst complex component 3-like 217911378479145359Rat
1591724Bloc1s3biogenesis of lysosomal organelles complex-1, subunit 317915591479158326Rat
1591735Trappc6atrafficking protein particle complex subunit 6A17915858779165502Rat
1591760Nkpd1NTPase, KAP family P-loop domain containing 117916564279175126Rat
1595870Ppp1r37protein phosphatase 1, regulatory subunit 3717918079479212612Rat
1597035Gemin7gem (nuclear organelle) associated protein 717921505479228769Rat
1595818Zfp296zinc finger protein 29617922864979231866Rat
1563538ClasrpCLK4-associating serine/arginine rich protein17923226079256462Rat
2321078RelbRELB proto-oncogene, NF-kB subunit17925773879285490Rat
1310959Clptm1CLPTM1 regulator of GABA type A receptor forward trafficking17928947879321079Rat
2135Apoc2apolipoprotein C217932942979334397Rat
70959Apoc4apolipoprotein C417933574579339942Rat
2134Apoc1apolipoprotein C117934705779350340Rat
2138Apoeapolipoprotein E17935392479357852Rat
1303022Tomm40translocase of outer mitochondrial membrane 4017935878179370976Rat
1309505Nectin2nectin cell adhesion molecule 217937212379407379Rat
68378Bcambasal cell adhesion molecule (Lutheran blood group)17941501679429403Rat
1307651CblcCbl proto-oncogene C17943997579456755Rat
1589465Bcl3BCL3, transcription coactivator17947136879485908Rat
1306386Ceacam16CEA cell adhesion molecule 16, tectorial membrane component17951497579524871Rat
1589436Ceacam19CEA cell adhesion molecule 1917954210779550927Rat
3813PvrPVR cell adhesion molecule17956129479576700Rat
1564357Igsf23immunoglobulin superfamily, member 2317959105979606323Rat
1311281Ceacam20CEA cell adhesion molecule 2017962207779643782Rat
7736402Sub1-ps1SUB1 regulator of transcription, pseudogene 117963377079634608Rat
631380Zfp180zinc finger protein 18017965244179672737Rat
40994558LOC120096885thymosin beta-4-like17966660579666715Rat
1305757Zfp112zinc finger protein 11217967693379691994Rat
41248459Rab12-ps1RAB12, member RAS oncogene family, pseudogene 117971533979717214Rat
620595Zfp111zinc finger protein 11117976289779774274Rat
41097707LOC120096887uncharacterized LOC12009688717977586979785939Rat
11438175LOC108348999uncharacterized LOC10834899917978909879799671Rat
7498933Znf235-ps1zinc finger protein 235, pseudogene 117979976679808543Rat
41339228LOC120096888uncharacterized LOC12009688817980057779813595Rat
11444414LOC108348989high mobility group protein B1 pseudogene17981517679816529Rat
1564214Zfp108zinc finger protein 10817982044579827564Rat
1563843Zfp61zinc finger protein 6117985001379857993Rat
1560430Zfp94zinc finger protein 9417985818879879702Rat
9431454LOC103691053uncharacterized LOC10369105317987972379894281Rat
7529325Zfp94l1zinc finger protein 94 like 117988587579896601Rat
1311676Tescltescalcin-like17989655479920998Rat
1560355Lypd5Ly6/Plaur domain containing 517992981879941791Rat
621476Kcnn4potassium calcium-activated channel subfamily N member 417995638079974354Rat
1309888Smg9SMG9 nonsense mediated mRNA decay factor17998854080011262Rat
41273648Trnaa-agc66transfer RNA alanine (anticodon AGC) 6618001474580014819Rat
1311107Irgcimmunity related GTPase cinema18002011480025797Rat
620597Plaurplasminogen activator, urokinase receptor18005344180068384Rat
1304722Cadm4cell adhesion molecule 418007523280096511Rat
1564862Zfp428zinc finger protein 42818009756780108875Rat
2323012Srrm5serine/arginine repetitive matrix 518010304280104777Rat
1309409Irgqimmunity-related GTPase Q18012392580131881Rat
1565787Pinlypphospholipase A2 inhibitor and Ly6/Plaur domain containing18013464280140488Rat
619823Xrcc1X-ray repair cross complementing 118014049580168705Rat
1305025Zfp575zinc finger protein 57518017501680177176Rat
1311034Ethe1ETHE1, persulfide dioxygenase18018403780199092Rat
1561121Phldb3pleckstrin homology-like domain, family B, member 318020090180219538Rat
69053Lypd3Ly6/Plaur domain containing 318022644980230901Rat
621373Tex101testis expressed 10118025507680259442Rat
1564380Lypd10Ly6/PLAUR domain containing 1018027301980278238Rat
2322813LOC100363535hypothetical protein LOC10036353518028819280293773Rat
41292995LOC120096889uncharacterized LOC12009688918029278080294985Rat
41019110LOC120096890uncharacterized LOC12009689018029713180301947Rat
1584667LOC681077similar to testis expressed gene 10118030823480312967Rat
1565655RGD1565655similar to BC049730 protein18032318880328311Rat
6493325Ybx1-ps6Y box binding protein 1, pseudogene 618033352280336338Rat
1562941Cd177CD177 molecule18034003480360599Rat
40977505Pym1-ps10PYM homolog 1, exon junction complex associated factor, pseudogene 1018037411580376604Rat
708435Ceacam4CEA cell adhesion molecule 418037666780382943Rat
11369943LOC108349556uncharacterized LOC10834955618041484680416174Rat
1642421Ceacam6CEA cell adhesion molecule 618041653180434668Rat
1583497Lypd4Ly6/Plaur domain containing 418046048780466105Rat
1583739Dmrtc2DMRT-like family C218046625980473883Rat
68440Rps19ribosomal protein S1918048071880486511Rat
6484896Cd79aCD79a molecule18049352080497936Rat
620951Arhgef1Rho guanine nucleotide exchange factor 118049902680520954Rat
1563034ErflETS repressor factor like18052137880526262Rat
621002Rabac1Rab acceptor 118056402980567164Rat
2169Atp1a3ATPase Na+/K+ transporting subunit alpha 318057279080601936Rat
2735Grik5glutamate ionotropic receptor kainate type subunit 518060587880667896Rat
1311420Zfp574zinc finger protein 57418066798480678257Rat
621690Pou2f2POU class 2 homeobox 218068233080769756Rat
9072276LOC103691054uncharacterized LOC10369105418072435880747156Rat
1588968Dedd2death effector domain containing 218078908480807789Rat
40932419LOC120100137U6 spliceosomal RNA18080331980803425Rat
1588959Zfp526zinc finger protein 52618080779180817852Rat
620351Gsk3aglycogen synthase kinase 3 alpha18081584380825732Rat
1311991ErfEts2 repressor factor18082993580838388Rat
1310706Ciccapicua transcriptional repressor18085392080880537Rat
620333Pafah1b3platelet-activating factor acetylhydrolase 1b, catalytic subunit 318088126380883789Rat
1595416Prr19proline rich 1918088452980890712Rat
1595911Tmem145transmembrane protein 14518089188880901615Rat
621190Megf8multiple EGF-like-domains 818090223680951614Rat
1563577Cnfncornifelin18094969980953747Rat
41091792LOC120096895uncharacterized LOC12009689518096165580980582Rat
3010Lipelipase E, hormone sensitive type18096561280984313Rat
7639269LOC102549342uncharacterized LOC10254934218098444181119329Rat
1304717Cxcl17C-X-C motif chemokine ligand 1718098475180996842Rat
41212000Hmgb1-ps12high-mobility group box 1, pseudogene 1218102583681031451Rat
67396Ceacam1CEA cell adhesion molecule 118104359581060050Rat
1583255Erich4glutamate-rich 418112355681125296Rat
1549698Dmac2distal membrane arm assembly component 218112876081134810Rat
1305374B3gnt8UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 818113560281138501Rat
2196Bckdhabranched chain keto acid dehydrogenase E1 subunit alpha18113894681167765Rat
1307861Exosc5exosome component 518116812881177266Rat
2323264Tmem91transmembrane protein 9118117948381187005Rat
1566122B9d2B9 domain containing 218118939581195383Rat
41128685LOC120096894uncharacterized LOC12009689418119167981194780Rat
69051Tgfb1transforming growth factor, beta 118119653281212848Rat
1309393Ccdc97coiled-coil domain containing 9718121922581227017Rat
1307456Hnrnpul1heterogeneous nuclear ribonucleoprotein U-like 118122840481264121Rat
620028AxlAxl receptor tyrosine kinase18126565681296278Rat
41222147LOC120096893uncharacterized LOC12009689318129633481301538Rat
1306078Cyp2s1cytochrome P450, family 2, subfamily s, polypeptide 118130994881325303Rat
40952951LOC120096896uncharacterized LOC12009689618132665381328809Rat
2323115LOC100359930Cyp2s1 protein-like18136736581369010Rat
2466Cyp2b1cytochrome P450, family 2, subfamily b, polypeptide 118151838781544999Rat
2467Cyp2b2cytochrome P450, family 2, subfamily b, polypeptide 218159453481608567Rat
628627Cyp2b3cytochrome P450, family 2, subfamily b, polypeptide 318165276281732153Rat
1594535Eif4g2-ps2eukaryotic translation initiation factor 4, gamma 2, pseudogene 218175467681757322Rat
9160854LOC103691092cytochrome P450 2B9-like18179177681810482Rat
735174Cyp2b21cytochrome P450, family 2, subfamily b, polypeptide 2118188609781915066Rat
1561337Epc2l1enhancer of polycomb homolog 2 (Drosophila)-like 118193196381934681Rat
2322934LOC100360011cytochrome P450, family 2, subfamily b, polypeptide 19-like18195835481963641Rat
620088Cyp2b12cytochrome P450, family 2, subfamily b, polypeptide 1218200760982019409Rat
9404051Cyp2b14cytochrome P450, family 2, subfamily b, polypeptide 1418206716082079597Rat
1596474Cyp2b15cytochrome P450, family 2, subfamily b, polypeptide 1518209418882106492Rat
2477Cyp2g1cytochrome P450, family 2, subfamily g, polypeptide 118214563582156862Rat
9360878LOC103691073uncharacterized LOC10369107318216198182173209Rat
2465Cyp2a3cytochrome P450, family 2, subfamily a, polypeptide 318217191482179980Rat
2463Cyp2a1cytochrome P450, family 2, subfamily a, polypeptide 118223161182244887Rat
2464Cyp2a2cytochrome P450, family 2, subfamily a, polypeptide 218226383382289487Rat
11418557LOC108349422uncharacterized LOC10834942218233349482337335Rat
1307759Sdccag1-ps1serologically defined colon cancer antigen 1, pseudogene 118234191482345530Rat
1583802Pgk1-ps6phosphoglycerate kinase 1, pseudogene 618234585682348568Rat
2476Cyp2f4cytochrome P450, family 2, subfamily f, polypeptide 418241610882429897Rat
620086Cyp2t1cytochrome P450, family 2, subfamily t, polypeptide 118244632182451564Rat
631376Egln2egl-9 family hypoxia-inducible factor 218245155482459809Rat
620931Rab4bRAB4B, member RAS oncogene family18246139682472784Rat
620883MiaMIA SH3 domain containing18247367782476378Rat
1307416Snrpasmall nuclear ribonucleoprotein polypeptide A18248177082490540Rat
1560854Actmapactin maturation protease18249031382499841Rat
631336Itpkcinositol-trisphosphate 3-kinase C18250095782522533Rat
1311356Coq8bcoenzyme Q8B18252557882549182Rat
1307579NumblNUMB-like, endocytic adaptor protein18254981482573788Rat
41348607Rpl14-ps3ribosomal protein L14, pseudogene 318256339182564154Rat
41101381LOC120099779uncharacterized LOC12009977918257744282589999Rat
41144525LOC120099778small nuclear ribonucleoprotein G-like18258468782585068Rat
1307033Ltbp4latent transforming growth factor beta binding protein 418260013682634346Rat
1309281Shkbp1Sh3kbp1 binding protein 118263679782650330Rat
1304682Sptbn4spectrin, beta, non-erythrocytic 418265075082738345Rat
1306080Blvrbbiliverdin reductase B18273864682756312Rat
1564271Sertad3SERTA domain containing 318276353582767271Rat
1549778Sertad1SERTA domain containing 118277569282778961Rat
619960Prxperiaxin18278508282807154Rat
7527404Tmem258-ps4transmembrane protein 258, pseudogene 418280074582802399Rat
1307541Hipk4homeodomain interacting protein kinase 418281070882821080Rat
1308248Pld3phospholipase D family, member 318282186382844280Rat
1307554RGD1307554similar to CG16812-PA18284430982871187Rat
2082Akt2AKT serine/threonine kinase 218287722882933828Rat
9424195LOC103691074uncharacterized LOC10369107418294734882950417Rat
1306256Ttc9btetratricopeptide repeat domain 9B18295343482955659Rat
1308381Map3k10mitogen activated protein kinase kinase kinase 1018295578382974084Rat
6500398Znf780bzinc finger protein 780B18300917483030463Rat
41148576LOC120100153U6 spliceosomal RNA18301264383012749Rat
41179851LOC120099780uncharacterized LOC12009978018304474483049885Rat
41397435Trnas-aga27transfer RNA serine (anticodon AGA) 2718304842883048502Rat
1583801Csde1-ps2cold shock domain containing E1, pseudogene 218305155483056439Rat
2318912LOC100362069ribosomal protein L28-like18305631883056902Rat
1592570Zfp780bzinc finger protein 780B18305899383182629Rat
41383691Snu13-ps3small nuclear ribonucleoprotein 13, pseudogene 318306080883061157Rat
7579720Zfp780b-ps2zinc finger protein 780B, pseudogene 218309420783108245Rat
41385694LOC120099781uncharacterized LOC12009978118315615983167857Rat
7569654Rpl23a-ps16ribosomal protein L23a, pseudogene 1618318282783185284Rat
40970233Acp1-ps2acid phosphatase 1, pseudogene 218318729283189250Rat
7588314LOC102553760zinc finger protein 59-like18320385083223665Rat
2321719Zfp780b-ps1zinc finger protein 780B, pseudogene 118324779383265406Rat
7575422LOC102549611uncharacterized LOC10254961118326552583272948Rat
1591403Zfp59zinc finger protein 5918330791683330139Rat
41259303LOC120100218U7 small nuclear RNA18331662183316684Rat
621102Psmc4proteasome 26S subunit, ATPase 418334912783357497Rat
41300812LOC120100311U2 spliceosomal RNA18336327283363384Rat
2313189FcgbpFc gamma binding protein18337497983413083Rat
41130624Rnu6-105RNA, U6 small nuclear 10518341819183418290Rat
1311906Fcgbpl1Fc fragment of IgG binding protein-like 118342478883462802Rat
1305542Fblfibrillarin18346983283478932Rat
1307223Dyrk1bdual specificity tyrosine phosphorylation regulated kinase 1B18347913983497011Rat
1591322Eid2EP300 interacting inhibitor of differentiation 218353821783542262Rat
9381183Eid2bEP300 interacting inhibitor of differentiation 2B18354553083547338Rat
1562943Selenovselenoprotein V18355147383558756Rat
70953Dll3delta like canonical Notch ligand 318356201183570008Rat
1587684Timm50translocase of inner mitochondrial membrane 5018357487283582769Rat
1563807Supt5hSPT5 homolog, DSIF elongation factor subunit18358671383616971Rat
11514392LOC10834984340S ribosomal protein S28 pseudogene18362115283621481Rat
7572409LOC102550060uncharacterized LOC10255006018363428983643045Rat
621031Rps16ribosomal protein S1618364306683646056Rat
41121395LOC120100461small nucleolar RNA SNORA4018364391983644044Rat
1310112Plekhg2pleckstrin homology and RhoGEF domain containing G218365185683666046Rat
11367619Trnai-uau1transfer RNA isoleucine (anticodon UAU) 118366546483665557Rat
620722Zfp36zinc finger protein 3618366908483671564Rat
1311009Med29mediator complex subunit 2918367796183683365Rat
1306219Paf1PAF1 homolog, Paf1/RNA polymerase II complex component18368365483689233Rat
1305597Samd4bsterile alpha motif domain containing 4B18368941383728652Rat
620506Gmfgglia maturation factor, gamma18372879783739189Rat
1304707Lrfn1leucine rich repeat and fibronectin type III domain containing 118374244283761450Rat
6493686Ifnl1interferon, lambda 118379865183800297Rat
1589046Ifnl3interferon, lambda 318381445683816096Rat
620862Sycnsyncollin18382383683833542Rat
1305932Nccrp1NCCRP1, F-box associated domain containing18383508383838620Rat
1307705Pak4p21 (RAC1) activated kinase 418384990483889188Rat
1585399Acp7acid phosphatase 7, tartrate resistant18389648583923436Rat
1585397Rpsa-ps8ribosomal protein SA, pseudogene 818394033683942080Rat
11404862LOC108349512uncharacterized LOC10834951218396437183981022Rat
1563982Fbxo27F-box protein 2718396542683987781Rat
1308308Fbxo17F-box protein 1718400227684024455Rat
1306221Mrps12mitochondrial ribosomal protein S1218402589684028896Rat
1309456Sars2seryl-tRNA synthetase 2, mitochondrial18402897284040725Rat
7591166LOC102550248uncharacterized LOC10255024818403113784037136Rat
6502457Ccer2coiled-coil glutamate-rich protein 218404169784046225Rat
621887NfkbibNFKB inhibitor beta18404629284053862Rat
621481Sirt2sirtuin 218405388384076975Rat
1310133RinlRas and Rab interactor-like18407701184088590Rat
41126916LOC120099783uncharacterized LOC12009978318409297884095550Rat
71059Hnrnplheterogeneous nuclear ribonucleoprotein L18409855884111568Rat
69353Ech1enoyl-CoA hydratase 118411449484120788Rat
3003Lgals4galectin 418412349784132605Rat
61951Lgals7galectin 718414861284152016Rat
7578509LOC102550499uncharacterized LOC10255049918416493284178207Rat
1307341Capn12calpain 1218417105984183161Rat
61816Actn4actinin alpha 418418278384251867Rat
1309221Eif3keukaryotic translation initiation factor 3, subunit K18426012584270051Rat
41287174LOC120099785uncharacterized LOC12009978518426012884264519Rat
1305463Map4k1mitogen activated protein kinase kinase kinase kinase 118427095184292496Rat
1586637Ryr1ryanodine receptor 118429257884423799Rat
41212701LOC120099784uncharacterized LOC12009978418431906284323055Rat
41050885LOC120099786uncharacterized LOC12009978618433680184337582Rat
41263901LOC120099787uncharacterized LOC12009978718442293184429407Rat
620476Rasgrp4RAS guanyl releasing protein 418443303384452841Rat
1303117Fam98cfamily with sequence similarity 98, member C18445280684456414Rat
1311713Spred3sprouty-related, EVH1 domain containing 318445877984470425Rat
1306765Ggngametogenetin18447048884474120Rat
1309842Psmd8proteasome 26S subunit, non-ATPase 818447437784481209Rat
6498645Rpl27-ps2ribosomal protein L27, pseudogene 218448208784484504Rat
1310942Catspergcation channel sperm associated auxiliary subunit gamma18448872884519495Rat
621450Kcnk6potassium two pore domain channel subfamily K member 618452561384533948Rat
735199Yif1bYip1 interacting factor homolog B, membrane trafficking protein18453967384549906Rat
2319167LOC100361913rCG54286-like18454982784550786Rat
735123Spint2serine peptidase inhibitor, Kunitz type, 218455815984580616Rat
620536Ppp1r14aprotein phosphatase 1, regulatory (inhibitor) subunit 14A18458312784590743Rat
61868Dpf1double PHD fingers 118460221284615954Rat
1311432Sipa1l3signal-induced proliferation-associated 1 like 318461871484825956Rat
9407641Wdr87WD repeat domain 8718482628284845693Rat
7642645LOC102550982uncharacterized LOC10255098218484938384870079Rat
9082300LOC103689966MARCKS-related protein-like18491969884921260Rat
6501417Ube2n-ps3ubiquitin-conjugating enzyme E2N, pseudogene 318497185184972973Rat
41222556LOC120096976uncharacterized LOC12009697618498389184987197Rat
1309815Zfp84zinc finger protein 8418498735285015478Rat
150344952Zfp790zinc finger protein 420-like18503886785053325Rat
7627463Rpl4-ps4ribosomal protein L4, pseudogene 418505551685059159Rat
6485475LOC100912787zinc finger protein 850-like18506943285086477Rat
2323829Zfp420zinc finger protein 42018509281085143682Rat
2318958Zfp27zinc finger protein 2718511745585130578Rat
41205985LOC120096968uncharacterized LOC12009696818512183585128281Rat
1563223Zfp74zinc finger protein 7418515815985183407Rat
9264595LOC103691076uncharacterized LOC10369107618518319585194334Rat
11363847Zfp568zinc finger protein 56818520664385257759Rat
1559509Znf568l-ps1zinc finger protein 568 like, pseudogene 118522306085235034Rat
1560188Zfp14ZFP14 zinc finger protein18526864985286125Rat
6499485Zfp82zinc finger protein 8218529146285311265Rat
2325050LOC100359681DEAD (Asp-Glu-Ala-Asp) box polypeptide 1818531237185314713Rat
1563239Zfp566zinc finger protein 56618531844985342186Rat
41016838LOC120100358small nucleolar RNA SNORA518532302285323143Rat
621205Zfp260zinc finger protein 26018533656785349896Rat
41207861LOC120096966uncharacterized LOC12009696618534452385348533Rat
708385Zfp382zinc finger protein 38218537911885399667Rat
6484969Zfp382-ps1zinc finger protein 382, pseudogene 118539998185401864Rat
7630088Zfp146zinc finger protein 14618540957085421884Rat
41375603Ptma-ps5prothymosin alpha, pseudogene 518541440185414670Rat
6496527Cox7a1cytochrome c oxidase subunit 7A118542216285447530Rat
1584238Rps24-ps2ribosomal protein S24, pseudogene 218543353585438711Rat
2270Capns1calpain, small subunit 118544461385454861Rat
41052996LOC120100431U2 spliceosomal RNA18546031485460452Rat
40980061Rnu6-826RNA, U6 small nuclear 82618546832585468431Rat
1309965Tbcbtubulin folding cofactor B18547763985483488Rat
1309395Polr2iRNA polymerase II subunit I18548351585484952Rat
1583800Ovol3ovo-like zinc finger 318548495685488592Rat
1306714Wdr62WD repeat domain 6218549153185530643Rat
41258428LOC120096980uncharacterized LOC12009698018553610285547123Rat
7516055LOC102548322THAP domain-containing protein 8-like18554017285543782Rat
40947938LOC120093131integrin beta-like protein 118554071185543782Rat
1306245Clip3CAP-GLY domain containing linker protein 318554717085563187Rat
1566318Alkbh6alkB homolog 618556351185568977Rat
1304580Syne4spectrin repeat containing nuclear envelope family member 418556940985573775Rat
1562079Sdhaf1succinate dehydrogenase complex assembly factor 118557620785577156Rat
1305567Lrfn3leucine rich repeat and fibronectin type III domain containing 318561686285623725Rat
41252116Rnu2-57RNA, U2 small nuclear 5718561811085618290Rat
41232937LOC120096986uncharacterized LOC12009698618562467785626808Rat
11514383LOC108349559uncharacterized LOC10834955918564530185648643Rat
1586434Actg1-ps6actin, gamma 1, pseudogene 618565924485661088Rat
1303081Tyrobptransmembrane immune signaling adaptor Tyrobp18567293185676856Rat
1359238Hcsthematopoietic cell signal transducer18567697685679083Rat
1308055NfkbidNFKB inhibitor delta18567935385690415Rat
69257Aplp1amyloid beta precursor like protein 118569688085707215Rat
1308456Kirrel2kirre like nephrin family adhesion molecule 218570879385718670Rat
620460Nphs1NPHS1 adhesion molecule, nephrin18572081285749079Rat
1306761Prodh2proline dehydrogenase 218575355885767165Rat
1560986RGD1560986similar to Gene model 108218576931785776345Rat
2318374Arhgap33Rho GTPase activating protein 3318577611285789767Rat
41265200LOC120097050uncharacterized LOC12009705018578996885800659Rat
1565712Proser3proline and serine rich 318579336385806682Rat
621554Hspb6heat shock protein family B (small) member 618580689885809072Rat
1308901Lin37lin-37 DREAM MuvB core complex component18580906585813235Rat
1312037Psenenpresenilin enhancer gamma secretase subunit18581490585816654Rat
1305600U2af1l4U2 small nuclear RNA auxiliary factor 1-like 418581622585818462Rat
1563574Igflr1IGF-like family receptor 118581842885821032Rat
7678027Kmt2blysine methyltransferase 2B18582170085840987Rat
4888591Mir3569microRNA 356918584161685841691Rat
1584121Zbtb32zinc finger and BTB domain containing 3218584193185851116Rat
1309849Upk1auroplakin 1A18585967185870670Rat
1584097Cox6b1cytochrome c oxidase subunit 6B118587508085884081Rat
1310603Etv2ETS variant transcription factor 218589056285894025Rat
1306184Rbm42RNA binding motif protein 4218589861885908569Rat
2318093Haus5HAUS augmin-like complex, subunit 518591237185924327Rat
1582983LOC688924hypothetical protein LOC68892418592663885949890Rat
6487791LOC100912333uncharacterized LOC10091233318593122085931993Rat
2177Atp4aATPase H+/K+ transporting subunit alpha18596160785974972Rat
1304706Tmem147transmembrane protein 14718597702885978848Rat
620150Gapdhsglyceraldehyde-3-phosphate dehydrogenase, spermatogenic18597909685994153Rat
1562305Sbsnsuprabasin18597947786006034Rat
1561521Dmkndermokine18601323786031243Rat
71086Krtdapkeratinocyte differentiation associated protein18603829686041594Rat
2320881LOC100361079ribosomal protein L36-like18606252586062968Rat
1359614Ffar2free fatty acid receptor 218607186086075049Rat
7698901LOC102554169uncharacterized LOC10255416918608184586086504Rat
1311035Ffar3free fatty acid receptor 318610538886106728Rat
628613Ffar1free fatty acid receptor 118611136886112272Rat
1311610Cd22CD22 molecule18611637686132782Rat
7496170LOC102554355uncharacterized LOC10255435518614085686147671Rat
3035Magmyelin-associated glycoprotein18614822786163726Rat
11399620LOC108349549uncharacterized LOC10834954918615001286151717Rat
41169523LOC120099789uncharacterized LOC12009978918616126386163626Rat
41214661LOC120099788uncharacterized LOC12009978818616487986170417Rat
70971Hamphepcidin antimicrobial peptide18617092686172865Rat
620975Usf2upstream transcription factor 2, c-fos interacting18617470386185942Rat
69236Lsrlipolysis stimulated lipoprotein receptor18618576986201952Rat
1597448Fam187bfamily with sequence similarity 187, member B18620377986219542Rat
620827Fxyd5FXYD domain-containing ion transport regulator 518626793786277329Rat
620830Fxyd7FXYD domain-containing ion transport regulator 718627767886286954Rat
69306Fxyd1FXYD domain-containing ion transport regulator 118628716386291478Rat
735035Lgi4leucine-rich repeat LGI family, member 418629453986305909Rat
620825Fxyd3FXYD domain-containing ion transport regulator 318630553186312455Rat
61982Hpnhepsin18633708586352785Rat
3631Scn1bsodium voltage-gated channel beta subunit 118635391786363836Rat
1311022Gramd1aGRAM domain containing 1A18636700186393348Rat
11446352LOC108349560uncharacterized LOC10834956018643130286436167Rat
1561430RGD1561430similar to ABO histo-blood group B transferase18643908686442406Rat
1563307RGD1563307similar to Set beta isoform18644903686453703Rat
6499588Znf599l-ps1zinc finger protein 599 like, pseudogene 118645345186488053Rat
1549713Scgb1b24secretoglobin, family 1B, member 2418652134886522498Rat
1549752Scgb2b2secretoglobin, family 2B, member 218652803586530028Rat
1560154Scgb2b24secretoglobin, family 2B, member 2418658150486582416Rat
1596105Apbhandrogen-binding protein eta18658813786589425Rat
1583799Hsp90aa1-ps10heat shock protein 90 alpha family class A member 1, pseudogene 1018663359986636012Rat
1583798Kpna3-ps1karyopherin subunit alpha 3, pseudogene 118666586186667440Rat
1359129LOC494538ABP beta18670760286709529Rat
1311531Scgb1b30secretoglobin, family 1B, member 3018671751086718775Rat
1306411WtipWT1 interacting protein18673121486764939Rat
41332531LOC120100477small nucleolar RNA SNORA1118675870286758828Rat
1312023Uba2ubiquitin-like modifier activating enzyme 218677523986802685Rat
1589941Pdcd2lprogrammed cell death 2-like18681029286822554Rat
41279452Rpl21-ps24ribosomal protein L21, pseudogene 2418682504886826194Rat
2727Gpiglucose-6-phosphate isomerase18682821186856077Rat
1308428Garre1granule associated Rac and RHOG effector 118686212186939725Rat
11462101LOC10834972140S ribosomal protein S23 pseudogene18689675686902505Rat
41021046LOC120099790uncharacterized LOC12009979018694152386954785Rat
40942253LOC120099791uncharacterized LOC12009979118696272486966447Rat
1305695Lsm14aLSM14A mRNA processing body assembly factor18696480087009325Rat
40976798Trnas-aga33transfer RNA serine (anticodon AGA) 3318702847987028559Rat
41194726LOC120099792uncharacterized LOC12009979218717541287176845Rat
6495874LOC100910905uncharacterized LOC10091090518724982587251590Rat
1583737Kctd15potassium channel tetramerization domain containing 1518725865887271979Rat
1308979Chst8carbohydrate sulfotransferase 818729414487435900Rat
11502957LOC108349467uncharacterized LOC10834946718731898287324451Rat
1560088RGD1560088similar to NADH:ubiquinone oxidoreductase B15 subunit18747990287480329Rat
1594571Pepdpeptidase D18753665087681233Rat
41313338LOC120100411small nucleolar RNA SNORA1718757426087574391Rat
2330CebpgCCAAT/enhancer binding protein gamma18768306087692772Rat
7604390LOC102555648uncharacterized LOC10255564818769952187729062Rat
41376606LOC120099793uncharacterized LOC12009979318773173587735767Rat
2326CebpaCCAAT/enhancer binding protein alpha18775963187762303Rat
7703231LOC102555707uncharacterized LOC10255570718779216987800501Rat
7575724LOC102555770uncharacterized LOC10255577018780385387811246Rat
621672Slc7a10solute carrier family 7 member 1018782908487845073Rat
619729Lrp3LDL receptor related protein 318784381587859147Rat
41107959LOC120100450small nucleolar RNA SNORA1718786102287861136Rat
11358633Trnat-agu1transfer RNA threonine (anticodon AGU) 118788302487883097Rat
1560122Wdr88WD repeat domain 8818788431687924719Rat
1308935Gpatch1G patch domain containing 118792560687974544Rat
1583028LOC687679similar to small nuclear ribonucleoprotein polypeptide G18798265987983067Rat
1308366Rhpn2rhophilin, Rho GTPase binding protein 218799114488051902Rat
1564719Faap24FA core complex associated protein 2418805152388057997Rat
1311730Cep89centrosomal protein 8918805821188100114Rat
619905Slc7a9solute carrier family 7 member 918810951788132653Rat
1562792Tdrd12tudor domain containing 1218813327188205729Rat
11435664LOC10834943640S ribosomal protein S2 pseudogene18814039688141307Rat
1302935Nudt19nudix hydrolase 1918821447588226072Rat
1561747Rgs9bpregulator of G protein signaling 9 binding protein18824943888250151Rat
1307106Ankrd27ankyrin repeat domain 2718825121688303615Rat
1310561Pdcd5programmed cell death 518830586988311200Rat
1308334Dpy19l3dpy-19 like C-mannosyltransferase 318835030388417339Rat
1307017Zfp507zinc finger protein 50718843578788468577Rat
11390820LOC108349563uncharacterized LOC10834956318866079188701550Rat
11379739LOC108349564uncharacterized LOC10834956418938342289388116Rat
1306322Tshz3teashirt zinc finger homeobox 318938673289460719Rat
1562402RGD1562402similar to 60S ribosomal protein L27a18956303489563540Rat
1563363Zfp536zinc finger protein 53619000035990463423Rat
11504974LOC108349103uncharacterized LOC10834910319008786390105749Rat
41103001LOC120100175U6 spliceosomal RNA19051132190511424Rat
11418222LOC108349449uncharacterized LOC10834944919057378990605138Rat
1310358Uri1URI1, prefoldin-like chaperone19064639290704811Rat
11358405LOC108349566uncharacterized LOC10834956619070689690740913Rat
2294Ccne1cyclin E119078194790791188Rat
1591916Mrpl32-ps1mitochondrial ribosomal protein L32, pseudogene 119079444290798694Rat
41039507LOC120100209U7 small nuclear RNA19086153790861598Rat
1585208LOC690000similar to CG3740-PA19087354290887205Rat
41346041Rnu6-968RNA, U6 small nuclear 96819089044290890548Rat
1310544Plekhf1pleckstrin homology and FYVE domain containing 119090830490915862Rat
11381349LOC108349450uncharacterized LOC10834945019091046590926453Rat
11366552LOC108349756glyceraldehyde-3-phosphate dehydrogenase pseudogene19094057290941452Rat
41380789LOC120099794extracellular matrix protein FRAS1-like19094910190959890Rat
1305955Pop4POP4 homolog, ribonuclease P/MRP subunit19096002690968360Rat
1597141Marf1-ps1meiosis regulator and mRNA stability factor 1, pseudogene 119097255191027367Rat
1585163Uqcrb-ps1ubiquinol-cytochrome c reductase binding protein, pseudogene 119101732891017808Rat
9168486Rpl13a-ps3ribosomal protein L13A, pseudogene 319103627891036843Rat
1584053LOC690114hypothetical protein LOC69011419105646491063841Rat
41322932LOC120100155U6 spliceosomal RNA19106146191061567Rat
11436011LOC108348090zinc finger protein OZF-like19106390591111883Rat
1584044Caap1-ps1caspase activity and apoptosis inhibitor 1, pseudogene 119106999391077845Rat
1583796LOC365238similar to CG15432-PA19107958991083390Rat
7598618LOC102548014uncharacterized LOC10254801419110575891128497Rat
1584032Zfp939zinc finger protein 93919112835691142632Rat
7710512Zfp619zinc finger protein 61919114801691167628Rat
7683572LOC102548320zinc finger protein 845-like19117169791198293Rat
41041613Rnu6-856RNA, U6 small nuclear 85619119747691197582Rat
2318957Cdc42se2-ps1CDC42 small effector 2, pseudogene 119128744391288185Rat
10043390Rps27a-ps30ribosomal protein S27a, pseudogene 3019137172391372135Rat
41115833LOC120097732uncharacterized LOC12009773219151091991513005Rat
7505973LOC102548815uncharacterized LOC10254881519198240192029109Rat
11362874LOC108349567uncharacterized LOC10834956719202928892049949Rat
41231984LOC120099796uncharacterized LOC12009979619204473292051682Rat
7655999LOC102549042uncharacterized LOC10254904219205174392123537Rat
41333903LOC120099795uncharacterized LOC12009979519210862892206698Rat
40972134Trnap-cggtransfer RNA proline (anticodon CGG)19247162192471695Rat
11357821LOC108349455uncharacterized LOC10834945519248072492591739Rat
1306235Vstm2bV-set and transmembrane domain containing 2B19259207092620491Rat
1582848Etf1-ps2eukaryotic translation termination factor 1, pseudogene 219266128392668713Rat
1561885MGC114499similar to RIKEN cDNA 4930433I11 gene19267146192678000Rat
1582830C1h2orf78similar to human chromosome 2 open reading frame 7819274378892752219Rat
11361536C1h2orf78-ps2similar to human chromosome 2 open reading frame 78, pseudogene 219281940192822177Rat
1596303C1h2orf78-ps1similar to human chromosome 2 open reading frame 78, pseudogene 119282371492824634Rat
1582815LOC690299hypothetical protein LOC69029919284049592856281Rat
7704592Znf431l-ps8zinc finger protein 431 like, pseudogene 819288960692917697Rat
1593253Pgk1-ps5phosphoglycerate kinase 1, pseudogene 519289855092900078Rat
6486156Zfp936zinc finger protein 93619294305992949011Rat
2321930Grb2-ps1growth factor receptor bound protein 2, pseudogene 119301652893018833Rat
6485855LOC100912659zinc finger protein 709-like19301903793038483Rat
1597345Zfp141zinc finger protein 14119313057493164324Rat
7701959Zfp788zinc finger protein 78819317257593197706Rat
1597332Vom2r37vomeronasal 2 receptor, 3719325799393318774Rat
1565669Vom2r38vomeronasal 2 receptor, 3819335855093420097Rat
1596282Vmn2r116l-ps12vomeronasal 2, receptor 116 like, pseudogene 1219345631293545002Rat
41217347H2aj-ps1Histone H2A.J, pseudogene 119357763693581219Rat
41131410LOC120100171U6 spliceosomal RNA19359441593594521Rat
6485896LOC100912683zinc finger protein 709-like19360728693628363Rat
40990384Rnu6-658RNA, U6 small nuclear 65819361098493611083Rat
7555854LOC102556043zinc finger protein 120-like19365524793675372Rat
41207608LOC120099798interferon-stimulated 20 kDa exonuclease-like 219369267493701377Rat
1624201Zfp715zinc finger protein 71519370600593748131Rat
1305432Siglec5sialic acid binding Ig-like lectin 519376819093776696Rat
1307441Siglec10sialic acid binding Ig-like lectin 1019381730193826376Rat
7651195LOC102550061uncharacterized LOC10255006119382681793836987Rat
9101016C1h19orf84similar to human chromosome 19 open reading frame 8419383534693837316Rat
621482Lim2lens intrinsic membrane protein 219383759793843769Rat
621523Nkg7natural killer cell granule protein 719384474893845975Rat
1566413Cldnd2claudin domain containing 219384853393851693Rat
1303312Etfbelectron transfer flavoprotein subunit beta19385190893866072Rat
40994046LOC120099799uncharacterized LOC12009979919387125693874563Rat
1564982Vsig10lV-set and immunoglobulin domain containing 10 like19387148793880157Rat
1305344Iglon5IgLON family member 519388090693898929Rat
2324488Siglecl1SIGLEC family like 119390224493924811Rat
1596020Cd33CD33 molecule19393541893940452Rat
41326489LOC120099800uncharacterized LOC12009980019394311893954490Rat
7541917Zfp658zinc finger protein 65819399246794005689Rat
7510716Zfp719zinc finger protein 71919399801894027342Rat
1309564Zfp819zinc finger protein 81919402734794085649Rat
41099787LOC120099801uncharacterized LOC12009980119405836294073333Rat
41297840LOC120099802uncharacterized LOC12009980219408646494092553Rat
1563073Siglec8sialic acid binding Ig-like lectin 819409273794103134Rat
1308740Ctu1cytosolic thiouridylase subunit 119411543194121224Rat
1308606Klk14kallikrein related-peptidase 1419412313194137239Rat
41290328LOC120098456uncharacterized LOC12009845619412461594127467Rat
9202400LOC103691107NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4 pseudogene19414821794148671Rat
1309337Klk13kallikrein related-peptidase 1319416538194177002Rat
1308975Klk12kallikrein related-peptidase 1219422209894227637Rat
1308690Klk11kallikrein related-peptidase 1119422874194233281Rat
1303242Klk10kallikrein related-peptidase 1019423453694239369Rat
1308280Klk9kallikrein related-peptidase 919424633994250631Rat
1305998Klk8kallikrein related-peptidase 819425180394258646Rat
1306420Klk7kallikrein-related peptidase 719426717094271332Rat
3419Klk6kallikrein related-peptidase 619427886394286136Rat
1593461Klk5kallikrein related-peptidase 519429657494304768Rat
1303228Klk4kallikrein-related peptidase 419434460894348979Rat
1303192Klk1c12kallikrein 1-related peptidase C1219437810394382140Rat
11360787Klk5l-ps3kallikrein related-peptidase 5 like, pseudogene 319439464594397275Rat
1561403Klk1c10kallikrein 1-related peptidase C1019440299394407052Rat
7667275LOC102546874prostate-specific antigen-like19442608394428521Rat
2320113Klk1c4kallikrein 1-related peptidase C419443457494438678Rat
1303220Klk1c6kallikrein 1-related peptidase C619446763994475806Rat
7690508Klk5l-ps1kallikrein related-peptidase 5 like, pseudogene 119447831494489098Rat
3888Klk1c2kallikrein 1-related peptidase C219449233294496480Rat
1593397Klk15-ps3kallikrein-related peptidase 15, pseudogene 319449917794505830Rat
41389408LOC120098457kallikrein-2-like19451814894532064Rat
6485832Klk15-ps1kallikrein-related peptidase 15, pseudogene 119453388994545793Rat
1305359Klk1c8kallikrein 1-related peptidase C819454777494552287Rat
1598667Klk5lkallikrein related-peptidase 5 like19456668894571882Rat
7557829Klk15-ps2kallikrein-related peptidase 15, pseudogene 219458801894594577Rat
727805Klk1c9kallikrein 1-related peptidase C919459735994601245Rat
41248172Klk5l-ps2kallikrein related-peptidase 5 like, pseudogene 219460846594612477Rat
2969Klk1kallikrein 119464272294646714Rat
11400164LOC108349762kallikrein-1E2-like19465235394669527Rat
735032Klk1c3kallikrein 1-related peptidase C319467163694675417Rat
9170070LOC103691133prostate-specific antigen-like19468179094685589Rat
1310995Klk15kallikrein-related peptidase 1519469942294706626Rat
3175Klk1b3kallikrein 1-related peptidase B319470910594713308Rat
7636386LOC102552731uncharacterized LOC10255273119471361394730846Rat
7731725LOC102552485uncharacterized LOC10255248519471984694730038Rat
1309326Fv1Friend virus susceptibility 119473083994736791Rat
41292810Snord88csmall nucleolar RNA, C/D box 88C19473215594732245Rat
41012795LOC120100470small nucleolar RNA SNORD8819473429994734388Rat
41118856LOC120100471small nucleolar RNA SNORD8819473460494734693Rat
41364498Snord88bsmall nucleolar RNA, C/D box 88B19473493794735027Rat
1308270Acp4acid phosphatase 419473637694751871Rat
9421087Smim47small integral membrane protein 4719474463594746122Rat
7612505LOC102552286formyl peptide receptor-related sequence 4-like19474795394749932Rat
11496573Gpr32G protein-coupled receptor 3219475686394757895Rat
41154963Rpf1-ps1ribosome production factor 1, pseudogene 119479819794800311Rat
3627Clec11aC-type lectin domain containing 11A19480045694809002Rat
621011Shank1SH3 and multiple ankyrin repeat domains 119480787994857356Rat
1309036C1h19orf81simlar to human chromosome 19 open reading frame 8119485711594871519Rat
3805Syt3synaptotagmin 319488083594895518Rat
11388338LOC108349570uncharacterized LOC10834957019491568094923655Rat
1307121Lrrc4bleucine rich repeat containing 4B19492203494956309Rat
1310111Aspdhaspartate dehydrogenase domain containing19495632794960722Rat
1307305Josd2Josephin domain containing 219496086794964751Rat
40945041Trnaa-agc69transfer RNA alanine (anticodon AGC) 6919497229894972372Rat
6500871LOC100909904uncharacterized LOC10090990419497365794977869Rat
1303214Emc10ER membrane protein complex subunit 1019498026094988847Rat
1311142Garin5agolgi associated RAB2 interactor 5A19498895994995971Rat
1311596Mybpc2myosin binding protein C219499410495017650Rat
1565899SpibSpi-B transcription factor19501893995024804Rat
621839Pold1DNA polymerase delta 1, catalytic subunit19502546295041559Rat
41378320LOC120099804uncharacterized LOC12009980419503646495038103Rat
61906Nr1h2nuclear receptor subfamily 1, group H, member 219504196795047377Rat
61940Napsanapsin A aspartic peptidase19506472695077101Rat
621358Kcnc3potassium voltage-gated channel subfamily C member 319508096095095165Rat
1306821Myh14myosin heavy chain 1419509626695158861Rat
1563905Rpl19-ps23ribosomal protein L19, pseudogene 2319516357095164284Rat
1562619Izumo2IZUMO family member 219519645995209131Rat
1305084Zfp473zinc finger protein 47319522268395243328Rat
1549692Vrk3VRK serine/threonine kinase 319524334495270780Rat
628902Atf5activating transcription factor 519529560295299755Rat
619938Nup62nucleoporin 6219529899595314902Rat
1304831Il4i1interleukin 4 induced 119529945795324564Rat
1309686Tbc1d17TBC1 domain family, member 1719532477095333156Rat
1312049Akt1s1AKT1 substrate 119533318695339678Rat
1303331Pnkppolynucleotide kinase 3'-phosphatase19534146595346921Rat
1306977Ptov1PTOV1, extended AT-hook containing adaptor protein19534706595354514Rat
1305137Med25mediator complex subunit 2519535996195375827Rat
1310608Fuzfuzzy planar cell polarity protein19537954295384532Rat
1306254Ap2a1adaptor related protein complex 2 subunit alpha 119538430395414249Rat
41172425LOC120097118uncharacterized LOC12009711819540532695413983Rat
727784Tskstestis-specific serine kinase substrate19541431295441670Rat
41049276Trnap-agg45transfer RNA proline (anticodon AGG) 4519541589095415964Rat
1305384Cpt1ccarnitine palmitoyltransferase 1c19544281495457347Rat
62020Prmt1protein arginine methyltransferase 119545885395468176Rat
1307361Bcl2l12Bcl2 like 1219547227295480991Rat
1549774Irf3interferon regulatory factor 319547996695484926Rat
708405Scaf1SR-related CTD-associated factor 119548544895499389Rat
1311443RrasRAS related19550058295504362Rat
1309896Prr12proline rich 1219551001595534002Rat
1305444Prrg2proline rich and Gla domain 219553427695543364Rat
1309992Nosipnitric oxide synthase interacting protein19554332995559101Rat
1359365Rcn3reticulocalbin 319556450395573762Rat
61811FcgrtFc gamma receptor and transporter19557443695584171Rat
2325455Mir150microRNA 15019560502495605108Rat
41148932LOC120097122uncharacterized LOC12009712219560508895605871Rat
621026Rps11ribosomal protein S1119560569095607798Rat
41357901Snord35bsmall nucleolar RNA, C/D box 35B19560651095606596Rat
628697Rpl13aribosomal protein L13A19560937495612557Rat
41294442Snord35asmall nucleolar RNA, C/D box 35A19561018595610264Rat
40927059LOC120100340small nucleolar RNA SNORD3419561043295610498Rat
41332605Snord33small nucleolar RNA, C/D box 3319561069995610783Rat
41127338LOC120100339small nucleolar RNA Z195/SNORD33/SNORD32 family19561122295611304Rat
2322792Flt3lgFms related receptor tyrosine kinase 3 ligand19561505695620463Rat
1566295Aldh16a1aldehyde dehydrogenase 16 family, member A119562672795639808Rat
1309809Pih1d1PIH1 domain containing 119563959795645295Rat
620101Slc17a7solute carrier family 17 member 719564970995661591Rat
6500406Gfygolgi-associated, olfactory signaling regulator19566162195665300Rat
1559447Pth2parathyroid hormone 219566652595667174Rat
1561972Kash5KASH domain containing 519566891895691353Rat
1563523Dkkl1dickkopf like acrosomal protein 119569401095699259Rat
1593252Tead2TEA domain transcription factor 219570236695719186Rat
40979258LOC120097159uncharacterized LOC12009715919570437495707794Rat
62035Cd37CD37 molecule19571917195724662Rat
1561338Slc6a16solute carrier family 6, member 1619572169095750191Rat
1562492Slc6a21solute carrier family 6 member 2119575425795765854Rat
620244Trpm4transient receptor potential cation channel, subfamily M, member 419578180595812095Rat
727864Hrchistidine rich calcium binding protein19581326295816987Rat
620054Ppfia3PTPRF interacting protein alpha 319581711095845950Rat
41275464LOC120097162uncharacterized LOC12009716219584503395849118Rat
620730Lin7blin-7 homolog B, crumbs cell polarity complex component19584688895849628Rat
1307120Snrnp70small nuclear ribonucleoprotein U1 subunit 7019585603995876434Rat
1309632Kcna7potassium voltage-gated channel subfamily A member 719588607395891565Rat
3212Ntf4neurotrophin 419589356095896391Rat
3006Lhbluteinizing hormone subunit beta19589826995901973Rat
1306509Ruvbl2RuvB-like AAA ATPase 219590201495915364Rat
1589798Gys1glycogen synthase 119591544395935292Rat
61813Ftl1ferritin light chain 119593639095938234Rat
2192BaxBCL2 associated X, apoptosis regulator19594000195945407Rat
1588686Dhdhdihydrodiol dehydrogenase19595436195965262Rat
1310551Tulp2TUB like protein 219596249695999775Rat
620030Nucb1nucleobindin 119596832595999183Rat
621526Ppp1r15aprotein phosphatase 1, regulatory subunit 15A19600005396003128Rat
735133Plekha4pleckstrin homology domain containing A419600582496028826Rat
41252911Trnas-aga17transfer RNA serine (anticodon AGA) 1719601179096011864Rat
41004471LOC120097182uncharacterized LOC12009718219602475096033425Rat
1588673Hsd17b14hydroxysteroid (17-beta) dehydrogenase 1419602929096039088Rat
68948Bcat2branched chain amino acid transaminase 219604040796060008Rat
7628264LOC102556190uncharacterized LOC10255619019604107496047337Rat
40933693Trnap-gggtransfer RNA proline (anticodon GGG)19606763996067719Rat
620175Fgf21fibroblast growth factor 2119608349596084738Rat
2638Fut1fucosyltransferase 119608693496090352Rat
1565454Izumo1izumo sperm-oocyte fusion 119609081796096893Rat
9086567LOC103691112uncharacterized LOC10369111219609167296095896Rat
1305291Rasip1Ras interacting protein 119609707896109564Rat
1588652MamstrMEF2 activating motif and SAP domain containing transcriptional regulator19610971596116295Rat
2639Fut2fucosyltransferase 219611954996139567Rat
1562499Sec1secretory blood group 119614339096164249Rat
1565197Ntn5netrin 519615698596165997Rat
735155Car11carbonic anhydrase 1119616990096175191Rat
2491DbpD-box binding PAR bZIP transcription factor19617579696180745Rat
1307757Sphk2sphingosine kinase 219618087296188592Rat
621182Rpl18ribosomal protein L1819618881196191452Rat
1309316Fam83efamily with sequence similarity 83, member E19619158196201182Rat
1587464Spaca4sperm acrosome associated 419619551496196187Rat
1308882Sult2b1sulfotransferase family 2B member 119620015596261295Rat
41131359LOC120099805uncharacterized LOC12009980519620891396218323Rat
1588641Lmtk3lemur tyrosine kinase 319626105896280362Rat
620398Cyth2cytohesin 219628425296291090Rat
628872Kcnj14potassium inwardly-rectifying channel, subfamily J, member 1419629315996300810Rat
1310649Grwd1glutamate-rich WD repeat containing 119630126096306962Rat
2740Grin2dglutamate ionotropic receptor NMDA type subunit 2D19630687196346994Rat
1306764Kdelr1KDEL endoplasmic reticulum protein retention receptor 119634725896358145Rat
1307737Syngr4synaptogyrin 419635867996371840Rat
1305013Tmem143transmembrane protein 14319637193496387991Rat
621094Emp3epithelial membrane protein 319638865196391946Rat
1308141Odad1outer dynein arm docking complex subunit 119639213296420926Rat
620268Abcc6ATP binding cassette subfamily C member 619644722496501464Rat
1305240Nomo1Nodal modulator 119650546096556280Rat
1588614Ncr3lg1natural killer cell cytotoxicity receptor 3 ligand 119656566496581825Rat
7748347Epb41l5-ps1erythrocyte membrane protein band 4.1 like 5, pseudogene 119658515196588057Rat
69247Kcnj11potassium inwardly-rectifying channel, subfamily J, member 1119659104896594574Rat
3786Abcc8ATP binding cassette subfamily C member 819659866396679495Rat
1303329Ush1cUSH1 protein network component harmonin19669530396743671Rat
1306610Otogotogelin19674633696815416Rat
631429Myod1myogenic differentiation 119688486496887574Rat
40964065LOC120099806uncharacterized LOC12009980619689199996904056Rat
2955Kcnc1potassium voltage-gated channel subfamily C member 119690295396944744Rat
1563497Sergefsecretion regulating guanine nucleotide exchange factor19694966097152529Rat
41280435LOC120099807uncharacterized LOC12009980719706626697067508Rat
40952192LOC120099808uncharacterized LOC12009980819712204697126401Rat
3895Tph1tryptophan hydroxylase 119715737597178415Rat
1587443Saal1serum amyloid A-like 119719868597218131Rat
1594860Saa3serum amyloid A 319721870697222287Rat
41262615LOC120099810uncharacterized LOC12009981019723686397242294Rat
1307371Saa4serum amyloid A419724758097251882Rat
41378349LOC120099809serum amyloid A-5 protein-like19725763797259953Rat
1311916Hps5HPS5, biogenesis of lysosomal organelles complex 2 subunit 219728162697320945Rat
1308225Gtf2h1general transcription factor IIH subunit 119732140197349455Rat
7636379LOC102552634uncharacterized LOC10255263419734491797365236Rat
2996Ldhalactate dehydrogenase A19737182397381247Rat
41276984LOC120099811uncharacterized LOC12009981119738112397383728Rat
41230808LOC120099812uncharacterized LOC12009981219738377897386285Rat
69366Ldhclactate dehydrogenase C19738598497403382Rat
3909Tsg101tumor susceptibility 10119741268997442589Rat
1587416UevldUEV and lactate/malate dehyrogenase domains19745418897486004Rat
6491878LOC100911574uncharacterized LOC10091157419752264197528961Rat
2319415Spty2d1SPT2 chromatin protein domain containing 119753149597549633Rat
11453258LOC10834928260S ribosomal protein L7a pseudogene19756832397570107Rat
1305749Tmem86atransmembrane protein 86A19759591097600260Rat
11452860Igsf22immunoglobulin superfamily member 2219760193897618144Rat
3448Ptpn5protein tyrosine phosphatase, non-receptor type 519762063897681186Rat
41074683LOC120099813uncharacterized LOC12009981319769140697706639Rat
632282Mrgprx3MAS related GPR family member X319772037797746953Rat
2320229Set-ps1Set nuclear proto-oncogene, pseudogene 119775323397797449Rat
632284Mrgprx1MAS related GPR family member X119780609997807112Rat
738043Mrgprb4MAS-related GPR, member B419785270497853675Rat
738052Mrgprb5MAS-related G protein-coupled receptor, member B519795919397960254Rat
41352397Hmgb1-ps32high-mobility group box 1, pseudogene 3219797329497974178Rat
40977331Mrgprb4-ps1MAS-related GPR, member B4, pseudogene 119797848197980262Rat
2322541Mrgprb13-ps1MAS-related GPR, member B13, pseudogene 119800209198004379Rat
6486569Mrgprb13-ps2MAS-related GPR, member B13, pseudogene 219803228298033552Rat
738051Mrgprb13MAS-related GPR, member B1319804101398041999Rat
2320559LOC100361204mas-related G-protein coupled receptor member B8-like19804940998050395Rat
41298225LOC120093062mas-related G-protein coupled receptor member B8-like19805785298058838Rat
738048Mrgprx2MAS related GPR family member X219811619298135534Rat
738053Mrgprx2lMAS-related G protein-coupled receptor, member X2-like19818544198186385Rat
1583794Far1-ps1fatty acyl CoA reductase 1, pseudogene 119818881698190338Rat
1587398Mrgprb3MAS-related GPR, member B319827080098286263Rat
1560730RGD1560730similar to MrgB3 G protein-coupled receptor19837743398378401Rat
1591915Mrgprb2MAS-related GPR, member B219840114098403148Rat
1309736Zdhhc13zinc finger DHHC-type palmitoyltransferase 1319848730998525906Rat
71092Csrp3cysteine and glycine rich protein 319852806798546647Rat
1308091E2f8E2F transcription factor 819856571798584265Rat
2322090Ran-ps2RAN, member RAS oncogene family, pseudogene 219864557498655680Rat
41160684LOC120097191uncharacterized LOC12009719119878694098797373Rat
619778Nav2neuron navigator 219895762999322339Rat
41379051LOC120097195uncharacterized LOC12009719519897279298986217Rat
1308896Dbx1developing brain homeobox 119934960899354038Rat
7747342LOC102546796uncharacterized LOC10254679619941626999427141Rat
1309941Htatip2HIV-1 Tat interactive protein 219947341199488632Rat
620413Prmt3protein arginine methyltransferase 319949271299581774Rat
40939292LOC120100115U4 spliceosomal RNA19955785499557970Rat
41343058Gapdh-ps53Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 5319962205599623687Rat
621824Slc6a5solute carrier family 6 member 519964538999697016Rat
620998Nell1neural EGFL like 1199709305100573872Rat
41069108LOC120097222uncharacterized LOC12009722219982886399830975Rat
7736966LOC10255718260S ribosomal protein L31-like19998035899982992Rat
1642415LOC100125384hypothetical protein LOC1001253841100300241100301711Rat
41395739Nsa2-ps7NSA2 ribosome biogenesis factor, pseudogene 71100469200100469968Rat
41271806Trnaa-agc61transfer RNA alanine (anticodon AGC) 611100836137100836210Rat
6500416Ftl1-ps1ferritin light chain 1, pseudogene 11100923579100924459Rat
41060898LOC120099814uncharacterized LOC1200998141101052794101087616Rat
1564265Ano5anoctamin 51101086490101187547Rat
7709992Csde1-ps1cold shock domain containing E1, pseudogene 11101128263101131688Rat
620531Slc17a6solute carrier family 17 member 61101212489101252543Rat
1583792Rpl18a-ps4ribosomal protein L18A, pseudogene 41101322809101323617Rat
40935431LOC120099815uncharacterized LOC1200998151101354768101380898Rat
1561456FancfFA complementation group F1101449120101452361Rat
1563167Gas2growth arrest-specific 21101452361101582619Rat
1565432Svipsmall VCP interacting protein1101587128101592818Rat
1559980Ccdc179coiled-coil domain containing 1791101600369101604315Rat
41215033LOC120099816uncharacterized LOC1200998161101705741101715040Rat
1585077Stip1-ps1stress-induced phosphoprotein 1, pseudogene 11101898734101900378Rat
1583791Hspa8-ps2heat shock protein family A (Hsp70) member 8, pseudogene 21102046852102047546Rat
6498966Ybx1-ps5Y box binding protein 1, pseudogene 51102225955102229984Rat
1585067Trim25-ps1tripartite motif-containing 25, pseudogene 11102350230102400041Rat
41070218LOC120099817uncharacterized LOC1200998171102476477102497194Rat
2321314Atxn1-ps1ataxin 1, pseudogene 11102516795102517889Rat
41236487Dnajb6-ps3DnaJ heat shock protein family (Hsp40) member B6, pseudogene 31102565949102567063Rat
7730966LOC102552387uncharacterized LOC1025523871102647014102669486Rat
1585050Ybx1-ps11Y box binding protein 1, pseudogene 111102898503102915906Rat
40964929LOC120100151U6 spliceosomal RNA1103004250103004356Rat
41048269LOC120099818uncharacterized LOC1200998181103031956103034632Rat
11465891LOC108349461uncharacterized LOC1083494611103443363103460555Rat
7512548LOC102552153uncharacterized LOC1025521531103510363103575329Rat
7518732LOC102552287uncharacterized LOC1025522871103583677103601779Rat
41329310Dnajb6-ps5DnaJ heat shock protein family (Hsp40) member B6, pseudogene 51103619537103621184Rat
1593285Hspd1-ps7heat shock protein family D (Hsp60) member 1, pseudogene 71103645663103648170Rat
2320865Atxn1-ps2ataxin 1, pseudogene 21103672445103674674Rat
6496810Ecsit-ps1ECSIT signaling integrator, pseudogene 11104502481104503645Rat
41166428LOC120100376small nucleolar RNA SNORA2/SNORA34 family1104515030104515165Rat
41379493LOC120100278U1 spliceosomal RNA1104816658104816811Rat
2320676Clp1-ps1cleavage factor polyribonucleotide kinase subunit 1, pseudogene 11105449881105451267Rat
6496163Luzp2leucine zipper protein 21105597291105983605Rat
41029545LOC120099819uncharacterized LOC1200998191105731072105743435Rat
2320478Hsp90ab1-ps1heat shock protein 90 alpha family class B member 1, pseudogene 11105948734105951090Rat
41153489LOC120100164U6 spliceosomal RNA1105964547105964651Rat
11409293LOC108348964uncharacterized LOC1083489641106125962106135332Rat
1590913Slc25a5-ps3solute carrier family 25 member 5, pseudogene 31106191309106192280Rat
1591914Ccdc137-ps1coiled-coil domain containing 137, pseudogene 11106199727106208762Rat
11393548LOC10834888060S ribosomal protein L34 pseudogene1106354560106354913Rat
41347527Rnu6-1195RNA, U6 small nuclear 11951106391996106392102Rat
1583954Hnrnpa1-ps16heterogeneous nuclear ribonucleoprotein A1, pseudogene 161106395841106397127Rat
41093297LOC120100213U7 small nuclear RNA1106488765106488826Rat
41176983LOC120100210U7 small nuclear RNA1106488917106488976Rat
1310401Siglechsialic acid binding Ig-like lectin H1106593652106602749Rat
6491275Rhoq-ps1ras homolog family member Q, pseudogene 11106623061106624411Rat
1304689Tubgcp5tubulin, gamma complex associated protein 51106636526106672175Rat
6490831Dynll1-ps2dynein light chain LC8-type 1, pseudogene 21106682223106683617Rat
1310332Cyfip1cytoplasmic FMR1 interacting protein 11106710924106799393Rat
7716912Prdx3-ps1peroxiredoxin 3, pseudogene 11106775624106776566Rat
41202226LOC120100150U6 spliceosomal RNA1106789754106789860Rat
1306051Nipa2NIPA magnesium transporter 21106799979106824206Rat
11471669LOC108348727uncharacterized LOC1083487271106824340106838875Rat
1305401Nipa1NIPA magnesium transporter 11106834000106875148Rat
41287726LOC120099820uncharacterized LOC1200998201106874665106884693Rat
11360778LOC108349578uncharacterized LOC1083495781106891465106904101Rat
1307989Herc2HECT and RLD domain containing E3 ubiquitin protein ligase 21106904789107110997Rat
2318412Oca2OCA2 melanosomal transmembrane protein1107116278107446093Rat
1559691Dnmt3a-ps3DNA methyltransferase 3 alpha, pseudogene 31107153094107163738Rat
41284145Pole3-ps1DNA polymerase epsilon 3, accessory subunit, pseudogene 11107341034107356298Rat
621735Gabrg3gamma-aminobutyric acid type A receptor subunit gamma 31107627450108247483Rat
41269839Rpl6-ps17ribosomal protein L6, pseudogene 171107702837107711388Rat
41327125LOC120099822uncharacterized LOC1200998221108030936108068757Rat
61859Gabra5gamma-aminobutyric acid type A receptor subunit alpha 51108268728108381670Rat
1583906Sarnp-ps1SAP domain containing ribonucleoprotein, pseudogene 11108457981108458724Rat
2651Gabrb3gamma-aminobutyric acid type A receptor subunit beta 31108467047108702522Rat
41087592LOC120099823uncharacterized LOC1200998231108581448108596320Rat
1583789Hsdl1-ps1hydroxysteroid dehydrogenase like 1, pseudogene 11108780156108781131Rat
2319766Lias-ps2lipoic acid synthetase, pseudogene 21108802590108803356Rat
11422984LOC10834976860S ribosomal protein L29-like1108838092108838388Rat
41179831LOC120100444small nucleolar RNA SNORA171108932965108933098Rat
11495179LOC108353803uncharacterized LOC1083538031108947890108957080Rat
41061314LOC120100421small nucleolar RNA SNORA171109086517109086648Rat
41198576LOC120097768uncharacterized LOC1200977681109198620109204581Rat
11519974Trnae-uuc1transfer RNA glutamic acid (anticodon UUC) 11109313144109313215Rat
1306150Atp10aATPase phospholipid transporting 10A (putative)1109556760109730440Rat
41142333Odc1-ps8ornithine decarboxylase 1, pseudogene 81109953728109955186Rat
6488322LOC100912195protein BEX1-like1110047861110051812Rat
1306361Ube3aubiquitin protein ligase E3A1110070260110161675Rat
41393201LOC120097268uncharacterized LOC1200972681110123926110128015Rat
7676646LOC102548730uncharacterized LOC1025487301110158663110291293Rat
41253898LOC120100276small nucleolar RNA SNORD1151110178175110178252Rat
41033562LOC120100264small nucleolar RNA SNORD1151110180033110180111Rat
41268507LOC120100283small nucleolar RNA SNORD1151110182787110182865Rat
41234278LOC120100290small nucleolar RNA SNORD1151110184594110184670Rat
41297869LOC120100284small nucleolar RNA SNORD1151110186394110186471Rat
41079516LOC120100288small nucleolar RNA SNORD1151110189568110189645Rat
41042878LOC120100262small nucleolar RNA SNORD1151110190139110190216Rat
41158753LOC120100275small nucleolar RNA SNORD1151110193908110193985Rat
41185069LOC120100292small nucleolar RNA SNORD1151110197442110197520Rat
40953491LOC120100293small nucleolar RNA SNORD1151110200168110200253Rat
41123320LOC120100240small nucleolar RNA SNORD1151110208959110209036Rat
41110617LOC120100270small nucleolar RNA SNORD1151110210797110210874Rat
40943897LOC120100268small nucleolar RNA SNORD1151110212636110212713Rat
41130772LOC120100269small nucleolar RNA SNORD1151110214472110214549Rat
41104542LOC120100266small nucleolar RNA SNORD1151110223936110224013Rat
41345916LOC120100259small nucleolar RNA SNORD1151110225775110225852Rat
41338298LOC120100260small nucleolar RNA SNORD1151110227613110227690Rat
40983518LOC120100263small nucleolar RNA SNORD1151110236867110236944Rat
40982950LOC120100285small nucleolar RNA SNORD1151110238704110238780Rat
40973162LOC120100241small nucleolar RNA SNORD1151110240543110240620Rat
40943119LOC120100274small nucleolar RNA SNORD1151110242382110242458Rat
41015843LOC120100242small nucleolar RNA SNORD1151110244217110244294Rat
41303197LOC120100243small nucleolar RNA SNORD1151110246052110246129Rat
40973358LOC120100244small nucleolar RNA SNORD1151110247891110247968Rat
41236265LOC120100246small nucleolar RNA SNORD1151110249730110249807Rat
41324388LOC120100247small nucleolar RNA SNORD1151110251568110251645Rat
41317864LOC120100248small nucleolar RNA SNORD1151110253404110253481Rat
41206771LOC120100249small nucleolar RNA SNORD1151110255243110255320Rat
41113608LOC120100250small nucleolar RNA SNORD1151110257081110257158Rat
40966335LOC120100251small nucleolar RNA SNORD1151110258920110258997Rat
41073030LOC120100252small nucleolar RNA SNORD1151110260759110260836Rat
41322133LOC120100253small nucleolar RNA SNORD1151110267359110267436Rat
41323105LOC120100254small nucleolar RNA SNORD1151110269195110269271Rat
40983394LOC120100261small nucleolar RNA SNORD1151110271033110271110Rat
41304089LOC120100239small nucleolar RNA SNORD1151110272865110272942Rat
41309315LOC120100235small nucleolar RNA SNORD1151110274700110274777Rat
41016316LOC120100236small nucleolar RNA SNORD1151110283559110283636Rat
41214457LOC120100258small nucleolar RNA SNORD1151110285396110285473Rat
40983475LOC120100257small nucleolar RNA SNORD1151110287232110287309Rat
41335386LOC120100237small nucleolar RNA SNORD1151110289065110289142Rat
41113286LOC120100277small nucleolar RNA SNORD1151110290902110290979Rat
41321796LOC120100238small nucleolar RNA SNORD1151110292739110292816Rat
41338037LOC120100255small nucleolar RNA SNORD1151110294577110294654Rat
7660362LOC102551177uncharacterized LOC1025511771110294734111035350Rat
41279059LOC120100281small nucleolar RNA SNORD1151110296410110296487Rat
41357392LOC120100282small nucleolar RNA SNORD1151110299683110299760Rat
41202669LOC120100280small nucleolar RNA SNORD1151110301514110301588Rat
41148090LOC120100271small nucleolar RNA SNORD1151110303346110303423Rat
40943837LOC120100279small nucleolar RNA SNORD1151110305181110305258Rat
40979199LOC120100272small nucleolar RNA SNORD1151110307020110307096Rat
41166596LOC120100265small nucleolar RNA SNORD1151110308960110309037Rat
40941743LOC120100286small nucleolar RNA SNORD1151110311820110311899Rat
41247311LOC120100287small nucleolar RNA SNORD1151110313740110313816Rat
40996824LOC120100273small nucleolar RNA SNORD1151110315578110315662Rat
41108358LOC120100291small nucleolar RNA SNORD1151110322055110322131Rat
41396804LOC120100331small nucleolar RNA SNORD1161110462563110462655Rat
41023737LOC120100319small nucleolar RNA SNORD1161110467179110467271Rat
41084950LOC120100317small nucleolar RNA SNORD1161110469365110469457Rat
41235310LOC120100314small nucleolar RNA SNORD1161110477332110477424Rat
41356364LOC120100313small nucleolar RNA SNORD1161110479954110480046Rat
41015411LOC120100324small nucleolar RNA SNORD1161110482541110482633Rat
41081049LOC120100325small nucleolar RNA SNORD1161110485165110485257Rat
41119470LOC120100326small nucleolar RNA SNORD1161110487777110487869Rat
41077533LOC120100327small nucleolar RNA SNORD1161110490401110490493Rat
41397269LOC120100315small nucleolar RNA SNORD1161110492982110493074Rat
41200237LOC120100330small nucleolar RNA SNORD1161110495552110495645Rat
41064894LOC120100295small nucleolar RNA SNORD1161110498125110498217Rat
41345270LOC120100296small nucleolar RNA SNORD1161110946457110946549Rat
40987078LOC120100297small nucleolar RNA SNORD1161110949030110949122Rat
41311430LOC120100294small nucleolar RNA SNORD1161110951599110951691Rat
41103596LOC120100298small nucleolar RNA SNORD1161110954171110954263Rat
41142208LOC120100299small nucleolar RNA SNORD1161110956744110956836Rat
41107913LOC120100309small nucleolar RNA SNORD1161110959315110959407Rat
41233470LOC120100301small nucleolar RNA SNORD1161110961886110961978Rat
41296992LOC120100302small nucleolar RNA SNORD1161110964463110964555Rat
40928160LOC120100303small nucleolar RNA SNORD1161110967037110967129Rat
40946633LOC120100304small nucleolar RNA SNORD1161110969611110969703Rat
41218166LOC120100310small nucleolar RNA SNORD1161110972130110972222Rat
40971092LOC120100305small nucleolar RNA SNORD1161110974703110974795Rat
40927834LOC120100306small nucleolar RNA SNORD1161110977274110977366Rat
41012988LOC120100329small nucleolar RNA SNORD1161110979851110979943Rat
41211402LOC120100312small nucleolar RNA SNORD1161110982423110982515Rat
41342901LOC120100321small nucleolar RNA SNORD1161110985002110985094Rat
40943754LOC120100307small nucleolar RNA SNORD1161110987576110987668Rat
41366411LOC120100318small nucleolar RNA SNORD1161110990216110990308Rat
41224851LOC120100335small nucleolar RNA SNORD1161110992583110992674Rat
41354060LOC120100333small nucleolar RNA SNORD1161110995192110995284Rat
41085628LOC120100308small nucleolar RNA SNORD1161110997780110997872Rat
40938955LOC120100316small nucleolar RNA SNORD1161111000373111000465Rat
41176080LOC120100323small nucleolar RNA SNORD1161111002979111003070Rat
40999106LOC120100332small nucleolar RNA SNORD1161111005695111005787Rat
41337281LOC120100320small nucleolar RNA SNORD1161111014871111014964Rat
41122044LOC120100336small nucleolar RNA SNORD1161111034987111035076Rat
41296445LOC120100337small nucleolar RNA SNORD1161111037433111037527Rat
7677078LOC102547183uncharacterized LOC1025471831111060102111095607Rat
41266353Snord64small nucleolar RNA, C/D box 641111094909111094975Rat
41054606Snord107small nucleolar RNA, C/D box 1071111099306111099377Rat
621306Snrpnsmall nuclear ribonucleoprotein polypeptide N1111101327111123400Rat
69269SnurfSNRPN upstream open reading frame1111101327111123634Rat
9283938Rhog-ps3ras homolog family member G, pseudogene 31111125687111208473Rat
41084506LOC120099825uncharacterized LOC1200998251111424659111494106Rat
1583788Commd9-ps1COMM domain containing 9, pseudogene 11111426330111428933Rat
1561206RGD1561206similar to solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 191111433195111435231Rat
41047128LOC120099826uncharacterized LOC1200998261113454803113493548Rat
40956054LOC120100387U2 spliceosomal RNA1113515184113515344Rat
41324480LOC120099827uncharacterized LOC1200998271113551559113562494Rat
41279909LOC120099828uncharacterized LOC1200998281113610948113657836Rat
6503647Rbm4b-ps1RNA binding motif protein 4B, pseudogene 11113739597113740013Rat
7750416Mgat4a-ps1alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase A, pseudogene 11113857991113864613Rat
41382752LOC120099829uncharacterized LOC1200998291114066134114087090Rat
41239287LOC120099830uncharacterized LOC1200998301114155536114162109Rat
7634635LOC102555470uncharacterized LOC1025554701114294070114303084Rat
9198344LOC103691146uncharacterized LOC1036911461114303744114386780Rat
7650527LOC102555617uncharacterized LOC1025556171114440731114448803Rat
41248427LOC120099831uncharacterized LOC1200998311114615464114620387Rat
14398575Mir344b-2microRNA mir-344b-21114616603114616673Rat
4888550Mir344b-1microRNA 344b-11114623759114623856Rat
14398600Mir344b-3microRNA mir-344b-31114632635114632705Rat
7511549LOC102555775uncharacterized LOC1025557751114637762114649714Rat
7544339LOC102555866uncharacterized LOC1025558661114688298114932765Rat
41245754LOC120099832uncharacterized LOC1200998321114959031114995314Rat
41022847LOC120099833uncharacterized LOC1200998331115011988115017347Rat
41401400LOC120099834uncharacterized LOC1200998341115051743115085815Rat
4888565Mir344a-2microRNA 344a-21115243128115243234Rat
41270785LOC120099835uncharacterized LOC1200998351115260536115267750Rat
41247317LOC120099836uncharacterized LOC1200998361115277512115283051Rat
7580217Snrpb-ps1small nuclear ribonucleoprotein polypeptides B and B1, pseudogene 11115304693115305592Rat
2325614Mir344-1microRNA 344-11115306861115306958Rat
7489017Mir344gmicroRNA 344g1115343044115343122Rat
7489023Mir344imicroRNA 344i1115426210115426308Rat
7697895LOC102546835uncharacterized LOC1025468351115475057115720360Rat
7648907LOC102547415uncharacterized LOC1025474151115720505115726234Rat
41296176LOC120097775uncharacterized LOC1200977751115747262115755253Rat
1310526Ndnnecdin, MAGE family member1115849168115850767Rat
1583615Magel2MAGE family member L21115880137115884680Rat
1311197Mkrn3makorin, ring finger protein, 31115926774115929286Rat
1591913Traf7-ps1TNF receptor associated factor 7, pseudogene 11115943129115945159Rat
1307664Peg12paternally expressed 121115962511115965114Rat
1598109Morf4l1-ps7mortality factor 4 like 1, pseudogene 71115975577115976718Rat
1596870Zc3h11a-ps2zinc finger CCCH-type containing 11A, pseudogene 21116013406116016461Rat
1626035Vom2r-ps62vomeronasal 2 receptor, pseudogene 621116129167116157652Rat
1596829Nono-ps11non-POU domain containing, octamer-binding, pseudogene 111116258765116260805Rat
7545650LOC102548067uncharacterized LOC1025480671116271482116447353Rat
7631858Fbxw11-ps1F-box and WD repeat domain containing 11, pseudogene 11116428735116431543Rat
2348Chrna7cholinergic receptor nicotinic alpha 7 subunit1116715286116837223Rat
7728972LOC102548165uncharacterized LOC1025481651116963210116996324Rat
7508565LOC102548323uncharacterized LOC1025483231116995976117064301Rat
1563721Otud7aOTU deubiquitinase 7A1117064428117388217Rat
41013486Rpl36-ps8ribosomal protein L36, pseudogene1117148209117148529Rat
41304028LOC120097335high mobility group nucleosome-binding domain-containing protein 5-like1117222188117224158Rat
40957095Rpl7a-ps34ribosomal protein L7a, pseudogene 341117339434117347725Rat
1565099Klf13KLF transcription factor 131117505857117536626Rat
41322568LOC120100492small nucleolar RNA U31117570637117570845Rat
7625624LOC102548601uncharacterized LOC1025486011117601030117605930Rat
41212243LOC120099837uncharacterized LOC1200998371117663708117665914Rat
1597140Trpm1transient receptor potential cation channel, subfamily M, member 11117718896117835434Rat
2325549Mir211microRNA 2111117777539117777644Rat
1305958Mtmr10myotubularin related protein 101117859355117910839Rat
1566323Fan1FANCD2 and FANCI associated nuclease 11117915323117945044Rat
1307633Mphosph10M-phase phosphoprotein 101117948134117964149Rat
1309966Mceemethylmalonyl CoA epimerase1117964576117987779Rat
620845Apba2amyloid beta precursor protein binding family A member 21118053270118286858Rat
11360285LOC108349006uncharacterized LOC1083490061118086884118095930Rat
41008579LOC120097338uncharacterized LOC1200973381118247652118262726Rat
1592985Entrep2endosomal transmembrane epsin interactor 21118288365118700514Rat
1309206Nsmce3NSE3 homolog, SMC5-SMC6 complex component1118401302118402629Rat
41098464LOC120100402small nucleolar RNA SNORA481118424802118424943Rat
1592144Matr3-ps1matrin 3, pseudogene 11118609657118613368Rat
40950485Snx4-ps1sorting nexin 4, pseudogene 11118719465118723782Rat
41002066LOC120099839uncharacterized LOC1200998391118747408118781774Rat
1306305Tjp1tight junction protein 11118849838119094492Rat
41226711LOC120099840uncharacterized LOC1200998401118932104118936851Rat
41255323Trnap-agg47transfer RNA proline (anticodon AGG) 471118957548118957629Rat
7721677LOC102546680uncharacterized LOC1025466801119181972119185546Rat
41364047LOC120099841uncharacterized LOC1200998411119204501119209290Rat
1311308Tars3threonyl-tRNA synthetase 31119213189119265492Rat
1564929Tm2d3TM2 domain containing 31119264576119277099Rat
11463533LOC108349586uncharacterized LOC1083495861119287967119293388Rat
40929172LOC120099842uncharacterized LOC1200998421119297968119315737Rat
1590620Cwc15-ps1CWC15 spliceosome-associated protein, pseudogene 11119335619119336345Rat
7554390LOC102547214uncharacterized LOC1025472141119348252119351951Rat
7612387LOC102549305uncharacterized LOC1025493051119375739119389971Rat
7569258LOC102549468uncharacterized LOC1025494681119410495119429149Rat
3246Pcsk6proprotein convertase subtilisin/kexin type 61119428978119627626Rat
40974504Rps29-ps9ribosomal protein S29, pseudogene 91119451277119451561Rat
2320494Snrpa1small nuclear ribonucleoprotein polypeptide A'1119641402119654653Rat
628897Selenosselenoprotein S1119659779119669546Rat
1311904Chsy1chondroitin sulfate synthase 11119689626119750711Rat
7683193LOC102549532uncharacterized LOC1025495321119755503119777201Rat
7577468LOC102549616uncharacterized LOC1025496161119804731119844038Rat
1308000Lrrk1leucine-rich repeat kinase 11119844360119972885Rat
41136282LOC120100464small nucleolar RNA SNORA401119956733119956858Rat
628662Aldh1a3aldehyde dehydrogenase 1 family, member A31119982272120017416Rat
41034538Trnap-agg55transfer RNA proline (anticodon AGG) 551120030751120030832Rat
1305154Asb7ankyrin repeat and SOCS box-containing 71120222835120267411Rat
1308792Lins1lines homolog 11120267586120295013Rat
1564356Cers3ceramide synthase 31120316930120422926Rat
1308783Adamts17ADAM metallopeptidase with thrombospondin type 1 motif, 171120445800120768204Rat
41272992LOC120097339uncharacterized LOC1200973391120764055120770141Rat
40926109LOC120097340uncharacterized LOC1200973401120775852120778917Rat
1592887Lysmd4LysM domain containing 41120839178120845148Rat
1359360Mef2amyocyte enhancer factor 2a1120847874120982488Rat
9136205LOC103691157uncharacterized LOC1036911571121055568121061214Rat
1307209Lrrc28leucine rich repeat containing 281121116833121245805Rat
41296733LOC120100341small nucleolar RNA SNORA701121176393121176525Rat
1310409Ttc23tetratricopeptide repeat domain 231121245996121329500Rat
11432987LOC108349234uncharacterized LOC1083492341121251718121271532Rat
41178707LOC120099844uncharacterized LOC1200998441121313138121320010Rat
727872Synmsynemin1121333712121363652Rat
11416078Rps27-ps3ribosomal protein S27, pseudogene 31121382010121384687Rat
41261573Rpl29-ps9ribosomal protein L29, pseudogene 91121491251121497854Rat
11489695LOC108349848thymosin beta-10 pseudogene1121497670121498138Rat
41223203LOC120099845uncharacterized LOC1200998451121525414121534845Rat
2869Igf1rinsulin-like growth factor 1 receptor1121549839121838545Rat
1561859Pgpep1lpyroglutamyl-peptidase I-like1121835243121868368Rat
1585883Fam169bfamily with sequence similarity 169, member B1121878670121968272Rat
40999933LOC120100494U4 spliceosomal RNA1121936095121936219Rat
7740165LOC102551020uncharacterized LOC1025510201122088458122164766Rat
41207249LOC120099846uncharacterized LOC1200998461122107156122110562Rat
9273422Mrps18c-ps2mitochondrial ribosomal protein S18C, pseudogene 21122176761122177564Rat
7591504LOC102551255tetraspanin-7-like1122231176122236101Rat
1585733LOC682259similar to Tetraspanin-7 (Tspan-7) (Transmembrane 4 superfamily member 2) (Cell surface glycoprotein A15) (T-cell acute lymphoblastic leukemia-associated antigen 1) (TALLA-1) (Membrane component, X chromosome, surface marker 1) (CD231 antigen)...1122232825122233599Rat
41024969LOC120099847uncharacterized LOC1200998471122285441122312506Rat
1311763Arrdc4arrestin domain containing 41122369355122383351Rat
41143867LOC120099848uncharacterized LOC1200998481122441489122510976Rat
41347657LOC120099849uncharacterized LOC1200998491122862073122867551Rat
1332712Or5m12-ps1olfactory receptor family 5 subfamily M member 12, pseudogene 11123124716123125128Rat
40976304LOC120100448small nucleolar RNA SNORA171123620368123620504Rat
2323071Dcaf12-ps1DDB1 and CUL4 associated factor 12, pseudogene 11123731057123733750Rat
40931072LOC120099850uncharacterized LOC1200998501123918082123925951Rat
7683637LOC102553173uncharacterized LOC1025531731123943804123994246Rat
69305Nr2f2nuclear receptor subfamily 2, group F, member 21124008282124022521Rat
7661531LOC102553329uncharacterized LOC1025533291124017749124165290Rat
2322933Srsf7-ps1serine and arginine rich splicing factor 7, pseudogene 11124210206124239378Rat
11468718Rpl21-ps25ribosomal protein L21, pseudogene 251124344834124345343Rat
41237530LOC120100125U6 spliceosomal RNA1124419603124419709Rat
40953130LOC12009778560S ribosomal protein L27-like1124728576124728938Rat
41077517LOC120099851uncharacterized LOC1200998511124972989125042272Rat
1562967Mctp2multiple C2 and transmembrane domain containing 21125769932126002886Rat
7698364LOC102553828spermatogenesis-associated protein 13-like1126159731126164254Rat
41088730Trnaa-agc79transfer RNA alanine (anticodon AGC) 791126350554126350634Rat
9191646LOC103691162uncharacterized LOC1036911621126477043126482167Rat
1583787Mif-ps8macrophage migration inhibitory factor, pseudogene 81126777227126777631Rat
7634877LOC102554078uncharacterized LOC1025540781126851551126852404Rat
41344751LOC120099852uncharacterized LOC1200998521126926159126934246Rat
1311983Rgmarepulsive guidance molecule BMP co-receptor a1127128934127172918Rat
1310056Chd2chromodomain helicase DNA binding protein 21127188146127317041Rat
41219816LOC120099853uncharacterized LOC1200998531127336589127338218Rat
40975001LOC120099854uncharacterized LOC1200998541127347845127351622Rat
41143699LOC120099855uncharacterized LOC1200998551127368228127374172Rat
41330022LOC120099856uncharacterized LOC1200998561127413163127418868Rat
1583735Top1-ps1DNA topoisomerase 1, pseudogene 11127423431127432141Rat
9249251LOC103691177histone H2A.Z pseudogene1127473174127484619Rat
1596692Fam174bfamily with sequence similarity 174, member B1127515393127618591Rat
41117170LOC120099857uncharacterized LOC1200998571127569126127570853Rat
41389607Ipmk-ps1inositol polyphosphate multikinase, pseudogene 11127578732127592426Rat
41204376LOC120099858uncharacterized LOC1200998581127620887127636745Rat
1583786Rpl26-ps7ribosomal protein L26, pseudogene 71127659594127660098Rat
621843St8sia2ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 21127766669127838017Rat
41343720LOC120097791uncharacterized LOC1200977911127962107127984875Rat
41241885LOC120100156U1 spliceosomal RNA1128006617128006780Rat
2322257LOC100360396hypothetical protein LOC1003603961128028275128028907Rat
620227Slco3a1solute carrier organic anion transporter family, member 3a11128115184128387887Rat
41257043Actg1-ps11actin, gamma 1, pseudogene 111128530958128550705Rat
41089556Rpl13-ps4ribosomal protein L13, pseudogene 41128596532128600414Rat
619716Sv2bsynaptic vesicle glycoprotein 2b1128978471129152479Rat
727893Akap13A-kinase anchoring protein 131129313183129619647Rat
9322177LOC103691165uncharacterized LOC1036911651129637017129655422Rat
41175336Brix1-ps1biogenesis of ribosomes BRX1, pseudogene 11129680951129683336Rat
1310815Klhl25kelch-like family member 251129724894129750142Rat
11517459LOC10834984960S ribosomal protein L7a pseudogene1129755848129757145Rat
7709422Gapdh-ps69Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 691129758471129759490Rat
6495781LOC10091088860S ribosomal protein L36-like1129764986129765341Rat
41164166LOC120100400small nucleolar RNA SNORA481129979431129979573Rat
11397546LOC108349597uncharacterized LOC1083495971130040995130043791Rat
1560280Agbl1AGBL carboxypeptidase 11130043914130950739Rat
11411641LOC108349814high mobility group protein B1-like1130158350130158821Rat
2316393Vom1r-ps67vomeronasal 1 receptor pseudogene 671131058349131059234Rat
7537804LOC102553800uncharacterized LOC1025538001131429410131442617Rat
41303997LOC120099860uncharacterized LOC1200998601131469335131484623Rat
41138645Rnu1-18RNA, U1 small nuclear 181131845667131845829Rat
7676282LOC102553862uncharacterized LOC1025538621132019641132025235Rat
3214Ntrk3neurotrophic receptor tyrosine kinase 31132116472132503849Rat
41050960LOC120099861uncharacterized LOC1200998611132181245132187438Rat
9468236LOC103691168uncharacterized LOC1036911681132680421132684321Rat
1309123Mrpl46mitochondrial ribosomal protein L461132698872132707639Rat
1559901Mrps11mitochondrial ribosomal protein S111132707601132717253Rat
1309793Det1DET1 partner of COP1 E3 ubiquitin ligase1132749736132765963Rat
41003782LOC120099862uncharacterized LOC1200998621132785368132793311Rat
7500992LOC102547416uncharacterized LOC1025474161132796668132801878Rat
41247581LOC120099863uncharacterized LOC1200998631132800647132808007Rat
2325398Mir8microRNA 81132806420132806514Rat
1305051Aenapoptosis enhancing nuclease1132815094132824522Rat
1306407Isg20interferon stimulated exonuclease gene 201132829303132837027Rat
7742101LOC102547609uncharacterized LOC1025476091132868748132874634Rat
41129480LOC120097803uncharacterized LOC1200978031132925214132928678Rat
41179479LOC120099864uncharacterized LOC1200998641132956992132959786Rat
68358Acanaggrecan1132981034133044416Rat
1308098Hapln3hyaluronan and proteoglycan link protein 31133046465133064665Rat
3083Mfge8milk fat globule EGF and factor V/VIII domain containing1133064665133080069Rat
11436035Rpl27a-ps3ribosomal protein L27a,pseudogene 31133096265133099871Rat
1311389Abhd2abhydrolase domain containing 2, acylglycerol lipase1133217403133298564Rat
40958364LOC120100454U2 spliceosomal RNA1133230750133230898Rat
1309649Rlbp1retinaldehyde binding protein 11133308920133322296Rat
2321863FanciFA complementation group I1133327264133383661Rat
620057PolgDNA polymerase gamma, catalytic subunit1133382764133399578Rat
11503785Trnar-ucg1transfer RNA arginine (anticodon UCG) 11133399712133399784Rat
7692197LOC102547943uncharacterized LOC1025479431133414486133421488Rat
1592552LOC685596similar to ubiquinol-cytochrome c reductase binding protein1133425137133425500Rat
41312538Atp5mpl-ps1ATP synthase membrane subunit 6.8PL, pseudogene 11133428758133429123Rat
7530616LOC102555346homeobox protein unc-4 homolog1133431075133469302Rat
4888559Mir3597-3microRNA 3597-31133440038133440152Rat
2325463Mir9-3microRNA 9-31133440049133440138Rat
41179128LOC120099866uncharacterized LOC1200998661133470652133492131Rat
727859RhcgRh family, C glycoprotein1133531704133555902Rat
41279797Cul4b-ps1cullin 4B, pseudogene 11133574646133575249Rat
41068534LOC120099869uncharacterized LOC1200998691133590983133598028Rat
1308541TicrrTOPBP1-interacting checkpoint and replication regulator1133597618133639513Rat
1310310Kif7kinesin family member 71133639487133658539Rat
41320917Pin4-ps6peptidylprolyl cis/trans isomerase, NIMA-interacting 4, pseudogene 61133647167133647563Rat
40978721LOC120099868uncharacterized LOC1200998681133652575133654456Rat
3351Plin1perilipin 11133664294133676854Rat
619842Pex11aperoxisomal biogenesis factor 11 alpha1133680091133687172Rat
1559862Wdr93WD repeat domain 931133687254133737449Rat
2318883Snrpepl2small nuclear ribonucleoprotein polypeptide E like 21133709656133710137Rat
1311751Mesp1mesoderm posterior bHLH transcription factor 11133738357133739875Rat
1305959Mesp2mesoderm posterior bHLH transcription factor 21133756601133759207Rat
2991Anpepalanyl aminopeptidase, membrane1133767332133810137Rat
1586888Ap3s2adaptor related protein complex 3 subunit sigma 21133818825133859269Rat
1311021Arpinactin-related protein 2/3 complex inhibitor1133864288133873124Rat
41141871LOC120099870uncharacterized LOC1200998701133872984133879902Rat
1306491Zfp710zinc finger protein 7101133966256134036592Rat
1597139Idh2isocitrate dehydrogenase (NADP(+)) 21134038644134057969Rat
1589010Naa38-ps1N(alpha)-acetyltransferase 38, NatC auxiliary subunit, pseudogene 11134093191134093669Rat
7554600LOC102548818uncharacterized LOC1025488181134107741134110798Rat
7638459LOC102548889uncharacterized LOC1025488891134114350134128483Rat
1307872Sema4bsemaphorin 4B1134136646134177777Rat
620133Cib1calcium and integrin binding 11134178331134183895Rat
1560277Gdpgp1GDP-D-glucose phosphorylase 11134184095134193281Rat
7590296LOC102549117uncharacterized LOC1025491171134186182134213438Rat
1310399Ttll13tubulin tyrosine ligase like 131134197801134213083Rat
1583734Ngrnneugrin, neurite outgrowth associated1134213235134219348Rat
620644Vps33bVPS33B, late endosome and lysosome associated1134223967134247232Rat
1311754Prc1protein regulator of cytokinesis 11134250086134271765Rat
41200941LOC120100407small nucleolar RNA SNORA481134251885134252021Rat
1309901Rccd1RCC1 domain containing 11134271870134281556Rat
1305357Unc45aunc-45 myosin chaperone A1134281930134296661Rat
41042766LOC120099871protein shisa-like-1a1134296708134298626Rat
1311839Hddc3HD domain containing 31134299469134301757Rat
11501622LOC10834944660S ribosomal protein L35a pseudogene1134302904134303425Rat
1310238Man2a2mannosidase, alpha, class 2A, member 21134304714134327611Rat
1564385FesFES proto-oncogene, tyrosine kinase1134337698134346934Rat
7565709LOC102553801uncharacterized LOC1025538011134346919134348781Rat
3274Furinfurin (paired basic amino acid cleaving enzyme)1134348142134361182Rat
11462077LOC108349447uncharacterized LOC1083494471134385420134400570Rat
1308810BlmBLM RecQ like helicase1134409832134496073Rat
1309666Crtc3CREB regulated transcription coactivator 31134552830134655929Rat
9396007LOC103691178chromobox protein homolog 3 pseudogene1134672915134675115Rat
1311884Iqgap1IQ motif containing GTPase activating protein 11134679581134769776Rat
1584548Zscan2zinc finger and SCAN domain containing 21134833701134848957Rat
1306429Wdr73WD repeat domain 731134860329134868475Rat
1562710Nmbneuromedin B1134869446134875507Rat
41341028Rpl26l1-ps1ribosomal protein L26-like 1, pseudogene 11134875225134875637Rat
69360Sec11aSEC11 homolog A, signal peptidase complex subunit1134881448134909427Rat
1308705Zfp592zinc finger protein 5921134951286135002443Rat
1309860Alpk3alpha-kinase 31135014455135062294Rat
621223Slc28a1solute carrier family 28 member 11135079375135122791Rat
735125Pde8aphosphodiesterase 8A1135166143135288986Rat
41062554LOC120100372small nucleolar RNA SNORA441135195011135195135Rat
62027Rps17ribosomal protein S171135295920135298506Rat
1310421Cpeb1cytoplasmic polyadenylation element binding protein 11135300048135407688Rat
9383371Snrnp48-ps1small nuclear ribonucleoprotein U11/U12 subunit 48, pseudogene 11135339418135340186Rat
1308950Ap3b2adaptor related protein complex 3 subunit beta 21135412580135445191Rat
7609569LOC102555928uncharacterized LOC1025559281135445291135469930Rat
2321127LOC100360933cDNA sequence BC048679-like1135445623135449427Rat
1305167Fsd2fibronectin type III and SPRY domain containing 21135484002135522517Rat
7489047Scarna15small Cajal body-specific RNA 151135484620135484683Rat
41294589LOC120100468small nucleolar RNA SNORA761135499682135499825Rat
1563506WhammWASP homolog associated with actin, golgi membranes and microtubules1135526363135557091Rat
620705Homer2homer scaffold protein 21135558977135659780Rat
41049822Rnu6-946RNA, U6 small nuclear 9461135620777135620883Rat
1310022RamacRNA guanine-7 methyltransferase activating subunit1135708529135714417Rat
1305713C1h15orf40similar to human chromosome 15 open reading frame 401135725869135732136Rat
1310962Btbd1BTB domain containing 11135734549135773067Rat
1307978Tm6sf1transmembrane 6 superfamily member 11135782467135828443Rat
628773Hdgfl3HDGF like 31135822600135876719Rat
7643677LOC102556513uncharacterized LOC1025565131135894458135909734Rat
1309042Bnc1basonuclin 11135917676135943333Rat
620578Sh3gl3SH3 domain containing GRB2 like 3, endophilin A31136124502136255669Rat
9089371LOC103691176U6 snRNA-associated Sm-like protein LSm5 pseudogene1136277978136278822Rat
1305155Adamtsl3ADAMTS-like 31136288793136596986Rat
1562653Saxo2stabilizer of axonemal microtubules 21136596445136638445Rat
1306521Efl1elongation factor like GTPase 11136638527136763518Rat
41041741LOC120100361small nucleolar RNA SNORA151136662596136662746Rat
1306790Mex3bmex-3 RNA binding family member B1136855130136859365Rat
41391087LOC120097812uncharacterized LOC1200978121136871425136877196Rat
41110788LOC120099872uncharacterized LOC1200998721136914913136919922Rat
41341971LOC120100412small nucleolar RNA SNORA171136970981136971112Rat
1566271Rpl7-ps20ribosomal protein L7, pseudogene 201137123201137130636Rat
7510373LOC102552825uncharacterized LOC1025528251137282138137284054Rat
41019099LOC120100465U2 spliceosomal RNA1137371689137371783Rat
1308063Tmc3transmembrane channel-like 31137552347137597477Rat
1561783Stard5StAR-related lipid transfer domain containing 51137606151137616017Rat
1583872Il16interleukin 161137617702137718022Rat
40984706Snrpc-ps10small nuclear ribonucleoprotein polypeptide C, pseudogene 101137642550137643027Rat
1310371Cfap161cilia and flagella associated protein 1611137743783137768685Rat
2320729Rchy1-ps1ring finger and CHY zinc finger domain containing 1, pseudogene 11137830459137831886Rat
1311666Tlnrd1talin rod domain containing 11137864340137866359Rat
1310344Mesdmesoderm development LRP chaperone1137866707137879999Rat
1305254Cemipcell migration inducing hyaluronidase 11137906921138062430Rat
1308210Abhd17cabhydrolase domain containing 17C, depalmitoylase1138084632138125595Rat
41188763LOC120099874uncharacterized LOC1200998741138184016138185964Rat
11503776LOC108349102uncharacterized LOC1083491021138189940138213720Rat
2154Arnt2aryl hydrocarbon receptor nuclear translocator 21138236235138392868Rat
7557291Ctxnd1cortexin domain containing 11138495689138547105Rat
61932Fahfumarylacetoacetate hydrolase1138548830138571599Rat
1359317Zfand6zinc finger AN1-type containing 61138581002138652052Rat
41067967Rnu6-891RNA, U6 small nuclear 8911138601694138601800Rat
40982279Pnpla8-ps1patatin-like phospholipase domain containing 8, pseudogene 11138732722138759449Rat
1590363Or5ae2olfactory receptor family 5 subfamily AE member 21138804766138805713Rat
1334373Or5ae1olfactory receptor family 5 subfamily AE member 11138860924138861871Rat
6489367Vmn2r116l-ps26vomeronasal 2, receptor 116 like, pseudogene 261138892454138912931Rat
1626046Vom2r-ps63vomeronasal 2 receptor, pseudogene 631138892457138892798Rat
708406Vom2r40vomeronasal 2 receptor, 401139409429139457552Rat
1641977Vom2r-ps64vomeronasal 2 receptor, pseudogene 641139409799139410704Rat
7573144Vmn2r116l-ps29vomeronasal 2, receptor 116 like, pseudogene 291139496211139515315Rat
1587126Vom2r42vomeronasal 2 receptor, 421139549127139593601Rat
40985241Vmn2r116l-ps15vomeronasal 2, receptor 116 like, pseudogene 151139595637139617784Rat
6485222Vmn2r116l-ps1vomeronasal 2, receptor 116 like, pseudogene 11139671255139673942Rat
1587109LOC679574similar to putative pheromone receptor (Go-VN3)1139696920139763181Rat
1587090Vom2r43vomeronasal 2 receptor, 431139793253139815783Rat
1333584Or13g1olfactory receptor family 13 subfamily G member 11139864790139865713Rat
41189502LOC120099875uncharacterized LOC1200998751139870107139920602Rat
1334399Or6f1olfactory receptor family 6 subfamily F member 11139888779139889705Rat
1332929Or14a260olfactory receptor family 14 subfamily A member 2601139918531139919472Rat
1333967Or14c44b-ps1olfactory receptor family 14 subfamily C member 44B, pseudogene 11139937745139938682Rat
41147859Rpl29-ps8ribosomal protein L29, pseudogene 81139956373139958279Rat
1333647Or14a258olfactory receptor family 14 subfamily A member 2581139960934139961884Rat
1333998Or6aa1olfactory receptor family 6 subfamily A member A11139968839139969795Rat
1333037Or14c44-ps1olfactory receptor family 14 subfamily C member 44, pseudogene 11140004210140005185Rat
6499723Ldha-ps1lactate dehydrogenase A, pseudogene 11140009867140010890Rat
1333281Or6aa1bolfactory receptor family 6 subfamily A member A1B1140016536140017495Rat
6499943Ldha-ps12lactate dehydrogenase A, pseudogene 121140025282140027726Rat
41201666LOC120099876uncharacterized LOC1200998761140041222140055037Rat
1332905Or14n1olfactory receptor family 14 subfamily N member 11140064224140065216Rat
1332817Or14c48-ps1olfactory receptor family 14 subfamily C member 48, pseudogene 11140107028140108065Rat
1334240Or14c43b-ps1olfactory receptor family 14 subfamily C member 43B, pseudogene 11140139131140140070Rat
1332664Or14c43olfactory receptor family 14 subfamily C member 431140171652140172647Rat
2322334Cdca4-ps2cell division cycle associated 4, pseudogene 21140183390140192383Rat
1334267Or14a257dolfactory receptor family 14 subfamily A member 257D1140204646140205587Rat
1333809Or14c40olfactory receptor family 14 subfamily C member 401140234383140235375Rat
1333180Or14e1-ps1olfactory receptor family 14 subfamily E member 1, pseudogene 11140262826140263202Rat
1332768Or14a257olfactory receptor family 14 subfamily A member 2571140276678140277619Rat
9229744LOC10369119360S acidic ribosomal protein P1-like1140289186140294946Rat
41194366LOC120100356U2 spliceosomal RNA1140302978140303142Rat
1334427Or14f1-ps1olfactory receptor family 14 subfamily F member 1, pseudogene 11140305863140306292Rat
1334054Or14a257bolfactory receptor family 14 subfamily A member 257B1140313700140314707Rat
1333057Or14c39bolfactory receptor family 14 subfamily C member 39B1140329678140330607Rat
1332591Or14e2-ps1olfactory receptor family 14 subfamily E member 2, pseudogene 11140358793140359187Rat
1333387Or14a257colfactory receptor family 14 subfamily A member 257C1140365515140366522Rat
1334239Or14a261-ps1olfactory receptor family 14 subfamily A member 261, pseudogene 11140385246140385832Rat
1333763Or14c39olfactory receptor family 14 subfamily C member 391140414652140415590Rat
70963Folh1folate hydrolase 11140428101140501563Rat
9349711LOC103691192twinkle protein, mitochondrial pseudogene1140480642140482788Rat
1626013Vom2r-ps66vomeronasal 2 receptor, pseudogene 661140519846140520742Rat
1598125Vom2r-ps67vomeronasal 2 receptor, pseudogene 671140594546140625318Rat
7544215Vmn2r116l-ps27vomeronasal 2, receptor 116 like, pseudogene 271140688438140712736Rat
41380632LOC120100443U2 spliceosomal RNA1140724802140724998Rat
2321947Brcc3-ps2BRCA1/BRCA2-containing complex, subunit 3, pseudogene 21140762660140885589Rat
6498800Rps4x-ps10ribosomal protein S4, X-linked, pseudogene 101140897229140897968Rat
620600Nox4NADPH oxidase 41140900886141078844Rat
1589755Tyrtyrosinase1141115036141210207Rat
41336186LOC120100222U7 small nuclear RNA1141120935141120995Rat
41118317LOC120100220U7 small nuclear RNA1141121136141121197Rat
2746Grm5glutamate metabotropic receptor 51141310069141884980Rat
7572872Sf3a1-ps1splicing factor 3A subunit 1, pseudogene 11141432976141436428Rat
7748684Eif5-ps5eukaryotic translation initiation factor 5, pseudogene 51141500532141507333Rat
7641285LOC102554680uncharacterized LOC1025546801142018187142025944Rat
2445Ctsccathepsin C1142028386142059841Rat
41001342LOC120100413small nucleolar RNA SNORA171142114137142114268Rat
628752Rab38RAB38, member RAS oncogene family1142182566142262923Rat
1598293Pgk1-ps7phosphoglycerate kinase 1, pseudogene 71142700683142701985Rat
2324099Rps19-ps10ribosomal protein S19, pseudogene 101142882999142883492Rat
1309948Tmem135transmembrane protein 1351143006343143279824Rat
40974846LOC120099877uncharacterized LOC1200998771143084390143109270Rat
71017Fzd4frizzled class receptor 41143280065143288799Rat
41301263Ptp4a1-ps2protein tyrosine phosphatase 4A1, pseudogene 21143359417143360017Rat
1359545Prss23serine protease 231143402725143422182Rat
9273863LOC103691188uncharacterized LOC1036911881143422289143529944Rat
7550309LOC102549783uncharacterized LOC1025497831143533778143534759Rat
1311070Me3malic enzyme 31143534024143735551Rat
41362827LOC120099879uncharacterized LOC1200998791143604795143623271Rat
40940142LOC120099878uncharacterized LOC1200998781143707970143731710Rat
1306766Ccdc81coiled-coil domain containing 811143739472143791026Rat
11513757Envl-ps17MLV-related proviral Env polyprotein-like, pseudogene 171143803658143805876Rat
7625414LOC102549852ferritin light chain 1-like1143810386143811096Rat
1359455Hikeshiheat shock protein nuclear import factor hikeshi1143825922143849374Rat
1309782Eedembryonic ectoderm development1143867875143895008Rat
1598292Rnd2-ps1rho family GTPase 2, pseudogene 11143925214143926854Rat
41102144LOC120099881uncharacterized LOC1200998811143972005143976631Rat
41233713LOC120099880uncharacterized LOC1200998801143975541143984048Rat
7499284LOC102550036uncharacterized LOC1025500361144050618144056394Rat
621054Picalmphosphatidylinositol binding clathrin assembly protein1144056415144138045Rat
1594161Ccdc83coiled-coil domain containing 831144167993144225622Rat
40960636LOC120099882uncharacterized LOC1200998821144242152144268371Rat
1307647Sytl2synaptotagmin-like 21144272870144379310Rat
1305335Ccdc89coiled-coil domain containing 891144386252144387514Rat
1565584CrebzfCREB/ATF bZIP transcription factor1144416864144423540Rat
1305677Tmem126atransmembrane protein 126A1144422698144430730Rat
1308371Tmem126btransmembrane protein 126B1144437142144451508Rat
619895Dlg2discs large MAGUK scaffold protein 21144451653146503949Rat
41389181Rpl7a-ps35ribosomal protein L7a, pseudogene 351144480892144481649Rat
9393062Rps27a-ps26ribosomal protein S27a, pseudogene 261144896527144897046Rat
41118710LOC120100420U2 spliceosomal RNA1145145485145145580Rat
40975144LOC120097344uncharacterized LOC1200973441145457745145462979Rat
41025307LOC120097343uncharacterized LOC1200973431145498645145531228Rat
41218420LOC120100216U7 small nuclear RNA1146167994146168057Rat
41390298LOC120097342uncharacterized LOC1200973421146186005146268804Rat
11461101LOC10834928960S ribosomal protein L7a pseudogene1146399656146400987Rat
11515099Rbis-ps2ribosomal biogenesis factor, pseudogene 21146515667146515964Rat
1590921Dcaf8-ps1DDB1- and CUL4-associated factor 8, pseudogene 11146567388146579549Rat
6493379Dppa4-ps3developmental pluripotency-associated 4, pseudogene 31146603214146604124Rat
2320959Fam98a-ps1family with sequence similarity 98, member A, pseudogene 11146617903146620814Rat
1308637Ccdc90bcoiled-coil domain containing 90B1146632756146646314Rat
1310789Ankrd42ankyrin repeat domain 421146648080146691086Rat
1563397Pcf11PCF11 cleavage and polyadenylation factor subunit1146694045146724030Rat
1591721Pank1-ps1pantothenate kinase 1, pseudogene 11146724869146733032Rat
6487744Rps3a-ps1ribosomal protein S3a, pseudogene 11146750204146756584Rat
41049365LOC120099883uncharacterized LOC1200998831146764427146787935Rat
6489457LOC100912031uncharacterized LOC1009120311146790018146803474Rat
1309507Rab30RAB30, member RAS oncogene family1146803652146898369Rat
1559690DdiasDNA damage-induced apoptosis suppressor1146906150146930462Rat
41237199LOC120100343small nucleolar RNA SNORA701146918150146918259Rat
1307842Prcpprolylcarboxypeptidase1146931487146983891Rat
1590594Cep20-ps1centrosomal protein 20, pseudogene 11147104492147105471Rat
1564695Fam181bfamily with sequence similarity 181, member B1147166428147167925Rat
41142467LOC120099884uncharacterized LOC1200998841147175164147180920Rat
41197070LOC120100419small nucleolar RNA SNORA171147233100147233231Rat
41037345LOC120100425small nucleolar RNA SNORA171147306143147306271Rat
1598223Rpl3-ps4ribosomal protein L3, pseudogene 41147589211147590404Rat
41401628Ywhah-ps1tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta, pseudogene 11147982102148014119Rat
1593977Rpl21-ps17ribosomal protein L21, pseudogene 171148209812148210306Rat
41247838LOC120099885uncharacterized LOC1200998851148287195149046216Rat
41139098LOC120099886uncharacterized LOC1200998861148290068148297098Rat
11468141LOC10834896960S ribosomal protein L21 pseudogene1148529229148529711Rat
2320477Pdzd11-ps1PDZ domain containing 11, pseudogene 11148917133148917842Rat
41228858LOC120100184U6 spliceosomal RNA1149795907149796000Rat
1598291Rpl23a-ps7ribosomal protein L23a, pseudogene 71149862205149862727Rat
1304658Tenm4teneurin transmembrane protein 41149895097151263315Rat
2325357Mir708microRNA 7081150599876150599963Rat
41192708LOC120100172U6 spliceosomal RNA1151271287151271389Rat
1305145Nars2asparaginyl-tRNA synthetase 2, mitochondrial1151300446151412069Rat
40982081LOC120099887uncharacterized LOC1200998871151362133151367647Rat
11384002LOC108349194uncharacterized LOC1083491941151368864151379738Rat
621367Gab2GRB2-associated binding protein 21151429844151625708Rat
1565984Usp35ubiquitin specific peptidase 351151626195151649926Rat
1559529Kctd21potassium channel tetramerization domain containing 211151650074151669775Rat
7587865LOC102550214uncharacterized LOC1025502141151673275151677041Rat
1305468Alg8ALG8, alpha-1,3-glucosyltransferase1151684344151704310Rat
1307511Ndufc2NADH:ubiquinone oxidoreductase subunit C21151711965151718188Rat
3859Thrspthyroid hormone responsive1151723415151727740Rat
1562118Prdx1-ps2peroxiredoxin 1, pseudogene 21151735733151737057Rat
1306430Kctd14potassium channel tetramerization domain containing 141151761045151766693Rat
1305036Ints4integrator complex subunit 41151790062151853827Rat
1561459Aamdcadipogenesis associated, Mth938 domain containing1151861990151893621Rat
1311245Rsf1remodeling and spacing factor 11151892055152015089Rat
61884Clns1achloride nucleotide-sensitive channel 1A1152019369152039670Rat
7738972Rpl35-ps4ribosomal protein L35, pseudogene 41152027322152030883Rat
628763Aqp11aquaporin 111152046515152056675Rat
7711357LOC102550562uncharacterized LOC1025505621152076132152094061Rat
3250Pak1p21 (RAC1) activated kinase 11152111172152226390Rat
1585814Hmgb1-ps23high-mobility group box 1, pseudogene 231152133368152134001Rat
41299698Trnag-acc7transfer RNA glycine (anticodon ACC) 71152191930152192004Rat
1585799Gdpd4glycerophosphodiester phosphodiesterase domain containing 41152233516152342329Rat
1590920Pkm-ps7pyruvate kinase M1/2, pseudogene 71152275198152278499Rat
628830Myo7amyosin VIIA1152342611152414171Rat
620084Capn5calpain 51152416252152472923Rat
3231Ompolfactory marker protein1152440278152440828Rat
1310926B3gnt6UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 61152484572152496226Rat
1561254Acer3alkaline ceramidase 31152504180152606596Rat
1359311Tskutsukushi, small leucine rich proteoglycan1152660259152671682Rat
1559902RGD1559902similar to thioredoxin1152735541152735798Rat
69322Gucy2eguanylate cyclase 2E1152739775152774474Rat
1309087Lrrc32leucine rich repeat containing 321152785709152802997Rat
41243111LOC120100189U1 spliceosomal RNA1152804275152804439Rat
1583564tuba1c-ps2tubulin, alpha 1C, pseudogene 21152835411152837618Rat
1310712EmsyEMSY transcriptional repressor, BRCA2 interacting1152881485152960420Rat
1309679Thap12THAP domain containing 121153003605153019386Rat
11462765Trnap-ugg1transfer RNA proline (anticodon UGG) 11153114486153114557Rat
11408073Trnap-agg1transfer RNA proline (anticodon AGG) 11153114734153114805Rat
621463Wnt11Wnt family member 111153134503153154294Rat
1561870RGD1561870similar to ribosomal protein L271153154498153154902Rat
1589754UvragUV radiation resistance associated1153185356153442200Rat
41072504LOC120100452small nucleolar RNA SNORA171153237414153237538Rat
41358401LOC120099889uncharacterized LOC1200998891153441507153470272Rat
620329Dgat2diacylglycerol O-acyltransferase 21153454078153484432Rat
41027309LOC120099890uncharacterized LOC1200998901153484559153501045Rat
41161444LOC120099888uncharacterized LOC1200998881153504068153546167Rat
1598060Mogat2monoacylglycerol O-acyltransferase 21153521813153545756Rat
61804Map6microtubule-associated protein 61153568019153634415Rat
41054014LOC120099891uncharacterized LOC1200998911153570312153573747Rat
69302Serpinh1serpin family H member 11153643500153650853Rat
1559673Gdpd5glycerophosphodiester phosphodiesterase domain containing 51153679718153761452Rat
1565895Klhl35kelch-like family member 351153767138153773550Rat
619888Rps3ribosomal protein S31153778363153783663Rat
41322136Snord14bsmall nucleolar RNA, C/D box 14B1153779081153779225Rat
40952513Snord15asmall nucleolar RNA, C/D box 15A1153782788153782935Rat
6487804Ppid-ps5peptidylprolyl isomerase D, pseudogene 51153808461153838113Rat
2156Arrb1arrestin, beta 11153837964153912111Rat
2325623Mir326microRNA 3261153854029153854123Rat
1596774Tpbgltrophoblast glycoprotein-like1153922694153926690Rat
621391Slco2b1solute carrier organic anion transporter family, member 2b11153959288154007294Rat
1333428Olr35olfactory receptor 351153994678154043281Rat
1333325Olr36olfactory receptor 361154052762154053742Rat
1332982Or2at1olfactory receptor family 2 subfamily AT member 11154089219154090184Rat
619881Neu3neuraminidase 31154137732154148879Rat
7751286LOC102553078ubiquitin-like protein FUBI-like1154141530154141967Rat
1311253Spcs2signal peptidase complex subunit 21154163724154183152Rat
1305502Xrra1X-ray radiation resistance associated 11154183330154247883Rat
7585495LOC102547456uncharacterized LOC1025474561154197713154236133Rat
1583288Rnf169ring finger protein 1691154250462154311867Rat
41396935LOC120100366small nucleolar RNA SNORA201154286312154286441Rat
41334291Set-ps4Set nuclear proto-oncogene, pseudogene 41154329801154343007Rat
1306179Chrdl2chordin-like 21154343201154370651Rat
11383936Rpl23-ps3ribosomal protein L23,pseudogene 31154394804154395254Rat
1312027Pold3DNA polymerase delta 3, accessory subunit1154417893154456687Rat
1305211Lipt2lipoyl(octanoyl) transferase 21154504563154506890Rat
6488981LOC100912071uncharacterized LOC1009120711154515779154571371Rat
621384Kcne3potassium voltage-gated channel subfamily E regulatory subunit 31154523903154530865Rat
1583226Pgm2l1phosphoglucomutase 2-like 11154571410154620902Rat
735150P4ha3prolyl 4-hydroxylase subunit alpha 31154628723154663779Rat
1309683Ppme1protein phosphatase methylesterase 11154668099154715079Rat
1307366C2cd3C2 domain containing 3 centriole elongation regulator1154715151154812955Rat
41351837LOC120099892uncharacterized LOC1200998921154739519154741308Rat
3933Ucp3uncoupling protein 31154815777154828764Rat
3932Ucp2uncoupling protein 21154839242154845612Rat
1359131Dnajb13DnaJ heat shock protein family (Hsp40) member B131154848586154863042Rat
9145766LOC103691200uncharacterized LOC1036912001154849970154869633Rat
41335333LOC120099893uncharacterized LOC1200998931154865137154884266Rat
1562228Coa4cytochrome c oxidase assembly factor 4 homolog1154882199154885445Rat
41121717LOC120099894uncharacterized LOC1200998941154894181154898468Rat
1307576Mrpl48mitochondrial ribosomal protein L481154896663154939285Rat
41277301LOC120099895uncharacterized LOC1200998951154951711154957869Rat
619737Rab6aRAB6A, member RAS oncogene family1154957870155008922Rat
41255502LOC120100360small nucleolar RNA SNORA41154965714154965854Rat
621614Plekhb1pleckstrin homology domain containing B11154998798155013094Rat
1308929Fam168afamily with sequence similarity 168, member A1155057352155203439Rat
1305381ReltRELT, TNF receptor1155206976155224609Rat
1309890Arhgef17Rho guanine nucleotide exchange factor 171155230607155290581Rat
7489033Mir3102microRNA 31021155243756155243892Rat
620269P2ry6pyrimidinergic receptor P2Y61155295110155330610Rat
62088P2ry2purinergic receptor P2Y21155352050155367423Rat
11467824LOC108349453uncharacterized LOC1083494531155364155155379163Rat
40986524LOC120097346uncharacterized LOC1200973461155432265155458440Rat
1304812Fchsd2FCH and double SH3 domains 21155444471155685539Rat
41344265LOC12009734560S ribosomal protein L7a1155597343155598176Rat
1311400Atg16l2autophagy related 16-like 21155687386155703419Rat
7724903LOC102546541uncharacterized LOC1025465411155708280155718310Rat
1306548Stard10StAR-related lipid transfer domain containing 101155722637155748007Rat
1310385Arap1ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 11155748622155814186Rat
620965Pde2aphosphodiesterase 2A1155823590155915434Rat
41230170LOC120097347uncharacterized LOC1200973471155852256155853969Rat
2325383Mir139microRNA 1391155878828155878895Rat
41080214LOC120099897uncharacterized LOC1200998971155953421155981611Rat
3521Art2bADP-ribosyltransferase 2b1155956601155974252Rat
1598290Ldha-ps3lactate dehydrogenase A, pseudogene 31156017007156018106Rat
621328ClpbClpB family mitochondrial disaggregase1156028740156158183Rat
7606674LOC102547177uncharacterized LOC1025471771156162119156171192Rat
621323Phox2apaired-like homeobox 2a1156178754156183118Rat
68396Inppl1inositol polyphosphate phosphatase-like 11156183043156197500Rat
9227837LOC103691225putative uncharacterized protein1156196466156197649Rat
1308515Folr2folate receptor beta1156200044156218380Rat
7736376Rpl12-ps3ribosomal protein L12, pseudogene 31156208145156208657Rat
71032Folr1folate receptor alpha1156219460156238436Rat
1311634Anapc15anaphase promoting complex subunit 151156238640156266005Rat
1561509Lrtomtleucine rich transmembrane and O-methyltransferase domain containing1156266655156268704Rat
735078Lamtor1late endosomal/lysosomal adaptor, MAPK and MTOR activator 11156272116156277687Rat
1565856Lrrc51leucine rich repeat containing 511156278617156297838Rat
1308777Numa1nuclear mitotic apparatus protein 11156297907156372855Rat
41374762LOC120097349uncharacterized LOC1200973491156350633156351250Rat
41262137LOC120097348uncharacterized LOC1200973481156360541156366382Rat
620042Il18bpinterleukin 18 binding protein1156372923156374963Rat
1307857Rnf121ring finger protein 1211156377583156439923Rat
7692537Xndc1Xrcc1 N-terminal domain containing 11156440284156460609Rat
11499324LOC10834860560S ribosomal protein L7a pseudogene1156443692156444571Rat
628819Trpc2transient receptor potential cation channel subfamily C member 21156460009156473039Rat
628834Art5ADP-ribosyltransferase 51156473362156483324Rat
1304591Art1ADP-ribosyltransferase 11156478096156487172Rat
620142Chrna10cholinergic receptor nicotinic alpha 10 subunit1156487279156494277Rat
71033Nup98nucleoporin 98 and 96 precursor1156494423156591415Rat
11436026Gpx4-ps1glutathione peroxidase 4, pseudogene 11156569245156570007Rat
619744Pgap2post-GPI attachment to proteins 21156591540156618116Rat
621310Rhogras homolog family member G1156618713156630710Rat
11481264Rps29-ps1ribosomal protein S29, pseudogene 11156638258156638584Rat
1306831Stim1stromal interaction molecule 11156656246156818777Rat
9366670LOC103691224ribosome biogenesis protein NSA2 homolog pseudogene1156758473156773537Rat
1592569Rrm1ribonucleotide reductase catalytic subunit M11156823960156848262Rat
1333505Or55b3olfactory receptor family 55 subfamily B member 31156859322156860519Rat
1333356Or55b4olfactory receptor family 55 subfamily B member 41156866390156867379Rat
1334204Or55b10olfactory receptor family 55 subfamily B member 101156884142156885092Rat
41133992LOC120099898glyceraldehyde-3-phosphate dehydrogenase-like1156884450156934043Rat
1334081Or52b4olfactory receptor family 52 subfamily B member 41156939068156940009Rat
1334129Or52b3-ps1olfactory receptor family 52 subfamily B member 3, pseudogene 11156963553156964495Rat
1305795Trim21tripartite motif-containing 211156964896156987504Rat
1333514Or51r1olfactory receptor family 51 subfamily R member 11156998692156999642Rat
1333531Or52p2olfactory receptor family 52 subfamily P member 21157010581157011528Rat
1333028Or52k2olfactory receptor family 52 subfamily K member 21157026845157027798Rat
1333293Or52k1olfactory receptor family 52 subfamily K member 11157037381157038325Rat
1593913Bcl2l1-ps1Bcl2-like 1, pseudogene 11157042301157044415Rat
1334009Or52m2olfactory receptor family 52 subfamily M member 21157048003157048962Rat
1333547Or52m1olfactory receptor family 52 subfamily M member 11157065217157066170Rat
1593885Or51h1olfactory receptor family 51 subfamily H member 11157090324157091271Rat
1593877LOC684179similar to olfactory receptor 5561157105171157106151Rat
41296074Or52i2l-ps1olfactory receptor family 52 subfamily I member 2 like, pseudogene 11157112092157113068Rat
1593867Trim68tripartite motif containing 681157114044157127494Rat
1592737Or51d1olfactory receptor family 51 subfamily D member 11157134584157135641Rat
1332833Or51e1olfactory receptor family 51 subfamily E member 11157142232157151114Rat
1334421Or51a39-ps1olfactory receptor family 51 subfamily A member 39, pseudogene 11157152386157153348Rat
41091203LOC120097890olfactory receptor 51I2-like1157160337157161936Rat
1333377Or51a25bolfactory receptor family 51 subfamily A member 25B1157170104157171066Rat
1333240Or51a25olfactory receptor family 51 subfamily A member 251157179120157180082Rat
40970916LOC120100439small nucleolar RNA SNORA171157186339157186469Rat
628858Olr59olfactory receptor 591157193051157227707Rat
1333708Or51f23b-ps1olfactory receptor family 51 subfamily F member 23B, pseudogene 11157204792157205735Rat
1332953Or51f5olfactory receptor family 51 subfamily F member 51157224045157224989Rat
1333218Or51f23c-ps1olfactory receptor family 51 subfamily F member 23C, pseudogene 11157231467157232417Rat
1333535Olr55-psolfactory receptor pseudogene 551157236148157236449Rat
1333155Or51f23-ps1olfactory receptor family 51 subfamily F member 23, pseudogene 11157243704157244204Rat
1333228Or51f4olfactory receptor family 51 subfamily F member 41157257231157258175Rat
1593886Or51f1olfactory receptor family 51 subfamily F member 11157278651157279610Rat
9149734Or52r7olfactory receptor family 52 subfamily R member 71157284942157285649Rat
1332773Or51f2olfactory receptor family 51 subfamily F member 21157292342157293292Rat
1333662Or52r1olfactory receptor family 52 subfamily R member 11157301200157302174Rat
6485887Hmgb1-ps20high-mobility group box 1, pseudogene 201157313524157314172Rat
1333161Or51s1olfactory receptor family 51 subfamily S member 11157315393157316319Rat
1591447Or51h5olfactory receptor family 51 subfamily H member 51157348962157350022Rat
1591436LOC684376similar to olfactory receptor 5551157358640157363279Rat
1563481Or51t1olfactory receptor, family 51, subfamily T, member 11157370403157371434Rat
1333965Or51a6-ps1olfactory receptor family 51 subfamily A member 6, pseudogene 11157376150157377038Rat
1334397Or51a7olfactory receptor family 51 subfamily A member 71157395779157396717Rat
3207Nras-ps1neuroblastoma RAS viral (v-ras) oncogene homolog , pseudogene 11157404959157406216Rat
1333806Or51a7bolfactory receptor family 51 subfamily A member 7B1157415212157416180Rat
1332641Or51g2olfactory receptor family 51 subfamily G member 21157421637157422575Rat
1334292Or51g1olfactory receptor family 51 subfamily G member 11157438123157439064Rat
1334324Or51a45-ps1olfactory receptor family 51 subfamily A member 45, pseudogene 11157446294157447224Rat
1333720Or51a41olfactory receptor family 51 subfamily A member 411157454391157455398Rat
1333753Or51a5b-ps1olfactory receptor family 51 subfamily A member 5B, pseudogene 11157461693157462619Rat
1332815Or52r1colfactory receptor family 52 subfamily R member 1C1157475119157476063Rat
1332889Or51f1folfactory receptor family 51 subfamily F member 1F1157479786157484201Rat
1333966Or51a5-ps1olfactory receptor family 51 subfamily A member 5, pseudogene 11157495818157496386Rat
1334432Or51f1golfactory receptor family 51 subfamily F member 1G1157502544157503494Rat
1333532Or51l1olfactory receptor family 51 subfamily L member 11157516210157517157Rat
1589774Or51p1olfactory receptor family 51 subfamily P member 11157523148157524089Rat
1334015Or52e2olfactory receptor family 52 subfamily E member 21157561070157562023Rat
1332721Or52j3bolfactory receptor family 52 subfamily J member 3B1157572005157572943Rat
1333176Or52s1bolfactory receptor family 52 subfamily S member 1B1157587391157589170Rat
1333934Or52j3olfactory receptor family 52 subfamily J member 31157605177157606115Rat
1333158Or52s1olfactory receptor family 52 subfamily S member 11157619852157620835Rat
1333207Or52e3olfactory receptor family 52 subfamily E member 31157626717157627652Rat
1333697Or52e51olfactory receptor family 52 subfamily E member 511157656899157657837Rat
1332971Or52e19olfactory receptor family 52 subfamily E member 191157668879157669817Rat
1333956Or52ab2olfactory receptor family 52 subfamily AB member 21157681873157682820Rat
1333865Or52ab2bolfactory receptor family 52 subfamily AB member 2B1157689725157690675Rat
1333469Or52ad1b-ps1olfactory receptor family 52 subfamily AD member 1B, pseudogene 11157702587157703531Rat
1333576Or52ab4olfactory receptor family 52 subfamily AB member 41157725793157726740Rat
1333961Or52ad1olfactory receptor family 52 subfamily AD member 11157733568157734512Rat
1333424Or52s19olfactory receptor family 52 subfamily S member 191157742232157743176Rat
1333794Or52s20olfactory receptor family 52 subfamily S member 201157748451157749422Rat
1333223Or52s6olfactory receptor family 52 subfamily S member 61157756757157757701Rat
1333486Or51l14olfactory receptor family 51 subfamily L member 141157767340157768296Rat
1333983Or52d13olfactory receptor family 52 subfamily D member 131157778486157782381Rat
1334262Or52ae7bolfactory receptor family 52 subfamily AE member 7B1157797762157798709Rat
1333117Or51af1b-ps1olfactory receptor family 51 subfamily AF member 1B, pseudogene 11157804670157805625Rat
1333043Olr100-psolfactory receptor pseudogene 1001157813825157814045Rat
1333874Or52ae10olfactory receptor family 52 subfamily AE member 101157824326157825276Rat
1333432Or51af1c-ps1olfactory receptor family 51 subfamily AF member 1C, pseudogene 11157832733157833688Rat
1333435Or52ae7olfactory receptor family 52 subfamily AE member 71157853355157854305Rat
1333997Or51af1olfactory receptor family 51 subfamily AF member 11157864549157865508Rat
1333791Or51ag1olfactory receptor family 51 subfamily AG member 11157878427157879374Rat
1334302Or51aa2olfactory receptor family 51 subfamily AA member 21157888966157889937Rat
1334037Or51ab3olfactory receptor family 51 subfamily AB member 31157901417157902370Rat
1332894Or51ah3olfactory receptor family 51 subfamily AH member 31157917326157918267Rat
1333707Or51ac3olfactory receptor family 51 subfamily AC member 31157921167157922120Rat
41254060LOC120100375small nucleolar RNA SNORA2/SNORA34 family1157930780157930915Rat
1333316Or52z12olfactory receptor family 52 subfamily Z member 121157933667157934632Rat
1333560Or52z13olfactory receptor family 52 subfamily Z member 131157958861157959808Rat
1334238Or52z14olfactory receptor family 52 subfamily Z member 141157970990157971952Rat
1333416Or51v14olfactory receptor family 51 subfamily V member 141157980431157981372Rat
1334390Or51v8bolfactory receptor family 51 subfamily V member 8B1157987781157988725Rat
1334316Or52ae8olfactory receptor family 52 subfamily AE member 81158002968158003921Rat
1598222Nrbf2-ps1nuclear receptor binding factor 2, pseudogene 11158017949158018810Rat
1333820Or51b6c-ps1olfactory receptor family 51 subfamily B member 6C, pseudogene 11158025825158026778Rat
1332852Or51v17-ps1olfactory receptor family 51 subfamily V member 17, pseudogene 11158033824158034857Rat
1333589Or52z15-ps1olfactory receptor family 52 subfamily Z member 15, pseudogene 11158058298158059264Rat
1334425Or51b6bolfactory receptor family 51 subfamily B member 6B1158072748158073701Rat
1334212Or51v8olfactory receptor family 51 subfamily V member 81158080680158081624Rat
1332659Or52ae8bolfactory receptor family 52 subfamily AE member 8B1158097260158098213Rat
1334424Or52a20olfactory receptor family 52 subfamily A member 201158108489158109439Rat
2319730LOC100361642olfactory receptor Olr122-like1158123097158125018Rat
1333546Or52ae9olfactory receptor family 52 subfamily AE member 91158130946158131893Rat
1332630Or51l4olfactory receptor family 51 subfamily L member 41158146732158147691Rat
1333008Or52a5bolfactory receptor family 52 subfamily A member 5B1158160904158161854Rat
1333141Or52a5olfactory receptor family 52 subfamily A member 51158182988158183935Rat
1334327Or52z1olfactory receptor family 52 subfamily Z member 11158206284158207246Rat
1597422Hbb-bshemoglobin, beta adult s chain1158218356158219722Rat
1595848Hbb-b1hemoglobin, beta adult major chain1158224175158231675Rat
2290038LOC100134871beta globin minor gene1158236972158238348Rat
41201883Hbb-b2hemoglobin, beta adult minor chain1158243696158245091Rat
2783Hbbhemoglobin subunit beta1158250421158251832Rat
1591909Hbe1l-ps1hemoglobin subunit epsilon 1 like, pseudogene 11158266601158267985Rat
620306Hbg1hemoglobin subunit gamma 11158271993158273371Rat
1564524Hbe2hemoglobin, epsilon 21158279285158280913Rat
1305115Hbe1hemoglobin subunit epsilon 11158282931158458855Rat
1332980Or51b4bolfactory receptor family 51 subfamily B member 4B1158308648158309583Rat
1333816Or51b4olfactory receptor family 51 subfamily B member 41158317228158318151Rat
1333394Or51b17olfactory receptor family 51 subfamily B member 171158327466158328389Rat
1333371Or51b6olfactory receptor family 51 subfamily B member 61158347649158348596Rat
1332595Or51m1-ps1olfactory receptor family 51 subfamily M member 1, pseudogene 11158367523158368480Rat
1333257Olr134-psolfactory receptor pseudogene 1341158382033158382413Rat
1334260Or51k2olfactory receptor family 51 subfamily K member 21158389143158390081Rat
1333481Or51k7olfactory receptor family 51 subfamily K member 71158401733158402686Rat
1596113Tmed5-ps1transmembrane p24 trafficking protein 5, pseudogene 11158424491158425578Rat
1334354Or51q1dolfactory receptor family 51 subfamily Q member 1D1158426462158427427Rat
1333984Or51k1b-ps1olfactory receptor family 51 subfamily K member 1B, pseudogene 11158432453158433446Rat
40953947LOC120099899MLV-related proviral Env polyprotein-like1158445311158447321Rat
1333861Or51q1olfactory receptor family 51 subfamily Q member 11158456134158457081Rat
1594809Snx12-ps1sorting nexin 12, pseudogene 11158460071158460615Rat
1334277Or51q1eolfactory receptor family 51 subfamily Q member 1E1158482153158483100Rat
1332931Or51k1olfactory receptor family 51 subfamily K member 11158486849158487799Rat
1334127Or51i1olfactory receptor family 51 subfamily I member 11158502581158503525Rat
1332767Or51i2olfactory receptor family 51 subfamily I member 21158513673158514611Rat
1333953Or51a10olfactory receptor family 51 subfamily A member 101158520743158521687Rat
1333379Or51a42olfactory receptor family 51 subfamily A member 421158542552158543496Rat
1334175Or51a24-ps1olfactory receptor family 51 subfamily A member 24, pseudogene 11158552371158553319Rat
1334236Or52d1b-ps1olfactory receptor family 52 subfamily D member 1B, pseudogene 11158565007158565881Rat
1333972Or52d1olfactory receptor family 52 subfamily D member 11158578401158579372Rat
1562433RGD1562433similar to ubiquilin 1 isoform 21158592368158594244Rat
1304920Ubqln3ubiquilin 31158604629158607318Rat
1307202Ubqlnlubiquilin-like1158615177158617426Rat
1310717Olfm5olfactomedin 51158620451158628289Rat
1333715Or52h1olfactory receptor family 52 subfamily H member 11158644763158645713Rat
1333444Or52h2olfactory receptor family 52 subfamily H member 21158659293158660225Rat
11417296LOC10834845860S ribosomal protein L36 pseudogene1158665098158665484Rat
1333202Or52b6-ps1olfactory receptor family 52 subfamily B member 6, pseudogene 11158675191158676157Rat
1310896Trim6tripartite motif containing 61158683746158696936Rat
7240857Trim34tripartite motif-containing 341158707172158720214Rat
1304579Trim5tripartite motif-containing 51158720407158737393Rat
7617624Trim30al-ps1tripartite motif-containing 30A like, pseudogene 11158740434158748386Rat
1566132Trim30ctripartite motif-containing 30C1158766401158787915Rat
40978348G3bp1-ps1G3BP stress granule assembly factor 1, pseudogene 11158768853158770150Rat
1563970Trim30dtripartite motif-containing 30D1158795288158813913Rat
1598221Eef1a1-ps4eukaryotic translation elongation factor 1 alpha 1, pseudogene 41158819049158820377Rat
1333771Or52h9olfactory receptor family 52 subfamily H member 91158826164158827105Rat
1332939Or52h7olfactory receptor family 52 subfamily H member 71158835924158836898Rat
1333320Or52d3olfactory receptor family 52 subfamily D member 31158849336158850289Rat
1332954Or52u1olfactory receptor family 52 subfamily U member 11158863988158864959Rat
1332984Or52ac1olfactory receptor family 52 subfamily AC member 11158871618158872517Rat
1334093Or52p1olfactory receptor family 52 subfamily P member 11158889800158890789Rat
1334411Or56b1olfactory receptor family 56 subfamily B member 11158910597158911556Rat
1333201Or52n4olfactory receptor family 52 subfamily N member 41158919013158919978Rat
1334089Or52n20olfactory receptor family 52 subfamily N member 201158933757158934725Rat
1333757Or56b2olfactory receptor family 56 subfamily B member 21158943205158944164Rat
1333452Or56b2bolfactory receptor family 56 subfamily B member 2B1158956989158957948Rat
1333167Or52n4colfactory receptor family 52 subfamily N member 4C1158972002158972967Rat
41272412LOC120097921ubiquitin carboxyl-terminal hydrolase 17-like protein D1158993774158995929Rat
1333818Or52n1bolfactory receptor family 52 subfamily N member 1B1159015174159016139Rat
1332871Or52n4eolfactory receptor family 52 subfamily N member 4E1159042896159043864Rat
1334090Or56b37-ps1olfactory receptor family 56 subfamily B member 37, pseudogene 11159068812159069569Rat
1332985Or56b2kolfactory receptor family 56 subfamily B member 2K1159075031159077896Rat
41141466LOC120100117U4 spliceosomal RNA1159079697159079847Rat
1333841Or52n4dolfactory receptor family 52 subfamily N member 4D1159108148159109107Rat
1333881Or52n1olfactory receptor family 52 subfamily N member 11159128222159129187Rat
6500127LOC100910107ubiquitin carboxyl-terminal hydrolase DUB-1-like1159151417159155192Rat
41094097LOC120098473ubiquitin carboxyl-terminal hydrolase 17-like protein D1159158689159162463Rat
41059698LOC120098474ubiquitin carboxyl-terminal hydrolase 17-like protein D1159165961159169738Rat
1588758LOC689730similar to ubiquitin specific peptidase 17 (homolog)1159173249159182920Rat
1333974Or52n3olfactory receptor family 52 subfamily N member 31159196782159197732Rat
1332903Or52n2olfactory receptor family 52 subfamily N member 21159204524159205480Rat
1334174Or52n2d-ps1olfactory receptor family 52 subfamily N member 2D, pseudogene 11159219730159220348Rat
1334393Or52n2folfactory receptor family 52 subfamily N member 2F1159223286159224242Rat
1332599Or52n2bolfactory receptor family 52 subfamily N member 2B1159248753159249718Rat
1332638Or52n2eolfactory receptor family 52 subfamily N member 2E1159256560159257516Rat
1598287Hspa8-ps29heat shock protein family A (Hsp70) member 8, pseudogene 291159266674159268569Rat
1333554Or52n5-ps1olfactory receptor family 52 subfamily N member 5, pseudogene 11159288667159289619Rat
41207204LOC120100221U7 small nuclear RNA1159294824159294888Rat
40951011LOC120100219U7 small nuclear RNA1159294900159294947Rat
1333263Or52e18olfactory receptor family 52 subfamily E member 181159307874159308812Rat
1334060Or52e15olfactory receptor family 52 subfamily E member 151159349202159350140Rat
1334364Or52e8olfactory receptor family 52 subfamily E member 81159360430159361380Rat
1333770Or52e15bolfactory receptor family 52 subfamily E member 15B1159391482159392420Rat
1334024Or52e55-ps1olfactory receptor family 52 subfamily E member 55, pseudogene 11159396920159397344Rat
1333157Or52e15colfactory receptor family 52 subfamily E member 15C1159401875159402816Rat
1333955Or52e8bolfactory receptor family 52 subfamily E member 8B1159412927159413880Rat
1332841Or52e7olfactory receptor family 52 subfamily E member 71159422789159423742Rat
1332760Or52e5olfactory receptor family 52 subfamily E member 51159429383159430324Rat
1332618Or52e7b-ps1olfactory receptor family 52 subfamily E member 7B, pseudogene 11159437067159438014Rat
1332780Or52e4olfactory receptor family 52 subfamily E member 41159454581159455519Rat
1333390Or52e5bolfactory receptor family 52 subfamily E member 5B1159461887159462828Rat
1332687Or56a3bolfactory receptor family 56 subfamily A member 3B1159476168159477115Rat
1334270Or56a41-ps1olfactory receptor family 56 subfamily A member 41, pseudogene 11159481250159481948Rat
1559839Ankrd49-ps3ankyrin repeat domain 49, pseudogene 31159492560159493383Rat
1332789Or56a5olfactory receptor family 56 subfamily A member 51159500672159501610Rat
1332887Olr193olfactory receptor 1931159514613159515554Rat
1334283Or52l1bolfactory receptor family 52 subfamily L member 1B1159543892159544842Rat
1333130Or52x1b-ps1olfactory receptor family 52 subfamily X member 1B, pseudogene 11159554499159555417Rat
1332776Or52l1olfactory receptor family 52 subfamily L member 11159582521159583471Rat
1333835Or52x1olfactory receptor family 52 subfamily X member 11159601106159602059Rat
1333227Or56b6olfactory receptor family 56 subfamily B member 61159619288159620253Rat
1334153Or56b6colfactory receptor family 56 subfamily B member 6C1159635655159636605Rat
1334048Or56b6bolfactory receptor family 56 subfamily B member 6B1159657311159658276Rat
1333229Or52b1olfactory receptor family 52 subfamily B member 11159684419159685363Rat
1332958Or52b2olfactory receptor family 52 subfamily B member 21159695507159696475Rat
1594988Or52w1olfactory receptor family 52 subfamily W member 11159715764159716744Rat
1359585Fhip1bFHF complex subunit HOOK interacting protein 1B1159718679159748449Rat
1561034C1h11orf42similar to human chromosome 11 open reading frame 421159722255159725863Rat
41250517LOC120099901uncharacterized LOC1200999011159737254159740264Rat
619844Cnga4cyclic nucleotide gated channel subunit alpha 41159752357159756369Rat
11492064LOC108349007uncharacterized LOC1083490071159756929159773172Rat
2290Cckbrcholecystokinin B receptor1159771733159781738Rat
628755Cavin3caveolae associated protein 31159826549159828138Rat
1549719Smpd1sphingomyelin phosphodiesterase 11159892946159896789Rat
2122Apbb1amyloid beta precursor protein binding family B member 11159896889159920505Rat
62040Hpxhemopexin1159932819159940327Rat
70074Trim3tripartite motif-containing 31159950921159973600Rat
1303204Arfip2ADP-ribosylation factor interacting protein 21159974255159980398Rat
71097Timm10btranslocase of inner mitochondrial membrane 10B1159980525159983371Rat
1584052Dnhd1dynein heavy chain domain 11159990785160077990Rat
1308302Rrp8ribosomal RNA processing 81160081092160088709Rat
620063Ilkintegrin-linked kinase1160088839160095140Rat
1305907Taf10TATA-box binding protein associated factor 101160095108160096401Rat
621296Tpp1tripeptidyl peptidase 11160097984160104108Rat
1309878Dchs1dachsous cadherin-related 11160104931160138958Rat
70943Mrpl17mitochondrial ribosomal protein L171160162181160163870Rat
1308274Gvinp1GTPase, very large interferon inducible 11160195394160203003Rat
1583990Egln1-ps2egl-9 family hypoxia-inducible factor 1, pseudogene 21160266448160268021Rat
1598220Gvin1GTPase, very large interferon inducible 11160279767160306701Rat
1582907Rsl24d1-ps2ribosomal L24 domain containing 1, pseudogene 21160336026160337165Rat
1598219Atmin-ps1ATM interactor, pseudogene 11160351454160353967Rat
1333669Or2ag13olfactory receptor family 2 subfamily AG member 131160362110160363057Rat
41166468LOC120099902uncharacterized LOC1200999021160415733160433407Rat
1334348Or2ag16olfactory receptor family 2 subfamily AG member 161160417660160418607Rat
41046890LOC120100116U4 spliceosomal RNA1160433810160433960Rat
1334018Or2ag19bolfactory receptor family 2 subfamily AG member 19B1160458552160459502Rat
1333885Or2ag16bolfactory receptor family 2 subfamily AG member 16B1160476725160477672Rat
1333949Or2ag17b-ps1olfactory receptor family 2 subfamily AG member 17B, pseudogene 11160491806160492754Rat
1333636Or2ag18olfactory receptor family 2 subfamily AG member 181160512174160513124Rat
1332741Or2ag17olfactory receptor family 2 subfamily AG member 171160531819160532769Rat
1333691Or2ag2bolfactory receptor family 2 subfamily AG member 2B1160565659160566609Rat
1334173Or13n4olfactory receptor family 13 subfamily N member 41160570018160570944Rat
1334402Or2ag21-psolfactory receptor family 2 subfamily AG member 21, pseudogene 11160599025160599427Rat
1332902Or13n4bolfactory receptor family 13 subfamily N member 4B1160609645160610571Rat
1333664Or2ag19olfactory receptor family 2 subfamily AG member 191160633102160634052Rat
1333866Or2ag20olfactory receptor family 2 subfamily AG member 201160656583160657530Rat
1332678Olr216-psolfactory receptor pseudogene 2161160669428160670204Rat
6491324Rack1-ps2receptor for activated C kinase 1, pseudogene 21160670664160674437Rat
1332882Or2ag1olfactory receptor family 2 subfamily AG member 11160683723160684673Rat
1332846Or2ag2olfactory receptor family 2 subfamily AG member 21160695621160696571Rat
1334028Or2d3olfactory receptor family 2 subfamily D member 31160701351160702274Rat
1332718Olr220olfactory receptor 2201160730837160731760Rat
1334043Or2d3colfactory receptor family 2 subfamily D member 3C1160756927160757850Rat
1333443Or2d4olfactory receptor family 2 subfamily D member 41160777353160778285Rat
1333522Or6b9olfactory receptor family 6 subfamily B member 91160795402160831530Rat
1333026Or6b6olfactory receptor family 6 subfamily B member 61160812705160813649Rat
1333307Or6i2-ps1olfactory receptor family 6 subfamily I member 2, pseudogene 11160824097160824727Rat
68340Or6a2olfactory receptor family 6 subfamily A member 21160827258160828241Rat
1332598Or10a5olfactory receptor family 10 subfamily A member 51160863556160864509Rat
41060371Trnaa-agc48transfer RNA alanine (anticodon AGC) 481160879981160880061Rat
1333459Or10a5c-ps1olfactory receptor family 10 subfamily A member 5C, pseudogene 11160897439160898390Rat
2324470Tm9sf3-ps1transmembrane 9 superfamily member 3, pseudogene 11160899639160905468Rat
1333075Or2d36bolfactory receptor family 2 subfamily D member 36B1160930225160931169Rat
1334002Or10a2olfactory receptor family 10 subfamily A member 21160948001160948954Rat
1333909Or10a4olfactory receptor family 10 subfamily A member 41160957099160958046Rat
1334160Or2d2bolfactory receptor family 2 subfamily D member 2B1160964638160965585Rat
1333500Or2d2olfactory receptor family 2 subfamily D member 21160979415160980362Rat
6490164Snx18-ps1sorting nexin 18, pseudogene 11161003246161007281Rat
1333621Or2d36olfactory receptor family 2 subfamily D member 361161028174161029118Rat
1598218Nlrp14NLR family, pyrin domain containing 141161069141161089158Rat
41291278LOC120099903uncharacterized LOC1200999031161073386161079124Rat
1598286Rbmxl2Rbmx like 21161116272161246053Rat
6489382Eef1a1-ps10eukaryotic translation elongation factor 1 alpha 1, pseudogene 101161270336161272186Rat
621169Syt9synaptotagmin 91161275882161456384Rat
1311854Olfml1olfactomedin-like 11161478129161502541Rat
1565383Ppfibp2PPFIA binding protein 21161504774161687339Rat
1308421Cyb5r2cytochrome b5 reductase 21161655862161664359Rat
1565730Cdv3l1carnitine deficiency-associated gene expressed in ventricle 3 like 11161678311161681564Rat
1564636Ovch2ovochymase 21161693619161713952Rat
1333421Or5p5bolfactory receptor family 5 subfamily P member 5B1161735695161736633Rat
1334142Or8i6-ps1olfactory receptor family 8 subfamily I member 6, pseudogene 11161737746161738184Rat
1333336Or5p50olfactory receptor family 5 subfamily P member 501161742688161743632Rat
1334107Olr238-psolfactory receptor pseudogene 2381161751470161752093Rat
1334219Or5p5olfactory receptor family 5 subfamily P member 51161759509161760447Rat
1333958Or5p52olfactory receptor family 5 subfamily P member 521161784000161785357Rat
1334165Or5p53olfactory receptor family 5 subfamily P member 531161813580161814512Rat
9444072LOC103691202glyceraldehyde-3-phosphate dehydrogenase pseudogene1161819802161820840Rat
1332645Or5p56olfactory receptor family 5 subfamily P member 561161842163161843095Rat
1333090Or5p56b-ps1olfactory receptor family 5 subfamily P member 56B, pseudogene 11161871812161872744Rat
1332781Or5p6olfactory receptor family 5 subfamily P member 61161900087161901031Rat
1334180Or10ab4olfactory receptor family 10 subfamily AB member 41161927803161928786Rat
1334008Or5p4olfactory receptor family 5 subfamily P member 41161949772161950710Rat
1334362Or5p6bolfactory receptor family 5 subfamily P member 6B1161968555161969499Rat
1334208Or5p84-ps1olfactory receptor family 5 subfamily P member 84, pseudogene 11161974994161975991Rat
1562400Or5p58olfactory receptor family 5 subfamily P member 581162007132162008103Rat
1334370Or5p59olfactory receptor family 5 subfamily P member 591162033893162034840Rat
1333255Or5p66bolfactory receptor family 5 subfamily P member 66B1162053881162054825Rat
1593423Skp2-ps1S-phase kinase-associated protein 2, pseudogene 11162065613162066882Rat
1333639Or5p60colfactory receptor family 5 subfamily P member 60C1162080213162081184Rat
1332743Or5p60bolfactory receptor family 5 subfamily P member 60B1162153461162154426Rat
1332840Or5p61-ps1olfactory receptor family 5 subfamily P member 61, pseudogene 11162179357162180300Rat
1334255Or5p60dolfactory receptor family 5 subfamily P member 60D1162219346162220290Rat
1333699Olr258-psolfactory receptor pseudogene 2581162227279162227925Rat
1333441Or5p66olfactory receptor family 5 subfamily P member 661162235096162236037Rat
1333174Or5p1olfactory receptor family 5 subfamily P member 11162267801162268733Rat
1333278Or8af1-ps1olfactory receptor family 8 subfamily AF member 1, pseudogene 11162273789162274537Rat
1334168Or5p68olfactory receptor family 5 subfamily P member 681162283866162284822Rat
1332928Or5p72olfactory receptor family 5 subfamily P member 721162293541162294485Rat
1334301Or5p73olfactory receptor family 5 subfamily P member 731162325587162326531Rat
1332927Or5p78b-ps1olfactory receptor family 5 subfamily P member 78B, pseudogene 11162357696162358623Rat
1334284Or5p83-ps1olfactory receptor family 5 subfamily P member 83, pseudogene 11162382685162383211Rat
1592241Smapl-ps1small acidic protein like, pseudogene 11162387205162387742Rat
1332813Or5p69bolfactory receptor family 5 subfamily P member 69B1162396498162397442Rat
1333901Or5p78colfactory receptor family 5 subfamily P member 78C1162420650162421594Rat
1334304Or5p75-ps1olfactory receptor family 5 subfamily P member 75, pseudogene 11162438130162439074Rat
1333728Or5p69olfactory receptor family 5 subfamily P member 691162461108162462052Rat
1332950Or5p78olfactory receptor family 5 subfamily P member 781162473821162474765Rat
1333977Or5p79olfactory receptor family 5 subfamily P member 791162479829162480773Rat
1334156Or5p80-ps1olfactory receptor family 5 subfamily P member 80, pseudogene 11162489001162489933Rat
1590087Or5p80olfactory receptor family 5 subfamily P member 801162509473162510405Rat
1592197Or10ab5olfactory receptor family 10 subfamily AB member 5, pseudogene 11162529010162529975Rat
1333605Or5p81olfactory receptor family 5 subfamily P member 811162544353162545297Rat
1564933Olr271-ps1olfactory receptor 271, pseudogene 11162580418162589573Rat
1332675Or5p76bolfactory receptor family 5 subfamily P member 76B1162591358162592302Rat
1332769Or5p76olfactory receptor family 5 subfamily P member 761162617193162618137Rat
2323421Or5p81bolfactory receptor family 5 subfamily P member 81B1162646352162647296Rat
41285702Olr281-ps1olfactory receptor 281, pseudogene 11162691385162692348Rat
1588967Or5e1olfactory receptor family 5 subfamily E member 11162724328162725263Rat
1588958Gnai2-ps1G protein subunit alpha i2, pseudogene 11162752964162754015Rat
1588954Cops7b-ps2COP9 signalosome subunit 7B, pseudogene 21162757275162758072Rat
1334387Or10a48olfactory receptor family 10 subfamily A member 48B, pseudogene 11162793841162794776Rat
1333025Or10a48b-ps1olfactory receptor family 10 subfamily A member 48B, pseudogene 11162825264162826252Rat
2323231Scly-ps1selenocysteine lyase, pseudogene 11162839235162842235Rat
1333156Or10a49olfactory receptor family 10 subfamily A member 491162843548162844492Rat
1333752Or10a3olfactory receptor family 10 subfamily A member 31162856896162857876Rat
1334171Or10a3colfactory receptor family 10 subfamily A member 3C1162870107162871051Rat
1307387Nlrp10NLR family, pyrin domain containing 101162922806162930363Rat
1306112Eif3feukaryotic translation initiation factor 3, subunit F1162934220162943204Rat
41259906LOC120093052uncharacterized LOC1200930521162952116162995966Rat
3918TubTUB bipartite transcription factor1163008198163030958Rat
1588939Ric3RIC3 acetylcholine receptor chaperone1163030621163086583Rat
11382437LOC108349532high mobility group protein B1 pseudogene1163050054163050871Rat
621166Lmo1LIM domain only 11163132338163168521Rat
41203530LOC120097351uncharacterized LOC1200973511163187266163190378Rat
1590972Stk33serine/threonine kinase 331163276176163458580Rat
41025008Rpl21-ps22ribosomal protein L21, pseudogene 221163411641163417424Rat
41316835LOC120100481small nucleolar RNA U131163428009163428118Rat
1595847Trim66tripartite motif-containing 661163468944163539633Rat
1309771Rpl27aribosomal protein L27A1163539732163542771Rat
41330851Snora3small nucleolar RNA, H/ACA box 31163540664163540793Rat
40942925LOC120100352small nucleolar RNA SNORA3/SNORA45 family1163541736163541866Rat
1308995Dennd2bDENN domain containing 2B1163544075163734736Rat
11412042Chmp1b-ps1charged multivesicular body protein 1B, pseudogene 11163678349163683873Rat
1306959Akip1A-kinase interacting protein 11163734730163743648Rat
1565905C1h11orf16similar to human chromosome 11 open reading frame 161163742987163754926Rat
41249843LOC120097353uncharacterized LOC1200973531163751577163761505Rat
621631Ascl3achaete-scute family bHLH transcription factor 31163755306163755951Rat
1310775Tmem9bTMEM9 domain family, member B1163755307163783880Rat
1304777Nrip3nuclear receptor interacting protein 31163789738163815036Rat
1563998Scube2signal peptide, CUB domain and EGF like domain containing 21163831876163899925Rat
41332604Trnas-aga46transfer RNA serine (anticodon AGA) 461163867257163867330Rat
1306759Dennd5aDENN domain containing 5A1163928183163994207Rat
1310870Tmem41btransmembrane protein 41B1164012585164026967Rat
40961947LOC120100367U2 spliceosomal RNA1164020562164020659Rat
41001346Rnvu1-33RNA, variant U1 small nuclear 331164044012164044154Rat
1598285Nhp2-ps5NHP2 ribonucleoprotein, pseudogene 51164051065164052045Rat
1310849Ipo7importin 71164062702164102938Rat
41029790Snora23small nucleolar RNA, H/ACA box 231164091024164091206Rat
1305662Zfp143zinc finger protein 1431164109041164144902Rat
1307895Wee1WEE1 G2 checkpoint kinase1164173681164197688Rat
41171990Rnu6-1168RNA, U6 small nuclear 11681164181113164181219Rat
1305579Swap70switching B-cell complex subunit SWAP701164267588164328796Rat
1588657Sbf2SET binding factor 21164352892164719883Rat
11499584Kmt5a-ps1lysine methyltransferase 5A, pseudogene 11164470159164472142Rat
41067342LOC120097354uncharacterized LOC1200973541164542501164557133Rat
2047Admadrenomedullin1164745484164747655Rat
1588628Kpna1-ps9karyopherin subunit alpha 1, pseudogene 91164788138164789691Rat
11423621LOC108349612uncharacterized LOC1083496121164828353164859432Rat
9142791LOC103691204uncharacterized LOC1036912041164862825164886508Rat
2111Ampd3adenosine monophosphate deaminase 31164884823164929899Rat
41341871LOC120097355uncharacterized LOC1200973551164913704164917576Rat
1303154rnf141ring finger protein 1411164933972164957081Rat
1310864Lyve1lymphatic vessel endothelial hyaluronan receptor 11164962872164976309Rat
1309828Irag1inositol 1,4,5-triphosphate receptor associated 11164981716165094232Rat
1311097Ctr9CTR9 homolog, Paf1/RNA polymerase II complex component1165137277165167303Rat
1305294Eif4g2eukaryotic translation initiation factor 4, gamma 21165181433165193583Rat
41129599Snord97small nucleolar RNA, C/D box 971165186791165186978Rat
41232175Rnf7-ps1ring finger protein 7, pseudogene 11165213264165219035Rat
9241707Zbed5l-ps1zinc finger BED-type containing 5 like, pseudogene 11165234060165240928Rat
6489976LOC100911864uncharacterized LOC1009118641165274998165281034Rat
41338040LOC120099904uncharacterized LOC1200999041165293636165294340Rat
1566189RGD1566189similar to ferritin light chain1165377580165378490Rat
11502966Trnas-gcu1transfer RNA serine (anticodon GCU) 11165571303165571384Rat
11374957LOC108349779keratin-associated protein 10-6-like1165574345165575331Rat
1309623Galnt18polypeptide N-acetylgalactosaminyltransferase 181165593180165904268Rat
40966768LOC120099905uncharacterized LOC1200999051165614823165635270Rat
41014533LOC120100128U6 spliceosomal RNA1165942462165942568Rat
1310411Usp47ubiquitin specific peptidase 471166152104166235312Rat
621846Dkk3dickkopf WNT signaling pathway inhibitor 31166237969166281271Rat
1311773Mical2microtubule associated monooxygenase, calponin and LIM domain containing 21166345853166471715Rat
1311773Mical2microtubule associated monooxygenase, calponin and LIM domain containing 21166491721166530575Rat
71021Parvaparvin, alpha1166547202166704958Rat
40944486LOC120099906uncharacterized LOC1200999061166686113166779188Rat
41376786LOC120100416small nucleolar RNA SNORA171166729024166729154Rat
1549742Tead1TEA domain transcription factor 11166791900167010591Rat
41147698LOC120099907NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2-like1166888513166888812Rat
40927122LOC120099908uncharacterized LOC1200999081166913881166916228Rat
1309847Rassf10Ras association domain family member 101167058245167063591Rat
7694563LOC102547978uncharacterized LOC1025479781167177345167193454Rat
1587415Ckap2-ps3cytoskeleton-associated protein 2, pseudogene 31167203062167213037Rat
41245374LOC120099909uncharacterized LOC1200999091167221216167259345Rat
41142546LOC120097953uncharacterized LOC1200979531167262316167263473Rat
62003Bmal1basic helix-loop-helix ARNT like 11167331756167430235Rat
1306301Btbd10BTB domain containing 101167431320167489320Rat
40976055Rnu6-26RNA, U6 small nuclear 261167476849167476955Rat
3440Pthparathyroid hormone1167508121167511530Rat
1598284Eno1-ps9enolase 1, pseudogene 91167611484167612975Rat
11365267Pomp-ps3proteasome maturation protein, pseudogene 31167624010167624965Rat
1306647Far1fatty acyl CoA reductase 11167644622167705868Rat
41120816LOC120099910cytochrome c, somatic-like1167660539167660823Rat
7538108LOC102548137uncharacterized LOC1025481371167724321167750850Rat
1598217Metap2-ps3methionyl aminopeptidase 2, pseudogene 31167766146167768505Rat
7593729LOC102548271uncharacterized LOC1025482711167886561167901539Rat
619918Spon1spondin 11167929049168228239Rat
11466449LOC10834962060S ribosomal protein L31 pseudogene1168146986168147396Rat
1310793Rras2RAS related 21168233693168303111Rat
1598283Rpl27a-ps4ribosomal protein L27a,pseudogene 41168336483168336924Rat
1586255Rps14-ps6ribosomal protein S14, pseudogene 61168339073168339543Rat
1565301RGD1565301similar to ribosomal protein S181168385938168386642Rat
620861Copb1COPI coat complex subunit beta 11168404334168438589Rat
61841Psma1proteasome 20S subunit alpha 11168442421168453440Rat
41368180Atp5mj-ps1ATP synthase membrane subunit j, pseudogene 11168472019168472630Rat
61943Pde3bphosphodiesterase 3B1168606762168770078Rat
7667300LOC102548890ubiquitin-like protein FUBI-like1168627468168627978Rat
1311866Cyp2r1cytochrome P450, family 2, subfamily r, polypeptide 11168749302168798079Rat
2254Calcacalcitonin-related polypeptide alpha1168878212168883176Rat
620997Calcbcalcitonin-related polypeptide, beta1168966465168970125Rat
1311379InscINSC, spindle orientation adaptor protein1168993032169100438Rat
40942999LOC120100423small nucleolar RNA SNORA171169083085169083212Rat
41367209LOC120097959uncharacterized LOC1200979591169464515169471269Rat
1309000Sox6SRY-box transcription factor 61169723306170334846Rat
40995085Trnav-aac35transfer RNA valine (anticodon AAC) 351169956121169956193Rat
40959047LOC120097357uncharacterized LOC1200973571170274780170333747Rat
1311703C1h11orf58similar to human chromosome 11 open reading frame 581170334950170346864Rat
1598216Plekha7pleckstrin homology domain containing A71170364524170547843Rat
41271539LOC120099912uncharacterized LOC1200999121170546748170550493Rat
621027Rps13ribosomal protein S131170572925170575355Rat
41025316Snord14asmall nucleolar RNA, C/D box 14A1170574389170574475Rat
1310389Pik3c2aphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha1170577942170684353Rat
6494996LOC100911093CCA tRNA nucleotidyltransferase 1, mitochondrial-like1170720730170722745Rat
620888Nucb2nucleobindin 21170750830170787356Rat
41368719LOC120099913uncharacterized LOC1200999131170864207170871362Rat
41201048Rnu6-651RNA, U6 small nuclear 6511170936910170937016Rat
41154129LOC120100415small nucleolar RNA SNORA171171168503171168634Rat
41035175LOC120097960uncharacterized LOC1200979601171287279171301330Rat
6486912LOC100912427nuclease-sensitive element-binding protein 1-like1171304587171306092Rat
620093Xylt1xylosyltransferase 11171643925171929774Rat
40972409LOC120099914uncharacterized LOC1200999141171676084171708721Rat
1586193Gapdh-ps109Glyceraldehyde-3-phosphate dehydrogenase, pseudogene 1091172292417172292996Rat
619939Rps15aribosomal protein S15a1172420151172427021Rat
735205Arl6ip1ADP-ribosylation factor like GTPase 6 interacting protein 11172430475172439990Rat
1563508Smg1SMG1, nonsense mediated mRNA decay associated PI3K related kinase1172441892172543667Rat
7544889LOC102549940uncharacterized LOC1025499401172626577172632763Rat
41302139LOC120099915uncharacterized LOC1200999151172632858172636221Rat
6503302Clec19aC-type lectin domain containing 19A1172667793172677953Rat
708576Syt17synaptotagmin 171172695275172761906Rat
1564255Itpripl2ITPRIP like 21172801152172803047Rat
11458746LOC108349625uncharacterized LOC1083496251172819660172831377Rat
41171220LOC120099916uncharacterized LOC1200999161172832432172841087Rat
2381Coq7coenzyme Q7, hydroxylase1172836359172851173Rat
1564267Tmc7transmembrane channel-like 71172855777172905796Rat
7701116LOC102550534ubiquitin-like protein FUBI-like1172860549172861181Rat
41283769LOC120099917uncharacterized LOC1200999171172905921172914944Rat
1307037Tmc5transmembrane channel-like 51172914915172999478Rat
621788Gde1glycerophosphodiester phosphodiesterase 11173016984173032396Rat
1310509Ccp110centriolar coiled-coil protein 1101173042238173072873Rat
1564485Vps35lVPS35 endosomal protein sorting factor like1173076105173179663Rat
41014644LOC120100364small nucleolar RNA SNORA241173170301173170415Rat
1565096Knop1lysine-rich nucleolar protein 11173180400173199378Rat
6502881IqckIQ motif containing K1173199308173316990Rat
41297868LOC120100373small nucleolar RNA SNORA441173218181173218293Rat
1309510Gprc5bG protein-coupled receptor, class C, group 5, member B1173316398173340951Rat
7553300LOC102550985uncharacterized LOC1025509851173325465173358499Rat
1311729Gpr139G protein-coupled receptor 1391173481583173522451Rat
41080939Nme2-ps5NME/NM23 nucleoside diphosphate kinase 2, pseudogene 51173631964173651136Rat
41149238LOC120100417small nucleolar RNA SNORA171173643130173643260Rat
621695Gp2glycoprotein 21173797057173812619Rat
3940Umoduromodulin1173816341173829681Rat
1307822Pdiltprotein disulfide isomerase-like, testis expressed1173837477173868685Rat
1309578Acsm5acyl-CoA synthetase medium-chain family member 51173870873173896838Rat
708383Acsm2acyl-CoA synthetase medium-chain family member 21173916368173955116Rat
1559600RGD1559600RGD15596001173973318173988758Rat
1306813Acsm1acyl-CoA synthetase medium-chain family member 11173985715174020565Rat
7656358LOC102551259uncharacterized LOC1025512591173998998174001331Rat
727928Acsm4acyl-CoA synthetase medium-chain family member 41174053931174078345Rat
1308854Thumpd1THUMP domain containing 11174078875174084915Rat
41158749LOC120099918uncharacterized LOC1200999181174122111174129090Rat
7626399LOC102551569uncharacterized LOC1025515691174122146174135541Rat
62086Acsm3acyl-CoA synthetase medium-chain family member 31174133260174159966Rat
1583889Eri2ERI1 exoribonuclease family member 21174140831174168757Rat
1305412Rexo5RNA exonuclease 51174168633174264526Rat
1308893Dcun1d3defective in cullin neddylation 1 domain containing 31174243001174285647Rat

Nucleotide Sequences
GenBank Nucleotide FQ216592 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH612466.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11148131275088344Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
1357400Bw62Body weight QTL624.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)12234064767340647Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)12887978078430678Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)13344984878449848Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)13344984878449848Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)13483685879836858Rat
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)13523959878430678Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)13523959878430678Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14580314078430678Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
4889962Bss94Bone structure and strength QTL 943.8tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14936146582174945Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)15389511782174945Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)15389511782174945Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
61433Cia2Collagen induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)17843075491209302Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)180592172125592172Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)182174743118944897Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)183547917128547917Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)185424647100358001Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1302788Scl19Serum cholesterol QTL 194.60.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)190532338123479925Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)190664883143200202Rat
2293142Bp314Blood pressure QTL 314arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192184926137184926Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)192948896144267916Rat
1331800Scl25Serum cholesterol level QTL 253.013blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)194494440117601394Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642722214537671Rat
61346Rf2Renal disease susceptibility QTL 23.7urine protein amount (VT:0005160)urine protein level (CMO:0000591)199267916144267916Rat
61399Tcat1Tongue tumor resistance QTL 13.3tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879)199267916144267916Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
2317833Alcrsp19Alcohol response QTL 1912.40.001response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
1641897Alcrsp1Alcohol response QTL 1response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
2303591Gluco41Glucose level QTL 412blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1102168504147168504Rat
61370Mcs3Mammary carcinoma susceptibility QTL 32.15mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1102268556147268556Rat
1354623Rf46Renal function QTL 463.8blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)1102813953151162766Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
9590300Scort16Serum corticosterone level QTL 164.390.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1103111621148111621Rat
8694370Bw154Body weight QTL 1548.910.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)1103111621148111621Rat
631569Bp93Blood pressure QTL 930.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847121834139Rat
631496Bp97Blood pressure QTL 973.08arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847151047847Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
2325726Eae30Experimental allergic encephalomyelitis QTL 30nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1123053310128593844Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
631570Bp94Blood pressure QTL 940.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123479780142990467Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
631206Niddm40Non-insulin dependent diabetes mellitus QTL 40blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1136745990163747690Rat
71118Thym1Thymus enlargement QTL 110.170.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
724550Thym3Thymus enlargement QTL 37.820.001thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1136829932181829932Rat
631519Pia11Pristane induced arthritis QTL 115.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1136830018181830018Rat
1598853Memor3Memory QTL 34.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)1143506580212458660Rat
61348Bp30Blood pressure QTL 302.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144017057197814409Rat
70160Bw18Body weight QTL 185.7body mass (VT:0001259)body weight (CMO:0000012)1144267353196383635Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
634315Niddm45Non-insulin dependent diabetes mellitus QTL 457.16blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1144267916172949660Rat
61379Bp44Blood pressure QTL 4419.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1144267916174133260Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354602Bw35Body weight QTL 3512.2body mass (VT:0001259)body weight (CMO:0000012)1151162512201278233Rat
1354620Kidm19Kidney mass QTL 194kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512201278233Rat
1354634Kidm12Kidney mass QTL 123.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)1151162512201278233Rat
1354636Lmblg1Limb length QTL 16.4tibia length (VT:0004357)tibia length (CMO:0000450)1151162512201278233Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
61343Bp28Blood pressure QTL 28arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1151646613196646613Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2303622Vencon6Ventilatory control QTL 60.001respiration trait (VT:0001943)respiration rate (CMO:0000289)1154561505199561505Rat
1582204Livw1Liver weight QTL 13.60.0003liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)1155422851172949803Rat
4889419Cstrr2Cold stress response QTL 20.05urine catecholamine amount (VT:0010502)absolute change in urine norepinephrine level (CMO:0001634)1155866514158592016Rat
4889428Stresp24Stress response QTL 240.05heart pumping trait (VT:2000009)absolute change in electrocardiographic low frequency R-R spectral component to high frequency R-R spectral component ratio (CMO:0002162)1155866514200866514Rat
631548Bp88Blood pressure QTL 8850.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1156677124176484451Rat
1354618Kidm15Kidney mass QTL 155kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)1156677124201278233Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
61347Bp197Blood pressure QTL 1974.2arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1158633083203633083Rat
2292222Bp307Blood pressure QTL 3073.060.0014arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393213533942Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164747424209747424Rat
619613Bp77Blood pressure QTL 770.01arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1164747424209747424Rat
737974Bp161Blood pressure QTL 1610.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1164747558181133855Rat
2312558Glom17Glomerulus QTL 173.90.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1166532971191278129Rat
1354653Despr9Despair related QTL 90.00019locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1167909849212909849Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169112897197261052Rat
619614Bp78Blood pressure QTL 780.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1169112897197261052Rat
61341Bp26Blood pressure QTL 26arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1169537671214537671Rat
724562Rends1Renal damage susceptibility QTL 10.05kidney glomerulus integrity trait (VT:0010546)index of glomerular damage (CMO:0001135)1169537671214537671Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
61326Eae6Experimental allergic encephalomyelitis QTL 65.3body mass (VT:0001259)change in body weight (CMO:0002045)1172949660181830018Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
631670Iddm10Insulin dependent diabetes mellitus QTL 101.9blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1174133260196383635Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat


Additional Information

Database Acc Id Source(s)
UniSTS 211648 UniSTS