RH128089 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH128089

Symbol: RH128089
Previously known as: AA859664; 
RGD ID: 5040100
Expected Size: 196 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21373,528,768 - 73,528,964 (+)MAPPERmRatBN7.2
mRatBN7.21053,609,492 - 53,609,702 (+)MAPPERmRatBN7.2
Rnor_6.01055,491,074 - 55,491,283NCBIRnor6.0
Rnor_6.01379,077,590 - 79,077,785NCBIRnor6.0
Rnor_5.01383,972,587 - 83,972,782UniSTSRnor5.0
Rnor_5.01055,233,453 - 55,233,662UniSTSRnor5.0
RGSC_v3.41055,660,814 - 55,661,023UniSTSRGSC3.4
RGSC_v3.41376,824,991 - 76,825,186UniSTSRGSC3.4
Celera1373,317,123 - 73,317,318UniSTS
Celera1052,775,812 - 52,776,021UniSTS
Cytogenetic Map13q22UniSTS
Cytogenetic Map10q24UniSTS
Is Marker For: Genes:   Prdx6   Rpl26   Prdx6-ps1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGAGCCAGTAGTATAGCGAGCG
Reverse Primer CTTCACCAAAGAGCTCCCATCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
71005Prdx6peroxiredoxin 6137352874673539295Rat
6498388Prdx6-ps1peroxiredoxin 6, pseudogene 1105360919753610539Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1356056920101056920Rat
8655951Rf63Renal function QTL 6312.2blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)136906051977046890Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
8655945Rf61Renal function QTL 613.6blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)136906051986800898Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)134619797684753113Rat
4889861Pur29Proteinuria QTL 2913.80.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)133741558480753406Rat
12879444Bp397Blood pressure QTL 397arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134504940490049404Rat
1331783Bp221Blood pressure QTL 2213.72886arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)136906051986800898Rat
1300166Kidm6Kidney mass QTL 63.93kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)136906051986800898Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134569998390699983Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133975454484754544Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133453521879535218Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)133843340883433408Rat
724564Uae11Urinary albumin excretion QTL 115.7urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)135949252277046890Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
738026Lnnr5Liver neoplastic nodule remodeling QTL 53.29liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)135987440885581182Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133228447177284471Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
12879471Bp398Blood pressure QTL 398arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134551471990514719Rat
12879477Bp401Blood pressure QTL 401arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133726209282262092Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133741558482415584Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)135236217197362171Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103539245763642539Rat
1549846Scl47Serum cholesterol level QTL 473.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)105057470795574707Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101147401056474010Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101527595560275955Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)104114263386142633Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103063205375632053Rat
1578762Toxo1Toxoplasma gondii resistance QTL 1brain integrity trait (VT:0010579)percentage of study population displaying Toxoplasma gondii brain cysts at a point in time (CMO:0002028)105220003059378278Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104133325886333258Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104502965095600334Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104444169989441699Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102845313673453136Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103539226764155584Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102929950464155584Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102694462871944628Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14232313287323132Rat
1331750Bp220Blood pressure QTL 2202.98arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133741558482415584Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104232313287323132Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
70220Bp55Blood pressure QTL 555.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
4889861Pur29Proteinuria QTL 2913.80.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)133741558480753406Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101502851360430477Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102652195761345413Rat
1331783Bp221Blood pressure QTL 2213.72886arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)136906051986800898Rat
619615Bp80Blood pressure QTL 800.0354arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133975454484754544Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101960648364606483Rat
1549897Stresp12Stress response QTL 123.35stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)133843340883433408Rat
724564Uae11Urinary albumin excretion QTL 115.7urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)135949252277046890Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103397392178973921Rat
2303563Bw89Body weight QTL 896body mass (VT:0001259)body weight (CMO:0000012)133228447177284471Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103122402675632053Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)104287676679813922Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101960648364606483Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
2293669Bmd33Bone mineral density QTL 334.50.0001femur strength trait (VT:0010010)femoral neck polar moment of inertia (CMO:0001670)104944455181709989Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1356056920101056920Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
2293679Bmd30Bone mineral density QTL 303.50.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
12879444Bp397Blood pressure QTL 397arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134504940490049404Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10580199062146030Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134569998390699983Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
61340Bp25Blood pressure QTL 254.20.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133453521879535218Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101816784163167841Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102132980561345413Rat
61349Bp31Blood pressure QTL 315.75arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)133737450982374509Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
12879471Bp398Blood pressure QTL 398arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134551471990514719Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
12879477Bp401Blood pressure QTL 401arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133726209282262092Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)135236217197362171Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104444169989441699Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
2293652Bmd22Bone mineral density QTL 224.90.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)104944455181709989Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
1359017Hrtrt21Heart rate QTL 212.4heart pumping trait (VT:2000009)heart rate (CMO:0000002)105177294096772940Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
8655951Rf63Renal function QTL 6312.2blood urea nitrogen amount (VT:0005265)plasma urea nitrogen level (CMO:0000586)136906051977046890Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
8655945Rf61Renal function QTL 613.6blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)136906051986800898Rat
71119Thym2Thymus enlargement QTL 23.8thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)134619797684753113Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)103756507982565079Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)103756507982565079Rat
1300166Kidm6Kidney mass QTL 63.93kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)136906051986800898Rat
70364Bp72Blood pressure QTL 72arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)105112110096121100Rat
738026Lnnr5Liver neoplastic nodule remodeling QTL 53.29liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)135987440885581182Rat
631530Tls3T-lymphoma susceptibility QTL 300.0001thymus integrity trait (VT:0010555)percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911)105177461295600334Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
631535Cm51Cardiac mass QTL 513heart mass (VT:0007028)calculated heart weight (CMO:0000073)105178628291669536Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104194452678307017Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
2293705Bmd25Bone mineral density QTL 257.10.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)104944455181709989Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
7207811Bmd90Bone mineral density QTL 905.2femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)104944455181709989Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104444169989441699Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104736947092369470Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102652195798952741Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100910494 UniSTS
  287417 UniSTS
  94167 UniSTS
UniSTS 211397 UniSTS