RH128027 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH128027

Symbol: RH128027
Previously known as: AA858544; 
RGD ID: 5039994
Expected Size: 180 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X73,458,976 - 73,459,156 (-)MAPPERmRatBN7.2
mRatBN7.21214,807,123 - 214,807,303 (-)MAPPERmRatBN7.2
mRatBN7.2386,510,268 - 86,510,448 (+)MAPPERmRatBN7.2
Rnor_6.0389,743,848 - 89,744,027NCBIRnor6.0
Rnor_6.01236,494,310 - 236,494,489NCBIRnor6.0
Rnor_5.0396,410,240 - 96,410,419UniSTSRnor5.0
Rnor_5.01243,798,840 - 243,799,019UniSTSRnor5.0
Cytogenetic Map1q43UniSTS
Is Marker For: Genes:   Rfk  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACTAAGCCCTAAACCACATGCC
Reverse Primer CTGAGCAACCTCCTTAGCCTTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1549748Rfkriboflavin kinase1214799880214807440Rat
1563242Rfk-ps1riboflavin kinase, pseudogene 1X7345721973459275Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1214537555238757011Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1185145134221264292Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
1358292Cm37Cardiac mass QTL 376.28e-07heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1182623426219932796Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
2292218Kidm35Kidney mass QTL 35kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1199368955224569684Rat
1331790Bp201Blood pressure QTL 2013.127arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1198211513225126682Rat
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
1300168Bp170Blood pressure QTL 1702.76arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1207702246228581766Rat
61403Niddm4Non-insulin dependent diabetes mellitus QTL 4blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1206329708222745518Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1188377360224054420Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
634340Hcar5Hepatocarcinoma resistance QTL 58liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1214537555226660468Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1214537555238757011Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1185145134221264292Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
1358292Cm37Cardiac mass QTL 376.28e-07heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1182623426219932796Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
2292218Kidm35Kidney mass QTL 35kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1199368955224569684Rat
1331790Bp201Blood pressure QTL 2013.127arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1198211513225126682Rat
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
1300168Bp170Blood pressure QTL 1702.76arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1207702246228581766Rat
61403Niddm4Non-insulin dependent diabetes mellitus QTL 4blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1206329708222745518Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1188377360224054420Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
634340Hcar5Hepatocarcinoma resistance QTL 58liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1214537555226660468Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X65612192120568734Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1214537555238757011Rat
1549830Bss1Bone structure and strength QTL 14.8femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1172609619217609619Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
70163Bw20Body weight QTL 205.1body mass (VT:0001259)body weight (CMO:0000012)1174133260219133260Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
1581568Rf53Renal function QTL 53urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)356395968161299569Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
724523Tsu1Thymus enlargement suppressive QTL 13.84thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)350437504115638231Rat
2300161Bmd43Bone mineral density QTL 438.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
731180Bp152Blood pressure QTL 1520.03arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)35378111291609953Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
12879848Bw181Body weght QTL 1810.015body mass (VT:0001259)body weight (CMO:0000012)370348525121056321Rat
2300174Bmd42Bone mineral density QTL 428.40.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)1171629477216629477Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2301971Cm71Cardiac mass QTL 714.63heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)341874578155617519Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2301970Bw81Body weight QTL 815.19body mass (VT:0001259)body weight (CMO:0000012)341874578155617519Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
2300187Bmd41Bone mineral density QTL 418.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1171629477216629477Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)33945463789115240Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
2292591Esta4Estrogen-induced thymic atrophy QTL 4thymus mass (VT:0004954)thymus wet weight (CMO:0000855)347233211147415807Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)33945463789115240Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat
1331790Bp201Blood pressure QTL 2013.127arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1198211513225126682Rat
1600376Arunc5Aerobic running capacity QTL 50.21exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)373376539118376539Rat
2302273Gluco35Glucose level QTL 355.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)380800231114297550Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
1600380Niddm70Non-insulin dependent diabetes mellitus QTL 703.10.0008blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1176550523221550523Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1188377360224054420Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
6903303Scl34Serum cholesterol QTL 342.50.0033blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)1180359209218108781Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1354597Kidm13Kidney mass QTL 132.9kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)341874578104104347Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333703347104104347Rat
631665Bw8Body weight QTL 85.5body mass (VT:0001259)body weight (CMO:0000012)350437042119183768Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
1358186Ept2Estrogen-induced pituitary tumorigenesis QTL 28.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
1582238Bw68Body weight QTL 683.20.0064body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1582239Epfw1Epididymal fat weight QTL 14.50.0006epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)353184593115665732Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
2293673Bss27Bone structure and strength QTL 2718.630.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)1171629477216629477Rat
2293677Bss41Bone structure and strength QTL 419.380.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1171629477216629477Rat
1582218Bw74Body weight QTL 743.90.0021body mass (VT:0001259)body weight (CMO:0000012)353184593115665732Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
1582221Kidm30Kidney mass QTL 303.50.0008kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)364655305115665732Rat
1582210Bw71Body weight QTL 713.30.0012body mass (VT:0001259)body weight (CMO:0000012)364655305115665732Rat
2293689Bss47Bone structure and strength QTL 477.250.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)1171629477216629477Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
1300111Rf12Renal function QTL 123.78renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)361017749121056321Rat
2293693Bss22Bone structure and strength QTL 2233.520.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1171629477216629477Rat
1300145Rf7Renal function QTL 72.96urine creatinine amount (VT:0010540)urine creatinine level (CMO:0000125)1185145134221264292Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
8662816Vetf4Vascular elastic tissue fragility QTL 44renal artery integrity trait (VT:0010642)number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563)359242096157323038Rat
631214Bw61Body weight QTL613.40.0001intramuscular adipose amount (VT:0010044)intramuscular fat area (CMO:0001162)1173108781218108781Rat
1581503Cm58Cardiac mass QTL 582.70.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)343827364121056321Rat
2292613Ept16Estrogen-induced pituitary tumorigenesis QTL 168.3pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)347233430110362260Rat
631200Cm25Cardiac mass QTL 254.80.0001heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)36113434889115068Rat
7771612Cm80Cardiac mass QTL 808.4heart left ventricle mass (VT:0007031)heart left ventricle weight (CMO:0000776)1149448574221264292Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
2293654Bss30Bone structure and strength QTL 3032.650.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1171629477216629477Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
1358292Cm37Cardiac mass QTL 376.28e-07heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
634312Bp143Blood pressure QTL 14330.0002arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1182623426219932796Rat
1300178Hrtrt4Heart rate QTL 43.74heart pumping trait (VT:2000009)heart rate (CMO:0000002)34382736490905114Rat
61377Edpm3Estrogen-dependent pituitary mass QTL 37.050.038pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)35318469289878207Rat
1358294Bw37Body weight QTL 3750.000011body mass (VT:0001259)body weight (CMO:0000012)1171310381216310381Rat
2301414Kidm37Kidney mass QTL 370.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)370653097121056321Rat
2312420Pur17Proteinuria QTL 177.10.0001urine protein amount (VT:0005160)urine total protein excretion rate (CMO:0000756)1156677124218753816Rat
10059600Bp378Blood pressure QTL 3783.080.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1176869060221869060Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
2292218Kidm35Kidney mass QTL 35kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1199368955224569684Rat
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
1300168Bp170Blood pressure QTL 1702.76arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1207702246228581766Rat
61403Niddm4Non-insulin dependent diabetes mellitus QTL 4blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1206329708222745518Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
1559282Emca5Estrogen-induced mammary cancer QTL 53.9mammary gland integrity trait (VT:0010552)percentage of study population developing mammary tumors during a period of time (CMO:0000948)343827364169034231Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)33035677398535386Rat
634340Hcar5Hepatocarcinoma resistance QTL 58liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1214537555226660468Rat
1581546Pur13Proteinuria QTL 132.930.0335urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)378196190146592722Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X65612192120568734Rat
738035Stresp1Stress response QTL 14.960.000011stress-related behavior trait (VT:0010451)defensive burying - copingX41304447112935181Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499328 UniSTS
UniSTS 211336 UniSTS