RH127385 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH127385

Symbol: RH127385
Previously known as: AA818112; RH140869; 
RGD ID: 5038878
Expected Size: 200 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21134,219,037 - 134,219,237 (+)MAPPERmRatBN7.2
mRatBN7.21571,453,689 - 71,453,882 (+)MAPPERmRatBN7.2
Rnor_6.01579,001,396 - 79,001,588NCBIRnor6.0
Rnor_6.01142,056,026 - 142,056,225NCBIRnor6.0
Rnor_5.01582,544,164 - 82,544,356UniSTSRnor5.0
Rnor_5.01143,008,869 - 143,009,068UniSTSRnor5.0
RGSC_v3.41136,081,003 - 136,081,202UniSTSRGSC3.4
RGSC_v3.41578,003,405 - 78,003,597UniSTSRGSC3.4
Celera1570,798,755 - 70,798,947UniSTS
Celera1126,279,071 - 126,279,270UniSTS
RH 3.4 Map11068.9UniSTS
Cytogenetic Map15q21UniSTS
Cytogenetic Map1q31UniSTS
Is Marker For: Genes:   Ngrn   Ngrn-ps3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTTTCAACTTCCTCCCAACAC
Reverse Primer AGTAAGAGTCGATGAGGCCAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1583734Ngrnneugrin, neurite outgrowth associated1134213235134219348Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)152803066582262678Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)152803066582262678Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
2293691Bmd37Bone mineral density QTL 376.60.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)153361105871477291Rat
2293686Bmd36Bone mineral density QTL 367.40.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)153361105871477291Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)153405413979054139Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
724545Niddm54Non-insulin dependent diabetes mellitus QTL 540.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)155079449473699215Rat
2317050Aia24Adjuvant induced arthritis QTL 242.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)155284790873690657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
61477Aia4Adjuvant induced arthritis QTL 43joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)155559608991365858Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
2313080Bss65Bone structure and strength QTL 653.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)156099046873690657Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
724548Niddm55Non-insulin dependent diabetes mellitus QTL 550.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)156832736073699069Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)190508614173018436Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)190508614180359386Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)190664883143200202Rat
2293142Bp314Blood pressure QTL 314arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192184926137184926Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)192948896144267916Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194494440172949803Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194494440181830018Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)194494440198211706Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)194494440198324465Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)194642722214537671Rat
61346Rf2Renal disease susceptibility QTL 23.7urine protein amount (VT:0005160)urine protein level (CMO:0000591)199267916144267916Rat
61399Tcat1Tongue tumor resistance QTL 13.3tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879)199267916144267916Rat
8655649Arrd1Age-related retinal degeneration QTL 14.89retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1100357752183970443Rat
2317833Alcrsp19Alcohol response QTL 1912.40.001response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
1641897Alcrsp1Alcohol response QTL 1response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1100979852145979852Rat
2303591Gluco41Glucose level QTL 412blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1102168504147168504Rat
61370Mcs3Mammary carcinoma susceptibility QTL 32.15mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1102268556147268556Rat
1354623Rf46Renal function QTL 463.8blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)1102813953151162766Rat
1354591Cm36Cardiac mass QTL 364.1heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1102813953201278233Rat
1354615Cm32Cardiac mass QTL 325.2heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1102813953201278233Rat
1354606Bp246Blood pressure QTL 2463.6arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)1102813953218753816Rat
9590300Scort16Serum corticosterone level QTL 164.390.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1103111621148111621Rat
8694370Bw154Body weight QTL 1548.910.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)1103111621148111621Rat
631496Bp97Blood pressure QTL 973.08arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1106047847151047847Rat
1300158Bp173Blood pressure QTL 1733.48arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1115540693185145286Rat
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
631199Cm23Cardiac mass QTL 234.60.0004heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)1115585465172949803Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
2313060Bss71Bone structure and strength QTL 712.60.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)1118944747163944747Rat
631205Bp196Blood pressure QTL 19640.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118944897199050459Rat
1598850Bp297Blood pressure QTL 2972.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
1598866Bp287Blood pressure QTL 2875.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121006655166006655Rat
61442Strs1Sensitivity to stroke QTL 17.4cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)1121767634166767634Rat
2293140Bp313Blood pressure QTL 313arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1121833674166833674Rat
631544Bp84Blood pressure QTL 845.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350408181759564Rat
1358189Cstrr1Cold stress response QTL 10.0001catecholamine amount (VT:0010543)urine norepinephrine level (CMO:0001629)1123350408182418476Rat
1641895Bp298Blood pressure QTL 298arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1123350408182418476Rat
1578770Stresp23Stress response QTL 23kidney sympathetic nerve activity (VT:0004050)stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786)1123350408182418476Rat
631549Bp89Blood pressure QTL 895.7arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123350581201284552Rat
631570Bp94Blood pressure QTL 940.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1123479780142990467Rat
634348Bp138Blood pressure QTL 138arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501168883176Rat
9685799Bp375Blood pressure QTL 375arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
631654Bp107Blood pressure QTL 107arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1125611501170611501Rat
9685802Bp376Blood pressure QTL 376arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1126540680171540680Rat
738006Anxrr14Anxiety related response QTL 1440.00035locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
738028Anxrr12Anxiety related response QTL 124.90.00001locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1130636910175636910Rat
631202Gluco13Glucose level QTL 130.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1131763437159756369Rat
6893347Bw98Body weight QTL 980.20.53body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
6893361Bw104Body weight QTL 1040.590.27body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat
1558645Bw55Body weight QTL 553.20.004body mass (VT:0001259)body weight (CMO:0000012)1133680936178680936Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 499191 UniSTS
  692026 UniSTS
UniSTS 210695 UniSTS