AU049031 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU049031

Symbol: AU049031
Also known as:
RGD ID: 5036733
Expected Size: 212 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.02180,252,520 - 180,252,702NCBIRnor6.0


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCGAGGACTGGTAAAAATG
Reverse Primer TAGTCTCCAAGAACAGCTTCCTTT
 

Region

Nucleotide Sequences
GenBank Nucleotide AU049031 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
UniSTS 145479 UniSTS