AU048913 Marker Search Result - Rat Genome Database

Send us a Message



 Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap)  (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AU048913

Symbol: AU048913
Previously known as:
RGD ID: 5036699
Expected Size: 190 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21826,124,824 - 26,125,014 (+)MAPPERmRatBN7.2
mRatBN7.21751,295,090 - 51,296,033 (+)MAPPERmRatBN7.2
Rnor_6.01753,988,032 - 53,988,974NCBIRnor6.0
Rnor_6.01827,318,371 - 27,318,560NCBIRnor6.0
Rnor_5.01827,031,743 - 27,031,932UniSTSRnor5.0
Rnor_5.01751,681,693 - 51,682,636UniSTSRnor5.0
RGSC_v3.41759,490,301 - 59,491,243UniSTSRGSC3.4
RGSC_v3.41826,994,291 - 26,994,480UniSTSRGSC3.4
Celera1825,863,356 - 25,863,549UniSTS
Celera1747,302,843 - 47,303,785UniSTS
Cytogenetic Map17q12.1UniSTS
Is Marker For: Genes:   Tbce  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTCGCTGCACCTTTCCTTTT
Reverse Primer TGCTCTTCCAGAGGTCCTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305533Tbcetubulin folding cofactor E175129014351336090Rat

Nucleotide Sequences
GenBank Nucleotide AC114215 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU048913 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
12904690Cm129Cardiac mass QTL 1290.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)181194427326548295Rat
12904689Cm128Cardiac mass QTL 1280.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)181194427326548295Rat
12904693Am20Aortic mass QTL 200.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)181194427326548295Rat
12904695Kidm73Kidney mass QTL 730.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)181194427326548295Rat
12904691Cm130Cardiac mass QTL 1300.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)181194427326548295Rat
12904680Bw189Body weight QTL 1890.019body mass (VT:0001259)body weight (CMO:0000012)181194427326548295Rat
2301410Bp317Blood pressure QTL 3170.004arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194427326548295Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
1331735Rf44Renal function QTL 442.981urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181823456431359530Rat
1331775Bp235Blood pressure QTL 2353.201arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181823456431359530Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182206624252293055Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171533061355836425Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat
7394837Memor18Memory QTL 18exploratory behavior trait (VT:0010471)measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957)171864018263640182Rat
1354628Stl13Serum triglyceride level QTL 133.8blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)172129303960781592Rat
61394Bp8Blood pressure QTL 82.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172308056759555013Rat
7488966Bp370Blood pressure QTL 3700.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318457246843Rat
12903978Cm118Cardiac mass QTL 1180.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)172365318468653184Rat
12903979Cm119Cardiac mass QTL 1190.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172365318468653184Rat
12903980Cm120Cardiac mass QTL 1200.002heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)172365318468653184Rat
12903981Am17Aortic mass QTL 170.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)172365318468653184Rat
1559055Bp278Blood pressure QTL 2780.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)172365318468653184Rat
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
1354619Bp242Blood pressure QTL 2426.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)172459934069599340Rat
1581512Cm55Cardiac mass QTL 552.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)172702794956836890Rat
4889955Bss93Bone structure and strength QTL 934.4tibia size trait (VT:0100001)tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727)172702794960463643Rat
2302377Scl61Serum cholesterol level QTL 614.36blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)172738994653481766Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
10450503Bp386Blood pressure QTL 3860.28arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)173136839162109574Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
724528Uae4Urinary albumin excretion QTL 44.90.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)173583708569599340Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
631497Bp98Blood pressure QTL 983.66arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)174135465160463643Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)174207316069599340Rat
1354635Bp245Blood pressure QTL 2456arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)174207316069599340Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
1354629Scl31Serum cholesterol level QTL 314.1blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)175089090860781592Rat
1354654Spl7Serum phospholipid level QTL 75.5blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)175089090860781592Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
2317053Aia25Adjuvant induced arthritis QTL 252.69joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)175090919660781426Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 361255 UniSTS
UniSTS 145363 UniSTS