RH129797 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH129797

Symbol: RH129797
Previously known as: AA996793; 
RGD ID: 5025818
Expected Size: 212 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2166,075,259 - 66,075,471 (+)MAPPERmRatBN7.2
mRatBN7.2286,997,437 - 86,997,649 (+)MAPPERmRatBN7.2
Rnor_6.0164,640,947 - 64,641,158NCBIRnor6.0
Rnor_6.0288,350,871 - 88,351,082NCBIRnor6.0
Rnor_5.02108,121,279 - 108,121,490UniSTSRnor5.0
Rnor_5.0163,632,884 - 63,633,095UniSTSRnor5.0
RGSC_v3.4164,400,317 - 64,400,528UniSTSRGSC3.4
RGSC_v3.4288,346,343 - 88,346,554UniSTSRGSC3.4
Celera282,587,890 - 82,588,101UniSTS
Celera163,796,300 - 63,796,511UniSTS
RH 3.4 Map1742.29UniSTS
Cytogenetic Map2q23UniSTS
Cytogenetic Map1q12UniSTS
Is Marker For: Genes:   E2f5   Rbis   LOC683688   LOC691060  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGAATGTCAGAATCAACAAAC
Reverse Primer CAGGCTTCAGTTCATCATAACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621357E2f5E2F transcription factor 528699733187012908Rat
41035119E2f5-ps1E2F transcription factor 5, pseudogene 116607514466076828Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578777Stresp15Stress response QTL 1520.05blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)259846005104846005Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)281018907126018907Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)282345893130923501Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243162366111362592Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)243162366111362592Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)276539322102785628Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)240067944102785628Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
5684990Bmd82Bone mineral density QTL 822.8tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)259324377103795077Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
7411551Bw131Body weight QTL 13129.60.001body mass (VT:0001259)body weight gain (CMO:0000420)267942638112942638Rat
1359034Bp274Blood pressure QTL 274arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)27478666494359546Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
61371Edpm1Estrogen-dependent pituitary mass QTL 140.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)23513484188029593Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
631500Bp99Blood pressure QTL 992.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)259324719102755241Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)280270434125270434Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
5684996Bmd85Bone mineral density QTL 854.70.024tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)259324377103795077Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)259134147127460910Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)264366971109366971Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)13523959878430678Rat
1578777Stresp15Stress response QTL 1520.05blood aldosterone amount (VT:0005346)plasma aldosterone level (CMO:0000551)259846005104846005Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)15389511782174945Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)282345893130923501Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
61465Bp13Blood pressure QTL 133.3blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)276539322102785628Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
70174BpQTLCluster2Blood pressure QTL cluster 24.24arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)240067944102785628Rat
4889962Bss94Bone structure and strength QTL 943.8tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14936146582174945Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
7411551Bw131Body weight QTL 13129.60.001body mass (VT:0001259)body weight gain (CMO:0000420)267942638112942638Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)13523959878430678Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)11148131282174945Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
1357400Bw62Body weight QTL624.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)12234064767340647Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
5684996Bmd85Bone mineral density QTL 854.70.024tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)259324377103795077Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14580314078430678Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)12887978078430678Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)259134147127460910Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)13344984878449848Rat
2306903Bp336Blood pressure QTL 3360.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)264366971109366971Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)15389511782174945Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)13344984878449848Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)281018907126018907Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
2293676Bmd19Bone mineral density QTL 1910.70.0001femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)243162366111362592Rat
2293682Bmd24Bone mineral density QTL 248.90.0001femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)243162366111362592Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
5684990Bmd82Bone mineral density QTL 822.8tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)259324377103795077Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
1359034Bp274Blood pressure QTL 274arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)27478666494359546Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)13483685879836858Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61371Edpm1Estrogen-dependent pituitary mass QTL 140.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)23513484188029593Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
631500Bp99Blood pressure QTL 992.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)259324719102755241Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)280270434125270434Rat
1300167Hrtrt2Heart rate QTL 24.35heart pumping trait (VT:2000009)heart rate (CMO:0000002)11148131275088344Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 116651 UniSTS
  499567 UniSTS
  683688 UniSTS
  691060 UniSTS
UniSTS 213089 UniSTS