D18Got3 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Got3

Symbol: D18Got3
Previously known as: OT55.07; oxsts1415; 
RGD ID: 45595
Expected Size: 281 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21571,268,474 - 71,270,091 (+)MAPPERmRatBN7.2
mRatBN7.22211,768,247 - 211,768,497 (+)MAPPERmRatBN7.2
Rnor_6.02227,801,840 - 227,802,089NCBIRnor6.0
Rnor_6.01578,818,211 - 78,819,827NCBIRnor6.0
Rnor_5.01582,360,979 - 82,362,595UniSTSRnor5.0
Rnor_5.02247,157,620 - 247,157,869UniSTSRnor5.0
RGSC_v3.4335,596,780 - 35,597,061RGDRGSC3.4
RGSC_v3.42220,339,029 - 220,339,279RGDRGSC3.4
RGSC_v3.12220,302,091 - 220,302,341RGD
Celera1570,621,751 - 70,623,367UniSTS
Celera2204,179,888 - 204,180,137UniSTS
RH 2.0 Map18829.0RGD
Cytogenetic Map2q42UniSTS
Is Marker For: Genes:   Ndst3  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCAGAGTGGTTGTACCAGCTT
Reverse Primer CTCTTAAGAAGGACCGAAGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310960Ndst3N-deacetylase and N-sulfotransferase 32211702728211868159Rat

Nucleotide Sequences
GenBank Nucleotide AU028400 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618509.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat
1554319Bmd2Bone mineral density QTL 213.40.0001lumbar vertebra area (VT:0010570)lumbar vertebra cross-sectional area (CMO:0001689)2114837675212549332Rat
1359022Ppulsi1Prepulse inhibition QTL 13.63prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)2136916935213594495Rat
1331794Bp202Blood pressure QTL 2023.66819arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2141194931223265385Rat
1331805Cm29Cardiac mass QTL 293.50746heart mass (VT:0007028)heart wet weight (CMO:0000069)2141194931223265385Rat
1641925Alcrsp2Alcohol response QTL 2response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561221167075Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
8662843Vetf9Vascular elastic tissue fragility QTL 92.05thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2157142078226277316Rat
1358356Srcrt1Stress Responsive Cort QTL13.66blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)2161699179222436696Rat
2306901Bp337Blood pressure QTL 3370.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2164073756227146641Rat
1331734Bp204Blood pressure QTL 2043.61192arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2168358098223265385Rat
2307174Activ3Activity QTL 34.830.000058locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)2168594495213594495Rat
61469Bp16Blood pressure QTL 165.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
70162Bp63Blood pressure QTL 635.64arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)2169745596214745596Rat
2293084Iddm26Insulin dependent diabetes mellitus QTL 262.9blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2174930955213594495Rat
2300189Bmd48Bone mineral density QTL 485.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)2179335906224335906Rat
61417Cia10Collagen induced arthritis QTL 103.4joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)2179946951224946951Rat
8694435Bw166Body weight QTL 16614.080.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)2182171407227171407Rat
9589044Scfw1Subcutaneous fat weight QTL 15.80.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)2182171407227171407Rat
8694383Bw158Body weight QTL 1587.690.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)2182171407227171407Rat
8694194Abfw1Abdominal fat weight QTL 111.70.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)2182171407227171407Rat
738013Alc15Alcohol consumption QTL 154.10.00022consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)2184165752229165752Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2185876309219753474Rat
1359031Bp275Blood pressure QTL 275arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)2185876309219753474Rat
61458Bp10Blood pressure QTL 103.42arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
1298083Bp158Blood pressure QTL 1582.62arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189020722215287351Rat
1331745Bp203Blood pressure QTL 2034.377arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2189599258218414891Rat
1581499Esta2Estrogen-induced thymic atrophy QTL 2thymus mass (VT:0004954)thymus wet weight (CMO:0000855)2189599258226936289Rat
61366Iddm3Insulin dependent diabetes mellitus QTL 34.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)2189599258234599258Rat
61398Bp50Blood pressure QTL 504.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2189599258234599258Rat
2301408Kidm36Kidney mass QTL 360.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)2190613715226808892Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2193452645245889826Rat
1598813Memor9Memory QTL 92.7exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)2199341726234244620Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2200990457245990457Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2202446871237938339Rat
2299161Iddm33Insulin dependent diabetes mellitus QTL 332.98blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2206312063220876787Rat
631203Gluco14Glucose level QTL 140.0001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)2206665645219003804Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2211744537249053267Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2211744537249053267Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2211744537249053267Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2211744537249053267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2211744537249053267Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)152803066582262678Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)152803066582262678Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
2293691Bmd37Bone mineral density QTL 376.60.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)153361105871477291Rat
2293686Bmd36Bone mineral density QTL 367.40.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)153361105871477291Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)153405413979054139Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
724545Niddm54Non-insulin dependent diabetes mellitus QTL 540.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)155079449473699215Rat
2317050Aia24Adjuvant induced arthritis QTL 242.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)155284790873690657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
61477Aia4Adjuvant induced arthritis QTL 43joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)155559608991365858Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
2313080Bss65Bone structure and strength QTL 653.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)156099046873690657Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
724548Niddm55Non-insulin dependent diabetes mellitus QTL 550.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)156832736073699069Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 295430 UniSTS
UniSTS 112364 UniSTS